The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010438	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4619729	1010163	1058847	4619729	integrase,transposase	Streptococcus_phage(20.0%)	49	1024649:1024708	1058957:1059016
WP_000006255.1|1010163_1010661_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|1010884_1012624_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|1012568_1013354_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|1013424_1014480_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|1014531_1014825_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|1014827_1015226_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|1015235_1015688_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|1015993_1016260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|1016192_1016729_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|1016785_1018243_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1018503_1018962_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|1019053_1020298_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|1020355_1020757_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|1020795_1021851_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|1022138_1023242_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|1023253_1024507_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
1024649:1024708	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|1025078_1025420_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|1025440_1025758_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|1025776_1025998_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|1026006_1026483_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|1026498_1026957_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|1027054_1027294_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|1027370_1027838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|1027860_1028304_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|1028303_1028531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|1028934_1029756_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|1029847_1030711_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|1031039_1031933_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|1032353_1033505_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|1035851_1036868_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|1037075_1038479_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|1038465_1039398_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|1039506_1040553_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|1041774_1042113_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|1042135_1042486_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|1042579_1043734_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|1044028_1044937_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|1044951_1046919_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|1047145_1048528_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|1048539_1050150_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|1050154_1050913_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|1051051_1052056_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|1053250_1053982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|1054072_1054699_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|1054970_1055669_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|1055695_1056550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|1056668_1056893_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|1056889_1057330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|1057446_1058847_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
1058957:1059016	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP010438	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4619729	1278445	1338783	4619729	integrase,terminase,transposase,protease,tRNA	Enterobacteria_phage(43.48%)	61	1324062:1324108	1342743:1342789
WP_001295836.1|1278445_1279069_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1279039_1279726_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1279722_1282137_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|1282567_1286848_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|1286887_1287256_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|1287946_1288207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|1289438_1290533_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1290601_1291528_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|1291757_1292240_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1292317_1293133_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|1293222_1295004_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|1295016_1295793_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1295892_1296771_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|1296939_1298394_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|1298453_1299815_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1299871_1301173_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|1301194_1302340_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_038432500.1|1302549_1303353_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|1303363_1304599_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|1304620_1305670_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|1305986_1307654_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|1307663_1308923_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|1308933_1309749_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|1309745_1310639_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|1310833_1311901_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1311897_1312407_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|1312524_1313247_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|1313249_1313744_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|1313917_1315303_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|1315338_1315860_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1315967_1316180_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1316181_1317048_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1317518_1318061_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1318280_1318973_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|1319003_1321607_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1321585_1322626_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1322636_1323152_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1323154_1323787_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1324062:1324108	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|1324121_1325285_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|1325404_1325668_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|1325990_1326086_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|1326148_1326448_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|1326444_1327311_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|1327621_1327954_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|1328001_1328151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1328208_1329735_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|1330199_1330751_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1330760_1331558_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1331674_1331776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|1331772_1332228_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|1332227_1332398_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1332390_1332681_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|1332677_1333040_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1333036_1333177_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|1333262_1333646_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|1334043_1335060_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000079503.1|1335092_1335503_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1335788_1335995_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1336159_1336354_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_071842869.1|1337663_1338065_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	97.7	7.8e-63
WP_001027248.1|1338039_1338783_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
1342743:1342789	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP010438	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4619729	1949532	1970925	4619729	portal,integrase,tRNA,plate,tail	Shigella_phage(31.58%)	31	1941527:1941541	1977628:1977642
1941527:1941541	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1949532_1950639_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1950692_1951154_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1951163_1951817_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1951988_1953239_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1953732_1954398_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1954398_1955103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1955560_1956454_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1956544_1957672_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1957652_1957898_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1957934_1958246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1958362_1958704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1958641_1958950_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1959124_1959799_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1959889_1960090_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1960133_1960691_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1960866_1961046_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1961035_1962403_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1962414_1962597_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1962596_1963070_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1962996_1963788_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1963778_1964363_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554707.1|1964366_1965155_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000548498.1|1965154_1965757_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|1965728_1966142_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000905001.1|1966550_1967105_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1967211_1968045_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943927.1|1968278_1968443_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1968545_1968869_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1969405_1969516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1969568_1969973_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1970193_1970925_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1977628:1977642	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP010438	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4619729	2162229	2226175	4619729	integrase,transposase,tRNA,lysis,tail	Escherichia_phage(40.62%)	60	2152889:2152907	2183263:2183281
2152889:2152907	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000628058.1|2162229_2163462_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2163716_2164700_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2165177_2166551_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2166679_2167615_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2167666_2168902_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2168903_2169119_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2169197_2169407_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2169399_2169594_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2169650_2170460_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|2170452_2173053_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|2173154_2173430_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2173504_2173675_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|2173674_2173896_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|2174337_2174826_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2174822_2174978_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|2175431_2175908_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2176031_2176328_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|2176350_2176773_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|2176785_2177643_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|2177649_2178396_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|2178418_2178979_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|2179066_2179252_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2179448_2180906_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|2181042_2181306_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|2181286_2181646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|2183411_2184392_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2183263:2183281	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_071842875.1|2184714_2188077_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	6.2e-12
WP_001698950.1|2188076_2188652_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|2188749_2189340_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|2189656_2189890_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|2189958_2190072_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|2190850_2191285_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2191425_2192559_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_000628244.1|2192925_2196450_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|2196723_2196990_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|2196986_2197409_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|2197519_2198509_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_046377550.1|2198716_2201296_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|2201352_2201538_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|2201545_2201872_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|2202043_2202949_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|2203184_2204684_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|2204741_2207015_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|2207262_2209308_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|2209592_2210522_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|2210533_2210821_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|2210829_2211576_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|2211590_2212088_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|2212095_2213166_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|2213162_2213930_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|2213929_2214718_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|2214719_2216147_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|2216136_2216559_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|2216558_2217764_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|2217790_2219104_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|2219204_2220155_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|2220136_2220727_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|2220830_2220896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|2223586_2224860_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001254932.1|2225023_2226175_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 5
NZ_CP010438	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4619729	2385117	2404328	4619729	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|2385117_2386578_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2386666_2387950_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2388554_2388668_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2388736_2388970_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000078177.1|2389286_2389877_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2389974_2390550_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|2390549_2391512_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2391462_2392032_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|2392420_2392654_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2392711_2393122_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2393273_2393447_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2393618_2393774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2393852_2393918_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2393920_2394109_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2394119_2394332_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2394694_2395192_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2395188_2395722_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2395718_2396030_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2396034_2396250_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2397003_2397219_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2397519_2397732_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2397786_2397876_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2398153_2398906_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2398919_2399969_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2399970_2400249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2400315_2400567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2400783_2400939_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2401010_2401298_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2401297_2401537_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2401561_2401867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2402069_2402402_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2402838_2402988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2403284_2403515_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2403598_2404006_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2404172_2404328_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 6
NZ_CP010438	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4619729	3220926	3232137	4619729	integrase,tail	Enterobacteria_phage(50.0%)	17	3218901:3218917	3235812:3235828
3218901:3218917	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|3220926_3221859_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|3222170_3223328_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|3223480_3223843_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|3223839_3224760_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|3224756_3226088_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|3226122_3226404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|3226702_3227143_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|3227169_3227688_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|3227737_3228013_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|3228012_3228507_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|3228503_3228872_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|3229230_3229593_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|3229658_3230483_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|3230610_3231147_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|3231137_3231500_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|3231499_3231805_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|3231936_3232137_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3235812:3235828	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 7
NZ_CP010438	Escherichia coli K-12 strain K-12 MG1655 chromosome, complete genome	4619729	3606268	3613407	4619729		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|3606268_3608830_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|3608935_3609592_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|3609642_3610440_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|3610605_3611514_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|3611510_3612677_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278991.1|3612768_3613407_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
