The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007523	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 chromosome, complete genome	4769471	334119	354539	4769471	tail,plate,holin	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|334119_334848_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|335044_335335_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|335583_336039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|336035_336641_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|336645_338391_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|338393_339026_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|339018_340134_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|340124_340484_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|340647_342195_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|342194_343124_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|343120_343483_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|343810_344533_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|344542_345586_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|345573_345783_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|345782_346736_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|346735_349090_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|349186_349315_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|349274_349592_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|349643_350168_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|350167_351595_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|351584_351782_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|351778_352234_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|352393_352708_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|352720_353326_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|353328_353616_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|354191_354539_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 2
NZ_CP007523	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 chromosome, complete genome	4769471	1018129	1083461	4769471	plate,transposase,tRNA,protease	uncultured_Mediterranean_phage(10.0%)	55	NA	NA
WP_000753958.1|1018129_1019557_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
WP_000929420.1|1019709_1020867_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272193.1|1020955_1021342_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_000017194.1|1021588_1022890_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001186673.1|1022926_1023751_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094519.1|1023780_1026453_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018214.1|1026689_1027484_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246886.1|1027934_1028660_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000808106.1|1028917_1029769_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224567.1|1029913_1030639_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622423.1|1030785_1031343_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811905.1|1031483_1032680_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000947413.1|1032992_1033751_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
WP_000922422.1|1033763_1034621_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000949017.1|1034632_1035985_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240935.1|1036016_1038431_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758966.1|1038553_1039039_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139265.1|1039042_1040068_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210741.1|1040173_1040629_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565950.1|1040632_1041421_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000741212.1|1041420_1042569_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569412.1|1042565_1043162_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
WP_001294826.1|1043185_1046668_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055753.1|1046680_1047640_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_000502119.1|1047834_1048293_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000524168.1|1048531_1050295_+	chitinase	NA	NA	NA	NA	NA
WP_001021054.1|1050370_1052512_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901088.1|1052567_1052957_+	VOC family protein	NA	NA	NA	NA	NA
WP_000210056.1|1053019_1054312_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062330.1|1054395_1054656_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_001518678.1|1054642_1054843_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185319.1|1055040_1055586_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000560527.1|1055582_1056005_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000252573.1|1056036_1056738_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001260683.1|1056811_1058530_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000093986.1|1058640_1059348_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202315.1|1059344_1059749_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874215.1|1059867_1060683_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001287486.1|1060721_1061375_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594021.1|1061367_1062399_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001051726.1|1062588_1063155_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000154871.1|1069413_1070217_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.1e-38
WP_000648534.1|1070237_1071152_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001127538.1|1071256_1072432_+	MFS transporter	NA	NA	NA	NA	NA
WP_001230968.1|1072563_1073364_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000207224.1|1073441_1074212_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644706.1|1074267_1075635_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_001052775.1|1075706_1076462_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000801238.1|1076496_1077219_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917872.1|1077215_1077683_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_001670675.1|1077746_1078478_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000367626.1|1079009_1080065_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000145244.1|1080075_1081071_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000371508.1|1081067_1082951_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000108007.1|1082966_1083461_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP007523	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 chromosome, complete genome	4769471	1750071	1758803	4769471	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1750071_1751190_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1751186_1753133_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1753262_1753484_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1753807_1754128_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1754158_1756435_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1756626_1757085_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_085983316.1|1757547_1758803_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 4
NZ_CP007523	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 chromosome, complete genome	4769471	1808866	1907674	4769471	tail,holin,protease,portal,lysis,tRNA,terminase	Salmonella_phage(42.11%)	102	NA	NA
WP_001154025.1|1808866_1809670_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1809662_1810985_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1810965_1811670_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1811669_1816136_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|1816480_1818322_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1818581_1819130_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1819157_1819805_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1819866_1821057_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1821241_1822333_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1822939_1824340_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1824540_1825002_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1825318_1826533_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1826777_1828214_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1828291_1829494_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1829688_1830981_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1831025_1831274_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1831314_1831554_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1831596_1832754_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1832716_1835602_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1835728_1836028_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1836049_1836208_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_077905303.1|1836200_1836461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1836510_1836921_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1837040_1837280_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1837245_1837620_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1837704_1838688_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1838690_1839440_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1839450_1839798_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1839794_1840106_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1840183_1840474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1840765_1840999_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1841110_1841332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1841414_1842017_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1842225_1842837_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1842833_1842980_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1842969_1843767_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1843833_1844151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1844324_1844450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1844585_1845035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1845395_1846082_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1846357_1846687_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1846670_1847123_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1847140_1847620_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1847827_1848361_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1848317_1850456_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1850452_1850659_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|1850655_1852203_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|1852126_1854208_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1854298_1854622_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1854614_1854914_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1854894_1855461_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1855457_1855859_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1855870_1856620_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1856665_1857064_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1857060_1857390_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_077905305.1|1857469_1860457_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	4.8e-266
WP_000978296.1|1860453_1860786_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1860884_1861382_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1861498_1862032_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1862121_1862817_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1862826_1863564_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1863461_1864166_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541992.1|1864237_1866685_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_001541993.1|1866711_1867587_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178849.1|1867625_1867868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1867921_1870360_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1870359_1870941_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1871416_1872385_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1873032_1873659_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1873727_1874027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1874011_1874698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1874968_1875160_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1875586_1878199_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1878406_1879417_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1879582_1880125_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1880121_1881231_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|1881329_1883438_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1883450_1885358_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1885372_1886626_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1886630_1888271_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1888267_1888831_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1889086_1889254_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1889353_1889872_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1889940_1891701_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1891886_1892339_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1892410_1893463_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1893819_1894329_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1894545_1895151_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1895137_1897291_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1897309_1897756_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1897879_1899934_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1899969_1900428_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1900522_1901185_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1901358_1901772_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1901816_1902134_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1902191_1903403_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1903617_1904166_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1904191_1904971_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1905019_1905301_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1905297_1905627_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1905713_1906373_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1906993_1907674_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 5
NZ_CP007523	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 chromosome, complete genome	4769471	2695649	2702458	4769471	tail,integrase	Salmonella_phage(33.33%)	11	2690512:2690534	2700227:2700249
2690512:2690534	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|2695649_2696531_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|2697003_2697192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2697256_2697424_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|2697680_2698214_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|2698267_2698498_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|2698687_2699182_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_176731523.1|2699253_2700096_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.3e-71
WP_000722368.1|2700469_2700823_-	YebY family protein	NA	NA	NA	NA	NA
2700227:2700249	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|2700839_2701715_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|2701715_2702090_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|2702227_2702458_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 6
NZ_CP007523	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 chromosome, complete genome	4769471	2806502	2813756	4769471		Morganella_phage(33.33%)	8	NA	NA
WP_001157322.1|2806502_2807933_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2808006_2808702_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2808793_2809093_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2809742_2810939_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2811199_2811388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2811398_2811611_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2812065_2813334_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2813336_2813756_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 7
NZ_CP007523	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 chromosome, complete genome	4769471	2903099	2913605	4769471		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2903099_2904413_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2904439_2905519_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2905523_2906297_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2906293_2907286_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2907291_2907843_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2907843_2908722_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2908769_2909669_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2909668_2910754_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2911130_2912024_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2912201_2913605_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 8
NZ_CP007523	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 chromosome, complete genome	4769471	2981913	2991084	4769471	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2981913_2983947_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2984187_2984646_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2984817_2985348_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2985404_2985872_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2985918_2986638_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2986634_2988320_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2988542_2989274_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2989333_2989441_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2989421_2990153_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2990136_2991084_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 9
NZ_CP007523	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 chromosome, complete genome	4769471	3010491	3076878	4769471	tail,lysis,holin	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|3010491_3011187_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|3011340_3012225_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|3012401_3013121_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|3013117_3013363_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|3013567_3014809_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|3014802_3016038_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|3016112_3017123_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|3017138_3018659_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|3018792_3019791_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|3020289_3021312_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|3021461_3022604_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|3022618_3023287_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|3023616_3024474_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|3024462_3024852_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|3024856_3026224_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|3026440_3027328_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|3027360_3028683_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|3028726_3030718_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|3031063_3032533_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|3032722_3033586_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|3033706_3034756_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|3034834_3035692_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|3035756_3037445_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|3037461_3038400_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|3038399_3039530_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|3039898_3041080_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|3041144_3041810_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|3041811_3041934_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|3042321_3042576_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|3042899_3043472_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|3043684_3044671_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|3044700_3045420_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|3045833_3046406_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|3046731_3048288_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561747.1|3048394_3050200_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|3050209_3051304_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|3051303_3052329_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|3052330_3053920_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|3053923_3054268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|3054658_3055849_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|3055876_3056572_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|3056723_3058484_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|3058608_3058893_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|3059001_3059622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|3059649_3060657_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|3060836_3061064_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|3061095_3062856_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|3063136_3063640_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|3063667_3063958_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|3064296_3066126_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|3066179_3066623_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|3067000_3067528_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|3067530_3068772_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|3069364_3069694_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|3069990_3071322_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|3071350_3071719_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|3071733_3072723_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|3073051_3075418_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|3075586_3075790_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|3076086_3076878_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 10
NZ_CP007523	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 chromosome, complete genome	4769471	3467106	3590868	4769471	tail,head,portal,lysis,tRNA,integrase,terminase,plate,capsid	Salmonella_phage(75.0%)	111	3465987:3466002	3594787:3594802
3465987:3466002	attL	TTGATTTAATTATCTC	NA	NA	NA	NA
WP_000083343.1|3467106_3467844_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|3467974_3469309_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|3469326_3470226_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|3470328_3470916_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|3470977_3471361_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|3471679_3472369_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|3472484_3473522_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|3473725_3474145_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183639.1|3474217_3474898_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082639.1|3474951_3477612_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|3477726_3479082_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|3479126_3479450_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807809.1|3479446_3480748_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_000985653.1|3480851_3481307_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235094.1|3487187_3489761_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000992639.1|3489890_3490622_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|3490618_3491599_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|3491730_3492468_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_046338476.1|3492739_3493078_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|3493181_3493229_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200080.1|3493328_3494489_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210995.1|3494449_3495358_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|3495415_3496537_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|3496546_3497617_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|3498056_3498575_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|3498567_3499788_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|3499944_3500292_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|3500332_3501100_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|3501144_3501693_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|3501711_3501960_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|3502273_3503635_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|3503800_3504592_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|3504611_3505898_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|3506018_3506624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|3506658_3507249_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|3507371_3508250_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|3508335_3509997_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|3510145_3510484_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|3510649_3510940_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|3510929_3511406_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|3511555_3512038_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237667.1|3512651_3524126_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533858.1|3524190_3525600_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|3525596_3527777_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|3527784_3528948_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980500.1|3529499_3529718_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|3529786_3530887_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|3530883_3531369_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001282770.1|3531365_3534173_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.8	0.0e+00
WP_000763316.1|3534165_3534285_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280964.1|3534299_3534602_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	99.0	1.6e-44
WP_001207651.1|3534656_3535172_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046108.1|3535181_3536354_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_000974843.1|3536456_3536681_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|3537550_3538126_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001274645.1|3538125_3539979_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	99.8	0.0e+00
WP_001086801.1|3539975_3540581_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	99.5	1.1e-116
WP_000268332.1|3540573_3541482_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000189373.1|3541468_3541828_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|3541824_3542403_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|3542480_3543332_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|3543333_3543780_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|3543772_3544204_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|3544299_3544728_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001069921.1|3544724_3545240_-	lysozyme	NA	E5G6N1	Salmonella_phage	99.4	1.2e-95
WP_000171565.1|3545220_3545436_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|3545439_3545643_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673536.1|3545642_3546107_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	99.4	3.8e-85
WP_000059173.1|3546200_3546851_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730759.1|3546854_3547916_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000216276.1|3547932_3548766_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|3548908_3550675_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|3550674_3551715_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284992.1|3551818_3553483_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	99.8	0.0e+00
WP_001673609.1|3553796_3554474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3554587_3554821_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154433.1|3554831_3555020_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000301197.1|3555172_3557602_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.1	0.0e+00
WP_000104131.1|3557592_3558453_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	4.5e-132
WP_001090715.1|3558449_3559034_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.7	9.0e-76
WP_000785513.1|3559030_3559258_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	3.0e-35
WP_001244236.1|3559257_3559491_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	97.4	1.1e-32
WP_000963480.1|3559558_3559900_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
WP_000956166.1|3559863_3560064_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	98.5	1.2e-32
WP_000460861.1|3560071_3560581_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	99.4	3.6e-89
WP_000102102.1|3560613_3560856_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	100.0	1.1e-38
WP_000616878.1|3560975_3561608_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	100.0	1.1e-116
WP_001536726.1|3561611_3562637_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_010989063.1|3564257_3564851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|3565240_3566434_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_001161781.1|3566768_3567596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000701821.1|3568046_3568262_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520307.1|3568297_3570367_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_001520831.1|3570869_3572153_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010989064.1|3572197_3573016_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_010989065.1|3573169_3573526_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000749979.1|3573620_3573905_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_000480483.1|3574017_3574539_+	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000973738.1|3574535_3574910_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001098984.1|3574906_3575887_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001033832.1|3575897_3576911_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000889012.1|3577205_3578408_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000776032.1|3578481_3579117_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_001682344.1|3579140_3579704_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000811366.1|3579703_3580546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819716.1|3580675_3582217_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000021514.1|3582439_3584119_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000088556.1|3585235_3586111_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_001521074.1|3586276_3588151_+	membrane protein	NA	NA	NA	NA	NA
WP_010989066.1|3588410_3589694_-	membrane protein	NA	NA	NA	NA	NA
WP_001682341.1|3590271_3590868_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
3594787:3594802	attR	GAGATAATTAAATCAA	NA	NA	NA	NA
