The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	110227	249890	4635301	plate,integrase,protease,transposase,tRNA,head,capsid,tail,portal	uncultured_Caudovirales_phage(40.0%)	119	164121:164138	215258:215275
WP_080717485.1|110227_110764_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_038193119.1|113332_114823_+	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_038225121.1|114991_115429_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
WP_046335534.1|115537_115867_-	universal stress protein UspB	NA	NA	NA	NA	NA
WP_038193116.1|116062_116494_+	universal stress protein UspA	NA	NA	NA	NA	NA
WP_038224034.1|116751_118095_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_046335536.1|118176_118920_-	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_046335538.1|118926_120969_-	oligopeptidase A	NA	NA	NA	NA	NA
WP_046335539.1|121857_122184_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	39.0	2.7e-05
WP_172664694.1|122184_122529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335542.1|122879_124544_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_046335544.1|124562_125972_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_046335546.1|126907_127954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335547.1|128064_128379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335548.1|128540_128876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038207314.1|129231_129687_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_046335549.1|129874_130099_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_046335551.1|130679_131795_-	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_046335552.1|131778_132933_-	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_046335554.1|132961_133612_-	DUF4310 family protein	NA	NA	NA	NA	NA
WP_046335555.1|133614_134406_-	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_046335557.1|134421_134751_-	DUF4312 family protein	NA	NA	NA	NA	NA
WP_038207298.1|134734_135136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038207405.1|135166_135505_-	transcriptional antiterminator	NA	NA	NA	NA	NA
WP_046335558.1|135779_137699_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_155399051.1|137801_137957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335560.1|138298_139141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038212953.1|139151_139682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038224009.1|140050_140644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038197049.1|140640_141495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335562.1|141491_142223_-	amino acid racemase	NA	NA	NA	NA	NA
WP_052725976.1|142233_143331_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_038247119.1|143837_144464_-	type B chloramphenicol O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	39.3	2.4e-26
WP_046335563.1|144754_145696_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_038212938.1|145836_147147_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_038207274.1|147242_148457_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_038207271.1|148453_148909_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_046335565.1|148898_150497_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_038197681.1|150499_151297_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_038197680.1|151300_152074_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_046335567.1|152098_153184_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	C7BUZ5	Synechococcus_phage	47.1	5.5e-10
WP_046335568.1|153203_153707_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_046335570.1|153737_154514_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_038207257.1|154524_154812_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_038197674.1|154856_155798_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_046337796.1|156125_158198_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_038197673.1|158438_158711_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_038197671.1|158698_158989_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_038207251.1|159308_159845_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_046335571.1|161669_162764_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_172664695.1|162768_164085_-	YhfT family protein	NA	NA	NA	NA	NA
164121:164138	attL	CATTGATATCACTCATGA	NA	NA	NA	NA
WP_046335573.1|164146_164509_-	DUF2620 domain-containing protein	NA	NA	NA	NA	NA
WP_172664696.1|164594_165485_-	phosphotriesterase-related protein	NA	NA	NA	NA	NA
WP_038223977.1|165779_166955_-	YhfX family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_046335574.1|167059_167422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399053.1|167906_168673_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	2.5e-25
WP_046335580.1|168946_169381_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	61.0	7.9e-45
WP_046335581.1|169380_169683_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	66.7	9.1e-32
WP_046335582.1|170011_171229_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	77.6	1.8e-187
WP_038216705.1|171231_171780_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	67.4	3.3e-64
WP_046335585.1|171817_172969_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	63.4	2.5e-130
WP_051862875.1|173105_173489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335587.1|173491_174694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335588.1|175928_178343_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	39.4	8.7e-149
WP_172664653.1|178345_178753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038221417.1|179007_179190_+	DUF3950 domain-containing protein	NA	NA	NA	NA	NA
WP_038221418.1|179384_179669_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_038221424.1|179796_181020_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	6.6e-121
WP_080717793.1|181425_181707_+	DUF1090 family protein	NA	NA	NA	NA	NA
WP_038209042.1|181751_182285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335590.1|183251_184214_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	8.0e-21
WP_155399054.1|184213_184381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399055.1|184377_185084_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	50.6	5.2e-62
WP_038193618.1|190975_191314_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_046335597.1|191456_191807_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_046335598.1|191879_192260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399056.1|192498_193071_-	DUF4291 family protein	NA	NA	NA	NA	NA
WP_046335604.1|193196_193718_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_155399057.1|193719_193878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335605.1|194031_194565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052725977.1|194582_194960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335607.1|194978_195230_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	50.8	4.6e-13
WP_046335609.1|195326_196364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399185.1|196363_200161_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.2	4.7e-16
WP_046335611.1|201107_201527_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_046335612.1|201660_203832_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.6	2.1e-29
WP_046335614.1|203847_205239_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_046335615.1|205317_208887_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_046335616.1|208883_210320_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_038215407.1|210325_210991_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_038215405.1|210987_211782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335617.1|211781_214496_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	2.3e-89
WP_172664697.1|214505_215243_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_038189826.1|215275_216628_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
215258:215275	attR	CATTGATATCACTCATGA	NA	NA	NA	NA
WP_038191591.1|216630_217185_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_038191589.1|217168_218464_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_046335619.1|218469_219522_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_038206883.1|219485_221318_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012986878.1|221318_221759_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012986877.1|221761_223240_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_038206880.1|223260_223758_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012986874.1|224678_225197_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_046335621.1|225942_227613_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_155271792.1|228659_229697_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_038206871.1|233518_234493_+	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_038206868.1|234522_234729_+	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_038215395.1|234818_235223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335623.1|235219_236569_-	MFS transporter	NA	NA	NA	NA	NA
WP_082243286.1|236655_237546_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046335625.1|237726_239211_-	insulinase family protein	NA	NA	NA	NA	NA
WP_046335626.1|239333_240041_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_046335628.1|240234_241266_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	6.8e-18
WP_038250171.1|241262_242243_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	8.7e-15
WP_046335630.1|242253_243156_-	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_046335631.1|243166_244186_-	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_038191565.1|244329_245940_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155271901.1|246395_246545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335634.1|246902_248972_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_038206845.1|248981_249890_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
>prophage 2
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	476526	573806	4635301	plate,integrase,protease,transposase,tRNA	uncultured_Mediterranean_phage(11.11%)	82	511766:511784	586533:586551
WP_046335759.1|476526_476736_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_046335760.1|478570_479782_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_046335761.1|479800_482926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335762.1|482926_483685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335763.1|483715_483895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335764.1|484285_484513_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_046335766.1|485149_486262_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046335767.1|486332_487259_+	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_046335768.1|487255_488530_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_038209006.1|488526_489300_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	A0A2R8FG22	Brazilian_cedratvirus	27.2	1.0e-10
WP_046335769.1|489301_490003_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	1.7e-12
WP_038222576.1|490337_490802_-	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_046335771.1|491320_492283_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	31.7	3.3e-27
WP_046335772.1|492622_492823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155271792.1|493117_494155_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046335773.1|496346_500399_-	toxin	NA	NA	NA	NA	NA
WP_046335775.1|500391_503946_-	toxin	NA	NA	NA	NA	NA
WP_046335776.1|504038_505679_-	chitinase	NA	A0A1C8ZYL2	Chrysodeixis_includens_nucleopolyhedrovirus	33.1	2.5e-38
WP_046335778.1|506274_507465_-	MFS transporter	NA	NA	NA	NA	NA
WP_038194221.1|507684_507987_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	35.5	1.1e-05
WP_046335779.1|509554_510478_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046335780.1|510474_511746_-	AMP-dependent synthetase	NA	NA	NA	NA	NA
511766:511784	attL	TTGAAATCTATTGGGTATA	NA	NA	NA	NA
WP_046335781.1|511789_514195_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_046335782.1|514196_515327_-	acyl-protein synthase	NA	NA	NA	NA	NA
WP_155399188.1|518018_518859_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.2	8.2e-22
WP_155399189.1|518910_520424_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	33.7	4.3e-13
WP_046335785.1|520460_520949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080717485.1|521546_522083_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046335786.1|522083_522461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399064.1|523540_523696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335787.1|523708_524590_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_046337822.1|524589_524778_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_046337823.1|525050_525314_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	64.6	3.2e-17
WP_010847912.1|525550_525847_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_038186583.1|525854_526838_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_038223178.1|527122_528004_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_038215480.1|528057_529503_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_038197304.1|529492_529735_-	YhdT family protein	NA	NA	NA	NA	NA
WP_046335789.1|530181_531531_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_038192475.1|531542_531998_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_046335790.1|532016_532478_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_046337824.1|532617_533607_-	oxidoreductase	NA	NA	NA	NA	NA
WP_038192479.1|534257_535301_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	3.0e-05
WP_038223190.1|535409_536444_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_038186570.1|536440_536929_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_038223174.1|537001_537589_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_038223172.1|537585_539055_+	ribonuclease G	NA	NA	NA	NA	NA
WP_046335791.1|539102_542939_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_038201356.1|542935_543784_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_046335792.1|543802_545248_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_038192493.1|545292_545769_+	barnase	NA	NA	NA	NA	NA
WP_038192496.1|545773_546043_+	barstar family protein	NA	NA	NA	NA	NA
WP_046335793.1|547583_548567_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.3	4.4e-43
WP_046335794.1|548798_549338_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_046335795.1|549536_550880_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_038186553.1|550931_551342_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_012990122.1|553211_553484_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_038201372.1|553501_554353_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
WP_038192519.1|554433_554901_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_038186543.1|555054_555342_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_038201378.1|555365_556805_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_038201381.1|556870_557596_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	8.4e-23
WP_038192523.1|557602_558136_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_038201385.1|558116_558704_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_046335796.1|558723_559287_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	80.7	1.1e-57
WP_038192525.1|559386_560355_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.5	1.2e-35
WP_046335797.1|560379_561357_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_012990133.1|561588_562392_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	33.3	6.2e-19
WP_046337826.1|562402_563185_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_046335798.1|563189_563702_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_046335799.1|563735_564365_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_038201395.1|564366_564702_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_038192568.1|564833_565088_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_038249591.1|565141_566404_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_038215101.1|566524_567583_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	33.6	6.3e-11
WP_038215103.1|567693_569076_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	7.4e-20
WP_038215105.1|569360_569765_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_046335800.1|570080_571208_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_012990147.1|571474_571903_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_012990148.1|571918_572311_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_038223157.1|572678_573320_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_046335801.1|573323_573806_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	45.2	4.4e-28
586533:586551	attR	TTGAAATCTATTGGGTATA	NA	NA	NA	NA
>prophage 3
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	636007	700255	4635301	tRNA,transposase	Vibrio_phage(18.75%)	53	NA	NA
WP_046335848.1|636007_636964_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046335850.1|637151_638036_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155399065.1|638333_639197_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155399066.1|639159_639339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038221656.1|639418_639652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335855.1|641641_641905_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	64.6	3.8e-18
WP_046335857.1|642526_643309_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038196614.1|643361_645212_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	4.2e-34
WP_046335858.1|645468_647217_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.1	3.6e-72
WP_001144069.1|647332_647548_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_038196616.1|648018_649056_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.6	1.1e-105
WP_051870663.1|649121_650096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038196617.1|650532_651192_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_038196652.1|651301_651664_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_046335859.1|651765_652947_-	multifunctional CCA addition/repair protein	NA	A0A0S1S197	Klebsiella_phage	40.7	1.8e-67
WP_038217286.1|652962_653583_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_046335860.1|653880_654822_+	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_046335861.1|654882_657723_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_038196622.1|657835_659260_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.7	5.6e-39
WP_038196623.1|659370_659658_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_046335862.1|660119_660773_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.0	1.3e-43
WP_046335863.1|661030_661807_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_038209295.1|661841_663002_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	46.2	6.1e-92
WP_172664705.1|663008_663674_-	DUF1190 family protein	NA	A0A191ZBZ0	Erwinia_phage	45.3	1.3e-38
WP_038196629.1|663857_665222_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_038186319.1|665439_666075_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	35.7	9.6e-23
WP_046335866.1|666179_667019_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_046335867.1|667018_667627_+	esterase YqiA	NA	NA	NA	NA	NA
WP_038249306.1|667702_669598_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.8	2.1e-94
WP_046335868.1|669637_671893_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.4	4.4e-86
WP_046335869.1|671981_672713_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_038221759.1|672990_674412_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_038217253.1|674671_675157_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	39.5	1.2e-28
WP_038217251.1|675272_676091_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	NA	NA	NA	NA
WP_046335870.1|676093_676471_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_046335871.1|676499_677324_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_172664655.1|677316_678309_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_046335874.1|678295_679603_-	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_038196641.1|679678_682030_-	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_046335876.1|682212_683022_+	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_012988291.1|683028_683682_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	A0A2H4UV25	Bodo_saltans_virus	29.5	9.9e-07
WP_038217246.1|683816_686726_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.1	2.9e-21
WP_046335877.1|686944_689290_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	24.8	3.0e-29
WP_046335878.1|689426_690842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335879.1|691490_692168_-	CoA transferase	NA	NA	NA	NA	NA
WP_038196647.1|692164_692440_-	CoA transferase	NA	NA	NA	NA	NA
WP_038221781.1|692473_692773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080717485.1|692892_693429_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155271792.1|694511_695549_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_038196649.1|695717_696464_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_046335881.1|696562_696907_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_038197594.1|697767_699177_+	tryptophanase	NA	NA	NA	NA	NA
WP_080717485.1|699718_700255_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	707711	832917	4635301	plate,integrase,lysis,protease,transposase,terminase,tRNA,head,holin,capsid,tail,portal	Salmonella_phage(14.94%)	152	781138:781183	829441:829486
WP_046335885.1|707711_708791_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.3	1.2e-38
WP_038197602.1|708790_709744_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_038197603.1|709842_710319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012988267.1|710393_710888_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_080717817.1|711979_712177_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_038218116.1|712334_713183_+	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_038218114.1|713198_714257_+	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_046335886.1|714269_714527_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_038197609.1|714537_715686_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_052725986.1|715869_719313_+	hypothetical protein	NA	D0R7J2	Paenibacillus_phage	35.9	5.7e-45
WP_155399053.1|719266_720033_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	2.5e-25
WP_155399067.1|720104_726974_+	acyltransferase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	33.9	1.8e-50
WP_046335887.1|727136_728522_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_046337834.1|728559_730014_+	serine hydrolase	NA	NA	NA	NA	NA
WP_071839169.1|730180_734647_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.5	5.1e-62
WP_046335890.1|734664_740439_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	37.6	1.9e-48
WP_046335891.1|740567_741299_+	thioesterase	NA	NA	NA	NA	NA
WP_046335892.1|741307_741631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172664656.1|741665_744815_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.9	1.2e-78
WP_046335894.1|744915_745374_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155271792.1|745722_746760_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046335896.1|746827_747865_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_038202352.1|748085_748400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155271395.1|748637_748832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080717525.1|748931_749162_+	TNT domain-containing protein	NA	NA	NA	NA	NA
WP_038202354.1|749173_749410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038202356.1|749611_749992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038202359.1|750327_750612_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_046335899.1|751011_751350_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_046335900.1|751490_751820_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_046335901.1|752165_752420_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_046337835.1|752419_752845_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_046335902.1|752873_755507_-	host specificity protein J	NA	A0A1W6JNZ7	Morganella_phage	52.8	6.5e-267
WP_038201720.1|755524_756100_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	62.1	1.5e-59
WP_155399068.1|756096_756843_-	C40 family peptidase	NA	A0A1W6JP31	Morganella_phage	53.2	6.5e-71
WP_046335904.1|756845_757583_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	57.2	1.3e-82
WP_052725988.1|757594_757927_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	40.9	3.1e-17
WP_046335907.1|757926_761262_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	45.0	1.2e-225
WP_038201714.1|761489_761837_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	48.7	7.5e-22
WP_046335909.1|761833_762295_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	70.3	9.6e-57
WP_038201708.1|762314_762719_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	49.6	9.1e-27
WP_038201705.1|762715_763105_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	51.6	1.1e-29
WP_046335910.1|763097_763418_-|head,tail	head-tail adaptor protein	head,tail	Q7Y406	Yersinia_phage	44.4	7.7e-13
WP_046335911.1|763427_763730_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	56.0	5.2e-27
WP_046335912.1|763754_764966_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	57.9	2.8e-124
WP_046337837.1|764978_765629_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	76.4	1.3e-94
WP_046335913.1|765606_766827_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	71.4	5.7e-173
WP_046335915.1|766826_767003_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	57.1	1.7e-06
WP_046335916.1|767012_768743_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	83.0	4.4e-296
WP_046335918.1|768739_769234_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	79.9	3.3e-71
WP_046335920.1|769431_769782_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	71.6	9.2e-44
WP_046335922.1|769822_770320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335924.1|770471_770924_-|lysis	lysis protein	lysis	A0A1V1FD30	Vibrio_phage	37.1	9.5e-17
WP_046335925.1|770935_771355_-	lysozyme	NA	R9TMH8	Aeromonas_phage	56.1	4.5e-37
WP_172664657.1|771338_771671_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	59.0	4.5e-24
WP_046335928.1|771856_773080_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_082243291.1|773228_773738_-	site-specific DNA-methyltransferase	NA	A0A0U2QW97	Escherichia_phage	66.5	1.1e-56
WP_155399053.1|773768_774535_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	2.5e-25
WP_082243292.1|774571_775108_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	73.4	5.3e-75
WP_046335929.1|775208_775409_-	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	51.6	2.7e-08
WP_038203413.1|775613_776018_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	71.1	1.0e-46
WP_046335931.1|776036_777398_-	hypothetical protein	NA	K7P852	Enterobacteria_phage	45.2	2.1e-99
WP_038203407.1|777394_777979_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	41.4	4.4e-38
WP_046335933.1|777997_778756_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	78.8	2.3e-39
WP_038203399.1|778829_779090_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	45.8	1.5e-11
WP_038203396.1|779272_779884_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	54.9	1.2e-11
WP_038203393.1|780160_780559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335935.1|780885_781065_+	hypothetical protein	NA	NA	NA	NA	NA
781138:781183	attL	ATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_046335936.1|781400_781919_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	40.9	1.7e-33
WP_052725989.1|781911_782946_-	hypothetical protein	NA	Q7Y5S2	Haemophilus_phage	51.9	1.8e-26
WP_038216874.1|782929_783583_-	DUF2612 domain-containing protein	NA	A0A075DXV1	Acinetobacter_phage	40.2	6.2e-09
WP_046335937.1|783575_784700_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	38.7	1.8e-72
WP_038216878.1|784683_785043_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	50.5	3.7e-24
WP_046335938.1|785039_785705_-	hypothetical protein	NA	Q7Y5S7	Haemophilus_phage	58.5	3.0e-43
WP_046335939.1|785682_786531_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	56.7	5.3e-85
WP_046335940.1|786505_786844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335941.1|786840_787596_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	45.1	2.6e-35
WP_046335942.1|787697_787979_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_038216894.1|787965_788229_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_082243293.1|788347_788911_-	phage antirepressor N-terminal domain-containing protein	NA	A0A0H4IQ87	Shigella_phage	75.7	1.8e-44
WP_046335943.1|789158_789917_-	antirepressor	NA	A0A2L1IV39	Escherichia_phage	56.4	1.5e-75
WP_080718388.1|790105_790276_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_046335944.1|790399_790840_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_038215239.1|791263_791617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038215241.1|791613_791916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399069.1|792184_792472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337842.1|792539_794465_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	30.2	3.1e-16
WP_172664647.1|794451_794589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335946.1|794621_795032_-	hypothetical protein	NA	A0A140XG65	Salmonella_phage	34.5	1.1e-08
WP_046335947.1|795028_795466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335948.1|795475_796987_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	41.6	1.7e-102
WP_052726118.1|796989_797364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335951.1|797410_797746_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	39.0	1.2e-13
WP_046335953.1|797738_798209_-	hypothetical protein	NA	A0A2I7QV48	Vibrio_phage	45.5	1.6e-19
WP_046335955.1|798205_798568_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_046335957.1|798582_799542_-	DUF2184 domain-containing protein	NA	NA	NA	NA	NA
WP_046335958.1|799545_800025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335960.1|800027_801185_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	35.3	1.4e-19
WP_082243294.1|801188_802055_-|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	32.3	4.6e-28
WP_046335961.1|801957_803361_-	DUF1073 domain-containing protein	NA	Q7Y5U6	Haemophilus_phage	30.6	3.7e-51
WP_046335962.1|803360_804584_-|terminase	PBSX family phage terminase large subunit	terminase	H6WRS9	Salmonella_phage	74.0	2.5e-181
WP_046335963.1|804564_804981_-	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	58.5	1.4e-30
WP_046335965.1|805306_805717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335966.1|805713_806253_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	41.7	2.7e-34
WP_046335967.1|806551_806827_-	hypothetical protein	NA	A0A0A8WEQ1	Clostridium_phage	50.0	2.6e-17
WP_046335968.1|806819_807296_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	43.2	2.0e-17
WP_046335969.1|807292_807694_-	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	56.2	1.2e-34
WP_172664658.1|807690_807993_-|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	63.5	9.5e-29
WP_046335970.1|808351_808675_-	negative regulator GrlR	NA	NA	NA	NA	NA
WP_046337845.1|808858_809113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335971.1|809485_810100_-	hypothetical protein	NA	A0A2H4JCH5	uncultured_Caudovirales_phage	49.7	7.8e-46
WP_038214493.1|810096_810450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335972.1|810446_811043_-	recombination protein NinG	NA	E7C9S3	Salmonella_phage	74.2	2.3e-71
WP_052725990.1|811014_811485_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	47.8	5.2e-34
WP_046335974.1|811481_811925_-	recombination protein NinB	NA	A0A1P8DTD8	Proteus_phage	71.6	6.0e-24
WP_082243295.1|811927_812098_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_046335975.1|812094_812487_-	DUF2591 family protein	NA	J7I4M3	Pseudomonas_phage	30.3	9.2e-08
WP_046335976.1|812483_812861_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	28.6	6.7e-08
WP_038214680.1|812883_813126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335978.1|813143_813869_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	79.8	2.3e-105
WP_082243372.1|813868_814594_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	65.6	4.6e-29
WP_046335980.1|814739_815102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335981.1|815317_815506_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046335983.1|815613_816324_+	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	55.1	3.8e-68
WP_046335984.1|816333_817485_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	27.7	1.4e-35
WP_046335986.1|817979_818360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399071.1|818356_818833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335988.1|818952_819309_+	hypothetical protein	NA	A0A2H4JDX9	uncultured_Caudovirales_phage	38.6	5.4e-07
WP_046335989.1|819359_819728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335990.1|819791_820628_+	hypothetical protein	NA	M9NYX5	Enterobacteria_phage	42.9	5.1e-56
WP_155399072.1|820670_821081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335991.1|821073_821478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172664659.1|821552_821693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172664660.1|821695_821899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172664661.1|821895_822060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335993.1|822056_822398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337849.1|822439_823072_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	35.2	6.0e-17
WP_046335994.1|823077_823755_+	AAA family ATPase	NA	K7PMI2	Enterobacteria_phage	65.7	7.0e-80
WP_046335995.1|823751_824357_+	hypothetical protein	NA	A0A2D1GLM1	Escherichia_phage	57.2	1.2e-59
WP_046335996.1|824433_825027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335997.1|824995_825427_+	hypothetical protein	NA	G0YQE7	Erwinia_phage	50.4	1.3e-31
WP_046335999.1|825588_825813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336000.1|825802_826096_+	hypothetical protein	NA	A0A2I7QQE5	Vibrio_phage	41.0	1.2e-09
WP_071839177.1|826108_826294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336001.1|826271_826808_+	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	57.9	9.2e-51
WP_046336002.1|826804_827029_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	50.7	3.9e-11
WP_046336004.1|827031_827613_+	HNH endonuclease	NA	A0A1S5SAI9	Streptococcus_phage	39.4	1.3e-26
WP_046336008.1|828262_829420_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	75.1	4.9e-174
WP_038216735.1|829697_830573_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.3	2.8e-33
829441:829486	attR	ATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_038181623.1|830572_830785_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_071839179.1|831162_831399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038205607.1|831534_832917_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	26.0	1.3e-45
>prophage 5
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	915277	989734	4635301	integrase,protease,terminase,tRNA,head,capsid,tail,portal	uncultured_Caudovirales_phage(42.86%)	61	974054:974070	989725:989741
WP_038191984.1|915277_916726_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_038187498.1|916955_917213_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_046336050.1|917217_918135_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_038221989.1|918331_920197_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_046336051.1|921695_923069_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_038216835.1|923081_923807_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_046336052.1|923809_925036_+	MFS transporter	NA	NA	NA	NA	NA
WP_038205449.1|925706_926435_+	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_172664707.1|926431_927451_+	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_038221994.1|927471_928119_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_038205443.1|928211_928703_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_038205441.1|928695_929742_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_038187458.1|929843_930260_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_038187454.1|930289_930760_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.7	5.1e-29
WP_046336053.1|930849_931959_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.2	1.8e-48
WP_046336054.1|932013_932463_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_038187448.1|932586_933555_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	42.7	1.8e-49
WP_071826224.1|933565_935413_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_038192021.1|935441_935780_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	36.3	2.6e-11
WP_038216853.1|935904_937029_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	47.2	1.6e-92
WP_046336055.1|937099_938167_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_046336056.1|938272_938896_+	DUF479 domain-containing protein	NA	NA	NA	NA	NA
WP_046336057.1|939052_939655_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_046336058.1|939887_941651_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_046336059.1|941740_943081_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_046336060.1|943462_944776_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.5	6.6e-26
WP_038202635.1|944837_945527_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	38.0	2.8e-36
WP_038202638.1|945803_947018_+	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_046336061.1|947036_950723_+	AAA family ATPase	NA	G3MAB6	Bacillus_virus	22.1	3.3e-06
WP_038225072.1|952898_954521_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046337853.1|954593_956204_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_082243298.1|956264_957899_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_082243299.1|958027_959677_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_155399190.1|959935_961570_-	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_046336062.1|961635_963591_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_046336063.1|963931_964840_-	fructokinase	NA	NA	NA	NA	NA
WP_038205023.1|965066_965978_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.6	7.4e-101
WP_155272308.1|966071_967214_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.4	4.4e-103
WP_038205030.1|967740_968379_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046336064.1|968490_969399_-	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_046336065.1|970111_972541_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
974054:974070	attL	TGTAATTTCATGAAAAA	NA	NA	NA	NA
WP_046336066.1|974175_975408_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	43.1	6.5e-92
WP_046336067.1|975385_975610_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_071827335.1|975672_975957_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_046336068.1|975968_976889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336069.1|977403_977586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336070.1|977776_977968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071827381.1|977960_978131_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_046336071.1|978133_978439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336072.1|980584_980845_+	hypothetical protein	NA	A0A2H4JB54	uncultured_Caudovirales_phage	44.0	2.2e-10
WP_046336073.1|980846_981197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336075.1|981420_982575_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	68.2	8.9e-144
WP_046336076.1|982620_983166_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	53.3	3.9e-49
WP_046336078.1|983168_984386_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	78.3	5.6e-189
WP_046336079.1|984378_984681_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	67.4	2.0e-31
WP_046336081.1|984680_985118_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	56.6	3.7e-42
WP_038195049.1|985393_985753_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	70.9	4.7e-43
WP_046336083.1|985764_987426_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	79.0	5.8e-269
WP_046337860.1|987873_988461_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	61.4	2.2e-58
WP_046336084.1|988461_988728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051875999.1|988963_989734_+	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	50.9	2.3e-42
989725:989741	attR	TTTTTCATGAAATTACA	NA	NA	NA	NA
>prophage 6
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	1160036	1203877	4635301	plate,integrase,transposase	uncultured_Caudovirales_phage(18.18%)	42	1191248:1191283	1211593:1211628
WP_046336185.1|1160036_1161077_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046336186.1|1161122_1161866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336187.1|1161936_1162935_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046336188.1|1163385_1163622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336189.1|1164289_1167604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336190.1|1167959_1168472_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	73.5	1.3e-46
WP_046336191.1|1168489_1168699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336192.1|1168777_1169242_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_046336193.1|1169274_1169475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336194.1|1169518_1171519_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	8.8e-38
WP_046336196.1|1171520_1172246_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_082243302.1|1172487_1173711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046336197.1|1173806_1174064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336199.1|1174084_1174666_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_046337870.1|1174746_1176324_-	ParB family protein	NA	NA	NA	NA	NA
WP_046336200.1|1176327_1177704_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	49.5	9.4e-108
WP_046336202.1|1177687_1178065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336203.1|1178061_1178949_-	ParA family protein	NA	NA	NA	NA	NA
WP_046336205.1|1179230_1180502_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	1.3e-71
WP_046336207.1|1180641_1180848_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	48.1	2.4e-07
WP_082243303.1|1180955_1183061_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	61.0	2.9e-116
WP_046336208.1|1183382_1183652_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_046336210.1|1183673_1184225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052725995.1|1184539_1185103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172664709.1|1185180_1185948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336214.1|1186622_1187120_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	38.4	6.8e-16
WP_046336216.1|1187119_1189132_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_046336218.1|1189166_1190954_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
1191248:1191283	attL	TGCGGTACATCTGCGCACTTTTGGAAGCAGATATCG	NA	NA	NA	NA
WP_155271034.1|1191604_1191766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336220.1|1192268_1192532_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	67.7	6.5e-18
WP_046336221.1|1193175_1194183_-|integrase	site-specific integrase	integrase	A0A2I6UGM5	Salinibacter_virus	23.2	1.1e-07
WP_046336223.1|1194393_1195293_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_046337873.1|1195502_1196192_-	N-6 DNA methylase	NA	A0A2I7RHV5	Vibrio_phage	32.4	4.8e-20
WP_046336225.1|1196292_1197210_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_046336226.1|1197302_1197599_-	toxin-antitoxin protein	NA	NA	NA	NA	NA
WP_046336227.1|1197598_1198156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336228.1|1198276_1198738_-	antirestriction protein	NA	NA	NA	NA	NA
WP_046336229.1|1198750_1199185_-	antirestriction protein	NA	NA	NA	NA	NA
WP_155399080.1|1199135_1199420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336230.1|1199843_1201796_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_052725996.1|1201804_1203391_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_038225121.1|1203439_1203877_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
1211593:1211628	attR	CGATATCTGCTTCCAAAAGTGCGCAGATGTACCGCA	NA	NA	NA	NA
>prophage 7
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	1208843	1281428	4635301	plate,integrase,transposase	Brazilian_cedratvirus(14.29%)	58	1209816:1209875	1292994:1293081
WP_046336235.1|1208843_1209800_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
1209816:1209875	attL	CTCATCAGATTAGGTCTAGCTCAGATCATCAATAGTGTCAGATCGAGTCTTATTTGGTAA	NA	NA	NA	NA
WP_046336236.1|1210010_1210928_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_046336237.1|1211843_1212269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336238.1|1212994_1214509_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_046336240.1|1214505_1214832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336241.1|1216287_1217220_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_046336242.1|1217216_1217615_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_046336244.1|1217919_1219677_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_046336246.1|1221787_1222582_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_046336247.1|1222597_1224544_+	lipase family protein	NA	A0A2R8FER2	Brazilian_cedratvirus	33.3	1.7e-06
WP_082243374.1|1224627_1225368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052725997.1|1225511_1225775_+	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	44.8	5.5e-09
WP_082243305.1|1225885_1226269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172664663.1|1226295_1226520_+	DUF1851 domain-containing protein	NA	NA	NA	NA	NA
WP_046336251.1|1227387_1230648_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_046336253.1|1231163_1232201_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046336254.1|1232262_1232538_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_046336257.1|1232537_1232879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336259.1|1232981_1235753_-	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_046336261.1|1235752_1236157_-	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_046336262.1|1236150_1236510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336263.1|1236509_1237952_-	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_046336264.1|1237941_1238796_-	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_046336265.1|1238792_1239449_-	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_046336267.1|1239448_1239814_-	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_046336269.1|1240237_1240474_-	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_046336270.1|1240470_1240800_-	exported protein with RAQPRD domain protein	NA	NA	NA	NA	NA
WP_046336272.1|1240946_1241645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399081.1|1241762_1242608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336276.1|1242880_1243342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336277.1|1243357_1244116_-	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_046336278.1|1244124_1246188_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_046336279.1|1246184_1246706_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_046336280.1|1246702_1247248_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_046336281.1|1247244_1247943_-	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_046336282.1|1247951_1248656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336283.1|1248656_1249217_-	PilL protein	NA	NA	NA	NA	NA
WP_046336284.1|1249396_1249660_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	69.8	2.9e-18
WP_046336285.1|1251671_1252262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336286.1|1252345_1252855_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	75.2	9.0e-48
WP_046336287.1|1252870_1253080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336288.1|1253161_1253626_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_046336289.1|1253954_1255949_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.1	7.4e-37
WP_046336290.1|1255962_1256676_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_155399082.1|1256807_1256960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336291.1|1256967_1258194_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038203215.1|1258304_1258562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336292.1|1258569_1259163_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_046336296.1|1261201_1261603_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_046337878.1|1264420_1264672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337879.1|1268267_1268912_-	DUF1851 domain-containing protein	NA	NA	NA	NA	NA
WP_046336297.1|1268911_1270213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336299.1|1270217_1270580_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_082243306.1|1270572_1271133_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_155399083.1|1271364_1271511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336300.1|1274462_1275449_+	ATP-binding protein	NA	L7RCB4	Acanthamoeba_polyphaga_moumouvirus	28.9	5.7e-14
WP_155399053.1|1278361_1279127_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	2.5e-25
WP_046336301.1|1280543_1281428_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
1292994:1293081	attR	TTACCAAATAAGACTCGATCTGACACTATTGATGATCTGAGCTAGACCTAATCTGATGAGATGGACGCCCCGTATGGCATCAAATGTA	NA	NA	NA	NA
>prophage 8
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	1322114	1386693	4635301	protease,tail,transposase	Tupanvirus(12.5%)	47	NA	NA
WP_155271792.1|1322114_1323152_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_082243307.1|1323190_1325695_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	28.0	7.1e-61
WP_046336337.1|1325810_1330274_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	33.1	3.1e-43
WP_046336338.1|1330952_1334075_+|protease	autotransporter serine protease	protease	NA	NA	NA	NA
WP_155271792.1|1334558_1335596_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046336339.1|1335596_1336079_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_155399086.1|1336578_1336737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336342.1|1337465_1338398_-|tail	tail fiber protein	tail	D2K045	Staphylococcus_phage	55.4	9.8e-24
WP_046336343.1|1338955_1340332_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_046336345.1|1340506_1341940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336346.1|1341944_1344965_+	virulence factor SrfB	NA	NA	NA	NA	NA
WP_046336348.1|1344964_1347646_+	type III secretion system effector	NA	NA	NA	NA	NA
WP_038224578.1|1347652_1348654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399192.1|1348711_1350655_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_038224574.1|1350654_1351350_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.3	3.4e-21
WP_046336351.1|1351318_1352569_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_046337889.1|1352582_1354109_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_038198089.1|1354145_1354853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038202453.1|1354865_1355348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038202456.1|1355718_1356000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399087.1|1356124_1356271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038196832.1|1356291_1356582_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_046336352.1|1356755_1357316_-	MepB family protein	NA	NA	NA	NA	NA
WP_046336353.1|1357770_1359102_-	murein transglycosylase D	NA	NA	NA	NA	NA
WP_046336355.1|1359174_1359930_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_038202465.1|1359970_1360687_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_038224569.1|1360769_1361171_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_038224568.1|1361170_1361416_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155271877.1|1361657_1361801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038194110.1|1361875_1362346_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	59.9	3.7e-48
WP_046336358.1|1362409_1363159_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	36.4	3.3e-38
WP_038224595.1|1363437_1363935_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046336359.1|1364381_1366376_+	transketolase	NA	NA	NA	NA	NA
WP_038194119.1|1366651_1367671_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_038224561.1|1367758_1368925_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_038194125.1|1368982_1370059_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_046336362.1|1370427_1370823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336366.1|1373525_1373741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155271792.1|1374736_1375774_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_038248131.1|1376286_1377849_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
WP_038195478.1|1377870_1378389_+	4-hydroxyphenylacetate 3-monooxygenase, reductase component	NA	NA	NA	NA	NA
WP_046336367.1|1379122_1380589_+	dipeptide/tripeptide permease DtpB	NA	A0A0P0IY73	Acinetobacter_phage	27.8	2.9e-46
WP_038195476.1|1380671_1382000_-	MFS transporter	NA	NA	NA	NA	NA
WP_046336369.1|1382009_1383542_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_038195474.1|1383541_1384150_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_046336370.1|1384289_1385669_-	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_155399055.1|1385986_1386693_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	50.6	5.2e-62
>prophage 9
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	1432965	1660689	4635301	plate,integrase,protease,transposase,terminase,tRNA,holin,tail,lysis	Salmonella_phage(21.74%)	210	1508233:1508292	1623474:1623533
WP_046336391.1|1432965_1433643_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	38.3	1.1e-32
WP_046336392.1|1433857_1434904_+	Fe2+-enterobactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046336393.1|1434938_1436204_-	enterobactin transporter EntS	NA	NA	NA	NA	NA
WP_038214343.1|1436372_1437419_+	Fe(3+)-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_046336394.1|1437435_1438467_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_046336395.1|1438503_1439307_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_046336396.1|1439386_1447981_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.2	3.0e-74
WP_046336397.1|1448021_1448264_-	MbtH family protein	NA	NA	NA	NA	NA
WP_046336398.1|1448302_1449589_-	enterochelin esterase	NA	NA	NA	NA	NA
WP_046336399.1|1449903_1452102_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_046336400.1|1452283_1453468_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_038214358.1|1453464_1455093_+	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_046336401.1|1455089_1455977_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_046336402.1|1455976_1456735_+	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_052726003.1|1456997_1458245_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.4	6.9e-25
WP_046336403.1|1458332_1458728_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_046336404.1|1458932_1459442_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046336405.1|1459564_1460743_-	MFS transporter	NA	NA	NA	NA	NA
WP_046336406.1|1461000_1461834_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155272320.1|1462072_1462237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336407.1|1462240_1464190_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5ERI2	Ostreococcus_lucimarinus_virus	24.0	6.6e-22
WP_046336409.1|1464532_1465525_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_046336410.1|1465584_1467285_+	solute:sodium symporter family transporter	NA	A0A219Y9P9	Aeromonas_phage	25.9	4.7e-32
WP_046336411.1|1467296_1469201_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_046336412.1|1469273_1470164_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_038222131.1|1470223_1471054_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_155399089.1|1471097_1472387_-	cytosine permease	NA	NA	NA	NA	NA
WP_038202129.1|1472409_1473105_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038185912.1|1473512_1474127_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J122	uncultured_Caudovirales_phage	46.5	1.1e-42
WP_046336416.1|1474110_1474968_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	48.7	7.2e-74
WP_038202123.1|1475649_1476204_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038202120.1|1476380_1476911_+	HPP family protein	NA	NA	NA	NA	NA
WP_046336418.1|1477946_1489313_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	26.0	1.8e-148
WP_038185894.1|1490346_1490796_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_046336419.1|1490834_1491902_+|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_038202108.1|1494625_1495084_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_038202106.1|1495080_1495263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038202104.1|1495259_1495949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038222141.1|1495945_1497562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038202101.1|1497572_1497995_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_038202099.1|1497991_1498417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336421.1|1498507_1500694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336423.1|1500686_1503584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399194.1|1504057_1504906_+|tail	tail fiber protein	tail	I3PUX0	Vibrio_phage	45.1	2.3e-08
WP_046336425.1|1504975_1506577_+	hypothetical protein	NA	NA	NA	NA	NA
1508233:1508292	attL	CTACTCATGGTTAAATCCGAACTGTTATGGGGATAACAGTTCGGATTTAACCATGAGTAG	NA	NA	NA	NA
WP_038225121.1|1508284_1508722_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
WP_046336426.1|1509882_1510605_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_071839187.1|1510533_1510863_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_046336428.1|1511120_1511312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336430.1|1511859_1512720_-	GHMP kinase	NA	NA	NA	NA	NA
WP_046336431.1|1512712_1513786_-	threonine-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_046336433.1|1513785_1514586_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_046336434.1|1515327_1516722_+	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_046336435.1|1516718_1517693_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_038218296.1|1517707_1518361_+	cobalt-precorrin-8 methylmutase	NA	NA	NA	NA	NA
WP_046336437.1|1518353_1519517_+	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
WP_046336439.1|1519513_1520134_+	cobalt-precorrin-7 (C(5))-methyltransferase	NA	NA	NA	NA	NA
WP_046336440.1|1520123_1520720_+	decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase	NA	NA	NA	NA	NA
WP_046336442.1|1520712_1521507_+	cobalt-precorrin-4 methyltransferase	NA	NA	NA	NA	NA
WP_046336443.1|1521487_1522552_+	cobalt-precorrin 5A hydrolase	NA	NA	NA	NA	NA
WP_046336445.1|1522545_1523271_+	precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
WP_038195634.1|1523267_1524062_+	cobalt-precorrin-6A reductase	NA	NA	NA	NA	NA
WP_046336447.1|1524076_1524871_+	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
WP_046336448.1|1524870_1525584_+	cobalt-factor II C(20)-methyltransferase	NA	NA	NA	NA	NA
WP_046336449.1|1525587_1526319_+	energy-coupling factor ABC transporter permease	NA	NA	NA	NA	NA
WP_038195642.1|1526331_1526613_+	energy-coupling factor ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046336450.1|1526599_1527277_+	energy-coupling factor ABC transporter transmembrane protein	NA	NA	NA	NA	NA
WP_038218308.1|1527312_1528125_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.7	4.4e-12
WP_046336451.1|1528121_1529663_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_038218313.1|1529722_1530268_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_046336452.1|1530264_1531023_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_046337901.1|1531054_1531657_+	adenosylcobalamin/alpha-ribazole phosphatase	NA	NA	NA	NA	NA
WP_046337903.1|1531671_1532727_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_046336453.1|1532754_1534365_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.8	3.1e-25
WP_038201994.1|1534649_1535399_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_046336454.1|1535545_1536220_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_038185758.1|1536645_1537461_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_051869003.1|1538894_1539386_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_038197101.1|1539497_1540040_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155271448.1|1540121_1540712_-	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	46.3	2.0e-46
WP_038197099.1|1540948_1541287_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	55.6	9.3e-25
WP_046337904.1|1541365_1543357_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	54.4	1.1e-186
WP_038201984.1|1543471_1543684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038197096.1|1543702_1543939_+	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	48.1	7.2e-16
WP_038197094.1|1544174_1544378_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	59.7	5.0e-18
WP_038197093.1|1544387_1544663_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	45.6	1.3e-13
WP_046336456.1|1544664_1545204_+	lysozyme	NA	H6WRZ4	Salmonella_phage	66.9	3.3e-72
WP_038201979.1|1545200_1545701_+|lysis	lysis protein	lysis	A0A0A0YR13	Escherichia_phage	36.2	2.3e-16
WP_038201976.1|1545870_1546506_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	65.3	3.2e-71
WP_038185717.1|1546502_1546853_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	61.3	3.4e-30
WP_038201973.1|1546861_1547770_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	69.9	2.6e-114
WP_038201971.1|1547762_1548371_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	66.3	1.4e-76
WP_038218345.1|1549927_1550827_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_172664665.1|1550942_1552274_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	50.7	6.5e-29
WP_038218340.1|1552375_1552618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038218338.1|1552619_1553153_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	41.5	5.6e-24
WP_080717825.1|1553179_1553656_-	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	65.1	2.4e-55
WP_046336458.1|1554496_1555408_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_046336459.1|1555456_1556440_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_046336460.1|1556524_1557427_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_046337908.1|1559472_1560018_+	hypothetical protein	NA	S4TSV0	Salmonella_phage	58.2	1.3e-23
WP_046336461.1|1560389_1561574_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	74.6	1.0e-166
WP_012987901.1|1561573_1562092_+|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	65.5	7.2e-61
WP_012987900.1|1562197_1562515_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	55.8	1.3e-20
WP_013183720.1|1562526_1562649_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	66.7	5.7e-09
WP_065814049.1|1562641_1565383_+|tail	phage tail protein	tail	E5G6Q1	Salmonella_phage	41.7	7.1e-14
WP_038197081.1|1565379_1565895_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	63.6	3.0e-43
WP_046336462.1|1565881_1567495_+	phage protein (D protein) (Modular protein)	NA	Q6K1G4	Salmonella_virus	39.8	4.8e-87
WP_038197079.1|1567578_1567833_+	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	69.4	2.0e-19
WP_038201943.1|1568021_1568240_-	YdcH family protein	NA	NA	NA	NA	NA
WP_046336463.1|1568511_1568994_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_046336464.1|1569302_1569995_+	aquaporin Z	NA	NA	NA	NA	NA
WP_038181279.1|1571193_1572201_+	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_046336465.1|1572254_1573154_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_038218358.1|1573157_1574438_+	N-glycosyltransferase	NA	NA	NA	NA	NA
WP_038225227.1|1576447_1577077_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_046336468.1|1577474_1579385_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	31.6	3.3e-58
WP_046336469.1|1580967_1582143_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_046336471.1|1582148_1583039_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_046337911.1|1583346_1585002_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_038214735.1|1585700_1585997_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155399053.1|1586081_1586848_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	2.5e-25
WP_051863152.1|1587177_1587606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336473.1|1587676_1588036_+	antitermination protein Q	NA	U5P0A5	Shigella_phage	37.7	1.8e-18
WP_082243379.1|1588564_1589674_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_046336476.1|1589711_1590923_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	46.8	5.1e-89
WP_038198148.1|1591867_1592350_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	1.7e-27
WP_038187003.1|1592507_1592942_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_038187001.1|1592934_1593228_+	RnfH family protein	NA	NA	NA	NA	NA
WP_038216286.1|1593292_1593637_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_038198150.1|1593750_1595424_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_155271450.1|1595520_1596399_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_012989541.1|1596522_1597104_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_038207167.1|1597171_1597852_-	uracil-DNA glycosylase	NA	A0A0X9XZU0	Myotis_gammaherpesvirus	51.7	2.3e-54
WP_038207170.1|1598170_1599322_+	phospholipase	NA	NA	NA	NA	NA
WP_046336479.1|1599418_1600762_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.2	2.4e-47
WP_046336481.1|1600990_1602103_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	68.7	5.6e-143
WP_155399090.1|1603087_1603450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052726007.1|1603497_1603899_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_046336483.1|1604262_1604643_+	lectin	NA	NA	NA	NA	NA
WP_080717485.1|1605129_1605666_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_082243310.1|1605666_1606848_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_038186956.1|1607063_1607324_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	48.8	4.6e-16
WP_038216278.1|1607326_1607707_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_038205295.1|1607706_1608438_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_038216280.1|1608506_1609244_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_046336485.1|1609253_1610159_-	GTPase Era	NA	NA	NA	NA	NA
WP_012989530.1|1610155_1610836_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.5	1.3e-20
WP_038198161.1|1611022_1611991_-	signal peptidase I	NA	NA	NA	NA	NA
WP_038198160.1|1612011_1613808_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.2	5.0e-24
WP_038205287.1|1613999_1614464_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_038198158.1|1614463_1615423_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_038198157.1|1615444_1616095_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_038186983.1|1616127_1616703_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_038186987.1|1616991_1617732_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_038213503.1|1617955_1618219_-	pyocin activator PrtN family protein	NA	A0A1W6JP35	Morganella_phage	59.0	7.2e-17
WP_046336487.1|1618221_1618542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336488.1|1618538_1619132_-	KilA-N domain-containing protein	NA	Q71TC0	Escherichia_phage	39.5	1.2e-24
WP_046336489.1|1619134_1619356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052726008.1|1619345_1619951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336490.1|1622574_1622883_+	hypothetical protein	NA	A0A291AXM8	Shigella_phage	38.0	1.0e-06
WP_046336491.1|1622883_1623471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038225121.1|1623525_1623963_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
1623474:1623533	attR	CTACTCATGGTTAAATCCGAACTGTTATCCCCATAACAGTTCGGATTTAACCATGAGTAG	NA	NA	NA	NA
WP_052726009.1|1624139_1625501_+	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	39.5	7.4e-89
WP_155399091.1|1625928_1626081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336492.1|1627297_1627540_+	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	56.2	5.8e-21
WP_046336493.1|1627541_1627982_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	48.9	8.4e-34
WP_038193785.1|1627981_1628428_+	hypothetical protein	NA	A4KWV6	Enterobacteria_phage	33.1	6.5e-10
WP_046336494.1|1628596_1629115_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	40.9	1.3e-33
WP_052726010.1|1629107_1630232_-|tail	tail fiber protein	tail	A9YX14	Burkholderia_phage	47.7	2.5e-13
WP_046336495.1|1630239_1630893_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	44.6	4.0e-48
WP_082243312.1|1630889_1632077_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	54.9	1.4e-115
WP_046336498.1|1632080_1632428_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	57.8	3.2e-28
WP_046337922.1|1633176_1634121_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	39.5	8.0e-66
WP_065814050.1|1634426_1635401_-	DUF4431 domain-containing protein	NA	A0A1W6JPG1	Morganella_phage	38.5	6.0e-08
WP_046336501.1|1635431_1635734_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	42.7	2.0e-15
WP_046336502.1|1635730_1636351_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.3e-47
WP_052726011.1|1636350_1638540_-	hypothetical protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	48.1	1.3e-114
WP_172664666.1|1638529_1638676_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	48.9	2.1e-05
WP_046336503.1|1638711_1639155_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	35.5	1.6e-16
WP_046336505.1|1639154_1639595_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	68.5	1.9e-49
WP_046336506.1|1639599_1641066_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	48.8	3.7e-126
WP_046336507.1|1641071_1641614_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	55.9	8.1e-55
WP_038197868.1|1641606_1641993_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	72.7	1.2e-47
WP_046336508.1|1641992_1642502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336510.1|1642498_1642906_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	55.2	1.5e-32
WP_038224707.1|1642874_1643084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038224708.1|1643120_1644068_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	60.8	1.9e-107
WP_046336511.1|1644076_1644577_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	47.6	4.0e-32
WP_046336512.1|1644587_1645847_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	42.9	3.3e-75
WP_046336513.1|1645848_1646382_-	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	56.9	6.8e-46
WP_046336515.1|1646452_1647922_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	54.4	1.3e-150
WP_046336516.1|1648139_1649666_-|terminase	phage terminase large subunit	terminase	Q7Y5U7	Haemophilus_phage	52.3	5.5e-141
WP_071839188.1|1649619_1650282_-|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	48.5	7.9e-44
WP_038212574.1|1650345_1650699_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	37.4	4.4e-09
WP_046336518.1|1650806_1651031_-	hypothetical protein	NA	E9NIF1	Enterobacter_phage	62.0	4.7e-17
WP_046335967.1|1651079_1651355_-	hypothetical protein	NA	A0A0A8WEQ1	Clostridium_phage	50.0	2.6e-17
WP_052726012.1|1651347_1651809_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	50.6	6.5e-13
WP_046336521.1|1651805_1652207_-	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	56.2	7.6e-34
WP_172664658.1|1652203_1652506_-|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	63.5	9.5e-29
WP_071826763.1|1652667_1653108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172664710.1|1653037_1653295_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	52.8	7.1e-17
WP_046336522.1|1653768_1654170_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_046336523.1|1654395_1655175_-	antitermination protein	NA	F1C595	Cronobacter_phage	47.3	5.0e-66
WP_046336525.1|1655171_1656029_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	54.3	1.6e-76
WP_082243313.1|1656028_1657009_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	57.5	2.2e-103
WP_046336526.1|1657005_1658637_-	DEAD/DEAH box helicase family protein	NA	A0A286N2P9	Klebsiella_phage	67.3	8.0e-215
WP_082243380.1|1659048_1659315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052726013.1|1659331_1659610_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	43.9	1.5e-09
WP_082243314.1|1659708_1660689_+	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	65.1	4.2e-86
>prophage 10
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	1663975	1671406	4635301	tRNA,integrase,transposase	Escherichia_phage(37.5%)	12	1660356:1660369	1679914:1679927
1660356:1660369	attL	GTTGAGGTTTTCTA	NA	NA	NA	NA
WP_046336544.1|1663975_1664737_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	53.0	1.7e-66
WP_052726014.1|1664736_1665378_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	39.7	2.7e-33
WP_038213515.1|1665390_1665735_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	67.5	5.7e-38
WP_038223579.1|1665731_1665959_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	41.7	7.6e-07
WP_046336547.1|1665948_1666173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336548.1|1666172_1666553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336550.1|1666549_1666867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336552.1|1667005_1668277_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	46.9	9.6e-107
WP_052726015.1|1668611_1669250_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_046336553.1|1669529_1670174_+	HD domain-containing protein	NA	S4W232	Pandoravirus	26.3	9.4e-10
WP_038196760.1|1670252_1670777_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.7	2.0e-05
WP_038225121.1|1670968_1671406_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
1679914:1679927	attR	TAGAAAACCTCAAC	NA	NA	NA	NA
>prophage 11
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	1715168	1772466	4635301	tRNA,integrase,tail,transposase	Escherichia_phage(15.79%)	57	1744695:1744710	1777699:1777714
WP_046336572.1|1715168_1716446_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_046336573.1|1716457_1717078_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_046336574.1|1717092_1718265_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_046336575.1|1718422_1719913_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_046336576.1|1720137_1720335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038225121.1|1720662_1721100_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
WP_038195465.1|1721257_1722325_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_046336577.1|1722526_1723435_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_038186872.1|1723575_1723998_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_155399094.1|1724024_1724438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336579.1|1724626_1725247_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_046336580.1|1725473_1726511_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046336581.1|1726510_1727344_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_046336582.1|1727343_1728183_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_046336583.1|1728203_1729292_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	33.2	1.6e-25
WP_046336584.1|1729425_1730307_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	38.7	4.4e-50
WP_038186854.1|1730512_1731022_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_046336585.1|1731070_1732798_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	27.3	2.1e-19
WP_038196259.1|1732931_1733189_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_038196257.1|1733571_1734525_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.2	5.8e-72
WP_046336586.1|1734833_1735589_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_038196253.1|1735808_1736738_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_046336587.1|1736799_1738818_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.3	6.1e-140
WP_038196249.1|1739002_1740193_+	nucleoside permease	NA	NA	NA	NA	NA
WP_038186826.1|1740313_1740532_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_046336588.1|1740934_1742350_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_038195980.1|1743471_1743837_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_052726018.1|1744160_1745063_-	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
1744695:1744710	attL	ATTTTCATCAATGCCC	NA	NA	NA	NA
WP_046336589.1|1746290_1746674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336590.1|1747770_1748949_-|integrase	tyrosine-type recombinase/integrase	integrase	E5AGD0	Erwinia_phage	66.1	4.0e-147
WP_082243316.1|1749380_1750022_+	DUF4102 domain-containing protein	NA	A0A2R2Z2Y0	Escherichia_phage	73.7	1.8e-77
WP_071839192.1|1749967_1750183_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	50.0	2.0e-12
WP_046336591.1|1750192_1750486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336592.1|1750470_1750677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038223617.1|1751829_1752141_+	toxin HigB-2	NA	NA	NA	NA	NA
WP_038182073.1|1752143_1752434_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155271852.1|1752618_1752924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336593.1|1752965_1753241_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_038223619.1|1753383_1753689_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	42.5	8.4e-09
WP_155271853.1|1753760_1753940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399196.1|1754483_1754798_+	phage antirepressor KilAC domain-containing protein	NA	A0A1B0YZY9	Pseudomonas_phage	52.9	4.4e-21
WP_082243317.1|1755046_1755760_+	phage antirepressor N-terminal domain-containing protein	NA	I6S627	Salmonella_phage	64.4	1.5e-69
WP_155270976.1|1755958_1756132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052726022.1|1756128_1756542_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	37.2	6.5e-12
WP_038223228.1|1756987_1757194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336597.1|1757328_1757634_+|tail	phage tail protein	tail	A0A2H4JI07	uncultured_Caudovirales_phage	43.8	6.4e-17
WP_046336598.1|1757630_1758371_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	57.8	4.3e-83
WP_082243381.1|1758381_1759080_+	C40 family peptidase	NA	A0A1B0VP68	Pseudomonas_phage	53.7	8.5e-57
WP_172664711.1|1761359_1761890_+	hypothetical protein	NA	A0A1W6JNZ8	Morganella_phage	60.6	2.6e-50
WP_046336599.1|1762090_1762933_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	48.6	5.0e-35
WP_038196221.1|1763758_1764511_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_038223519.1|1764573_1765896_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_080718323.1|1766247_1766544_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_046336600.1|1766727_1768038_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_046336601.1|1768037_1770215_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_038196204.1|1770556_1771039_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_046336602.1|1771245_1772466_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	57.0	1.2e-141
1777699:1777714	attR	GGGCATTGATGAAAAT	NA	NA	NA	NA
>prophage 12
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	1854431	1927547	4635301	tRNA,protease,transposase	Paenibacillus_phage(17.39%)	73	NA	NA
WP_038225121.1|1854431_1854869_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
WP_046336626.1|1855491_1857222_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	1.4e-87
WP_038214983.1|1857514_1858069_+	VOC family protein	NA	NA	NA	NA	NA
WP_038197460.1|1858238_1858985_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_038214981.1|1859081_1860053_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_046336627.1|1860049_1860808_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_012988703.1|1861007_1861406_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_046336628.1|1861673_1863443_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.0	1.5e-09
WP_038214976.1|1863442_1863877_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_038208257.1|1863907_1864651_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038208254.1|1864746_1865268_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	29.6	1.5e-10
WP_038197899.1|1865349_1865967_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_046336629.1|1865983_1866991_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.7	4.8e-08
WP_038197895.1|1867102_1867594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336630.1|1867586_1868186_+	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_046336631.1|1868327_1869113_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_046337945.1|1869109_1869868_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.8	4.8e-21
WP_046336632.1|1869943_1870900_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_038183491.1|1870920_1872234_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.6	7.3e-17
WP_038244904.1|1872358_1873327_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_046336633.1|1873384_1874827_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_046337946.1|1875003_1875852_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046336634.1|1876245_1877721_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.4	4.0e-80
WP_038196889.1|1878214_1878565_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_172664712.1|1878569_1878899_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_046336635.1|1878999_1879344_-	RidA family protein	NA	NA	NA	NA	NA
WP_046336636.1|1879446_1881363_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.0	2.5e-90
WP_038208228.1|1881427_1882123_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_046336637.1|1882237_1882813_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_038196882.1|1883311_1885009_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	27.2	1.5e-30
WP_046336639.1|1885172_1886300_+	ribonuclease D	NA	NA	NA	NA	NA
WP_155399053.1|1887346_1888113_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	2.5e-25
WP_046336642.1|1889476_1890646_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_172664648.1|1891250_1891397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336643.1|1891543_1891882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336644.1|1892288_1892654_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	37.4	9.1e-10
WP_046336645.1|1892745_1892964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336646.1|1893140_1893329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399099.1|1893325_1893502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399100.1|1893639_1893801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071839196.1|1893919_1894591_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_046336648.1|1894931_1895336_-	antitermination protein	NA	S5M7R9	Escherichia_phage	52.8	2.3e-30
WP_155399101.1|1896331_1896496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399102.1|1896556_1896721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336650.1|1897418_1897829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399197.1|1900285_1901126_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.8	1.4e-24
WP_046336652.1|1901208_1902378_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_038188832.1|1903168_1903927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038208538.1|1904391_1905036_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_052726025.1|1905301_1906477_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_038208541.1|1906688_1907003_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_046336653.1|1907220_1908027_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_038183193.1|1908026_1909217_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_046336654.1|1909248_1910613_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	1.2e-38
WP_038208548.1|1910615_1911614_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.6	3.7e-53
WP_038208549.1|1911628_1912207_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	33.9	7.6e-27
WP_046336655.1|1912206_1913766_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_046336656.1|1914208_1914970_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.4	1.7e-13
WP_046336657.1|1915462_1916446_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.6	4.0e-44
WP_155271792.1|1916490_1917528_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_082243320.1|1917799_1918522_+|transposase	transposase	transposase	A0A1S7J231	Thermus_phage	28.9	1.2e-13
WP_155399053.1|1918482_1919249_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	2.5e-25
WP_052726027.1|1919301_1919658_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	40.3	9.2e-07
WP_046336658.1|1919641_1919833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038225121.1|1919894_1920332_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
WP_155399104.1|1920442_1920592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155272059.1|1921314_1922121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336661.1|1922288_1923149_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_046336662.1|1923177_1923798_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_046336663.1|1923863_1924808_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_038197571.1|1924881_1925478_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_046336664.1|1925477_1926242_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_038197569.1|1926500_1927547_+|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 13
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	2001321	2083067	4635301	integrase,protease,transposase	Virus_Rctr85(33.33%)	36	1990226:1990241	2020678:2020693
1990226:1990241	attL	TGCTGGTTTGTTAGCA	NA	NA	NA	NA
WP_046336704.1|2001321_2004372_+|protease	autotransporter serine protease	protease	NA	NA	NA	NA
WP_046336705.1|2005676_2006870_-	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_046336706.1|2006920_2007565_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_046336707.1|2009277_2010639_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_046336708.1|2010772_2011720_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046336709.1|2012237_2013407_+	MFS transporter	NA	NA	NA	NA	NA
WP_046336710.1|2013525_2015490_-	decarboxylase	NA	NA	NA	NA	NA
WP_038202661.1|2015948_2016296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038193578.1|2016526_2017282_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_038183381.1|2017408_2018353_+	universal stress protein UspE	NA	NA	NA	NA	NA
WP_046337956.1|2018644_2019601_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	35.8	4.3e-43
WP_046336711.1|2020071_2027583_-	insecticidal toxin complex protein A	NA	NA	NA	NA	NA
2020678:2020693	attR	TGCTAACAAACCAGCA	NA	NA	NA	NA
WP_046336712.1|2027695_2028793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082243324.1|2028792_2028948_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_046336713.1|2029080_2029515_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_046336253.1|2029627_2030665_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046336714.1|2030735_2031362_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_046335530.1|2031475_2032597_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_046336715.1|2043759_2045508_+	cytochrome-c oxidase	NA	NA	NA	NA	NA
WP_038202909.1|2045715_2047104_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_038223327.1|2047114_2048647_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_038202905.1|2049014_2049968_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_038213181.1|2050288_2051680_+	amino acid permease	NA	NA	NA	NA	NA
WP_046336716.1|2053241_2053928_+	molecular chaperone	NA	NA	NA	NA	NA
WP_046336717.1|2053967_2056517_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_046336718.1|2056565_2057567_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_172664713.1|2069644_2073538_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	31.6	1.1e-57
WP_046336720.1|2073902_2074517_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_038223334.1|2074601_2074922_-	YdbL family protein	NA	NA	NA	NA	NA
WP_071839200.1|2074932_2075067_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_046335530.1|2075092_2076214_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_046336721.1|2076356_2078981_-	YdbH family protein	NA	NA	NA	NA	NA
WP_038196869.1|2079251_2080247_+	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	42.2	6.4e-66
WP_038223338.1|2080271_2080706_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_038196871.1|2081210_2081504_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_155271792.1|2082029_2083067_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	2088736	2155530	4635301	plate,tail,transposase	Burkholderia_phage(10.53%)	52	NA	NA
WP_046336726.1|2088736_2089498_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.2	1.1e-12
WP_046335530.1|2089507_2090629_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_052726034.1|2090706_2091075_+|tail	tail fiber protein	tail	Q9B027	Phage_GMSE-1	40.0	8.0e-06
WP_046336727.1|2091632_2092322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336728.1|2092370_2092793_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	39.6	8.3e-23
WP_052726035.1|2092795_2093977_-|tail	tail fiber protein	tail	A9YX14	Burkholderia_phage	45.5	2.2e-12
WP_046336729.1|2093984_2094638_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	45.1	2.1e-49
WP_046336730.1|2094634_2095822_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	54.9	1.1e-115
WP_046336731.1|2095825_2096173_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	56.9	3.2e-28
WP_046336733.1|2096172_2096928_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	68.2	1.4e-73
WP_046336734.1|2098076_2099063_-	chitinase	NA	NA	NA	NA	NA
WP_046336735.1|2100887_2108513_-	Mcf protein	NA	NA	NA	NA	NA
WP_080717485.1|2109482_2110019_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046336736.1|2110724_2112437_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.8	2.4e-20
WP_038218170.1|2112654_2113191_+	septation protein A	NA	NA	NA	NA	NA
WP_046336737.1|2113263_2113701_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_051870721.1|2113919_2114630_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_071826315.1|2114725_2114905_-	YciY family protein	NA	NA	NA	NA	NA
WP_038195233.1|2115224_2116685_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_038195234.1|2116837_2117191_+	YciU family protein	NA	NA	NA	NA	NA
WP_038195236.1|2117285_2118287_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	3.9e-18
WP_038188880.1|2118283_2119291_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	3.6e-16
WP_038208598.1|2119300_2120209_-	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_046336738.1|2120222_2121143_-	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_046336739.1|2121225_2122863_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_046336740.1|2122987_2124631_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038208607.1|2125241_2125886_-	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_046336741.1|2126382_2129046_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_046336742.1|2129152_2129752_-	thymidine kinase	NA	A7XF40	Enterobacteria_phage	57.2	1.9e-57
WP_038188905.1|2130399_2130801_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_046336743.1|2131035_2132052_-	NAD-dependent epimerase	NA	A0A0E3FNQ3	Synechococcus_phage	27.7	1.2e-27
WP_046336744.1|2132060_2133404_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.9	2.4e-79
WP_038208622.1|2133428_2134346_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.2	5.6e-64
WP_038192144.1|2134544_2135570_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_046336745.1|2135722_2136184_+	YchJ family protein	NA	NA	NA	NA	NA
WP_038188923.1|2136257_2137106_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	33.9	7.0e-13
WP_038188925.1|2137751_2138615_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046336746.1|2139265_2140072_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_038192148.1|2140132_2142067_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.0	4.8e-41
WP_038192149.1|2142072_2143116_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_038208631.1|2143128_2143680_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_046336747.1|2143847_2145758_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_038218193.1|2145864_2146884_+	asparaginase	NA	NA	NA	NA	NA
WP_046336748.1|2146907_2147543_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A1V0SL12	Klosneuvirus	32.4	4.3e-15
WP_038188948.1|2147621_2147903_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_046336749.1|2147989_2148403_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_038192158.1|2148744_2149740_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_046336750.1|2149879_2150752_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_038218201.1|2150848_2151595_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_038224755.1|2151874_2152942_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_038218203.1|2152958_2154260_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_046336150.1|2154768_2155530_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.4	1.7e-13
>prophage 15
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	2161384	2215844	4635301	transposase,terminase,holin,tail,lysis	Morganella_phage(16.67%)	56	NA	NA
WP_046336755.1|2161384_2161810_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	44.4	7.6e-24
WP_172664649.1|2163521_2164001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052726036.1|2165922_2166255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336758.1|2166299_2166689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336759.1|2167583_2169467_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.3	1.2e-33
WP_046336760.1|2169705_2170668_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.4	3.6e-21
WP_052726037.1|2170667_2171612_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_172664668.1|2171668_2171872_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_052726038.1|2172142_2172433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399055.1|2173486_2174192_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	50.6	5.2e-62
WP_038209618.1|2174643_2175213_-	HutD family protein	NA	NA	NA	NA	NA
WP_046336762.1|2175339_2176761_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_046336763.1|2176899_2178237_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_046336764.1|2178226_2179234_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071839201.1|2179214_2179373_+	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_155399116.1|2179439_2179916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336765.1|2179851_2180691_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_046336766.1|2180764_2181553_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	67.6	3.1e-79
WP_172664714.1|2181942_2182929_-	endonuclease	NA	NA	NA	NA	NA
WP_038247262.1|2183284_2183722_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	44.9	1.7e-26
WP_038209600.1|2183833_2184262_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	42.3	1.9e-22
WP_046337968.1|2184391_2185648_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_046336768.1|2185766_2186711_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_046336769.1|2186707_2187799_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155399117.1|2188132_2188306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336770.1|2188298_2189627_-	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_046336771.1|2189644_2191918_-	arginine decarboxylase	NA	NA	NA	NA	NA
WP_046336772.1|2192228_2193302_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	56.8	2.6e-20
WP_038222675.1|2193593_2194565_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_046336773.1|2194610_2195477_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_046336774.1|2195478_2196906_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_038195997.1|2196896_2197211_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_051875965.1|2197938_2198724_+	thioesterase	NA	NA	NA	NA	NA
WP_155399118.1|2199121_2199748_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.5	1.7e-35
WP_082243327.1|2199833_2200073_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	73.4	8.5e-25
WP_046336775.1|2200124_2200304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336776.1|2200317_2200545_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	65.5	9.3e-13
WP_046337971.1|2200547_2201144_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_046336778.1|2201140_2201767_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_155399119.1|2202192_2202660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336781.1|2202604_2203774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336782.1|2205043_2207434_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	38.7	9.5e-148
WP_046336783.1|2207984_2208305_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_038205651.1|2209130_2209625_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	80.5	3.2e-74
WP_046336785.1|2209872_2210076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336786.1|2210072_2210423_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	75.9	2.5e-49
WP_046336787.1|2210427_2210859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052726041.1|2210946_2211312_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	43.8	4.7e-14
WP_046337976.1|2211572_2212424_-	KilA-N domain-containing protein	NA	Q9MCN2	Enterobacteria_phage	52.6	1.4e-72
WP_155399121.1|2212801_2212978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155271792.1|2213010_2214048_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_172664669.1|2214247_2214445_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_052726042.1|2214441_2214912_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_046336789.1|2214908_2215310_-	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	56.2	3.4e-34
WP_046336790.1|2215306_2215531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172664715.1|2215511_2215844_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	50.0	7.7e-24
>prophage 16
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	2374007	2422907	4635301	transposase	Acinetobacter_phage(18.18%)	41	NA	NA
WP_038225121.1|2374007_2374445_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
WP_038203265.1|2374711_2375338_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012989266.1|2375378_2375699_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_038212840.1|2376158_2377586_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_038207682.1|2377703_2379434_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_038193028.1|2379617_2381000_-	APC family permease	NA	NA	NA	NA	NA
WP_046336853.1|2381658_2383632_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	28.9	1.1e-08
WP_046336854.1|2383784_2384573_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	5.5e-12
WP_046336855.1|2384569_2385655_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_172664672.1|2385675_2386827_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046336857.1|2387037_2388525_-	amino acid permease	NA	NA	NA	NA	NA
WP_038193020.1|2388693_2389557_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038212847.1|2389747_2390830_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_046336858.1|2390932_2391775_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.2	8.0e-25
WP_038193015.1|2391775_2392714_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_038193066.1|2392957_2393377_+	NUDIX domain-containing protein	NA	I3WW32	Acinetobacter_phage	32.5	9.2e-06
WP_038207701.1|2393556_2394801_+	tryptophan permease	NA	NA	NA	NA	NA
WP_038207704.1|2394932_2395505_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_038190347.1|2395574_2395886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038207741.1|2396168_2396480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038225108.1|2396956_2397661_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_046336859.1|2398004_2398589_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	42.6	1.2e-16
WP_038193004.1|2398663_2399008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038207709.1|2399690_2400878_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	27.4	2.0e-26
WP_038212851.1|2400924_2401632_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_038207715.1|2401902_2403660_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	5.8e-94
WP_012989294.1|2403822_2404104_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_046336860.1|2404201_2405209_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	50.2	7.2e-89
WP_012989296.1|2405408_2405636_+	YejL family protein	NA	NA	NA	NA	NA
WP_038207721.1|2405665_2407405_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_046337982.1|2407803_2408064_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	51.2	2.6e-19
WP_038192993.1|2409191_2409467_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082243379.1|2410006_2411116_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155271792.1|2412307_2413345_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046336861.1|2414133_2414964_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_046336862.1|2415215_2416832_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_052726044.1|2417249_2418536_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_155399124.1|2419656_2419833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336863.1|2419897_2420599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399198.1|2420672_2421514_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	45.1	1.4e-21
WP_046336865.1|2421737_2422907_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	2514307	2718980	4635301	plate,integrase,protease,transposase,terminase,head,holin,capsid,tail,portal	uncultured_Caudovirales_phage(20.0%)	197	2550324:2550341	2703036:2703110
WP_052726047.1|2514307_2519623_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_046336902.1|2519789_2521601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071827747.1|2521926_2522010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336903.1|2522888_2523200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336904.1|2523368_2524745_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_172664674.1|2525029_2525638_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	70.2	4.6e-67
WP_046336905.1|2525819_2526005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336906.1|2526089_2526917_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_155399127.1|2528524_2529208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399128.1|2529214_2530297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052726050.1|2530257_2531346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052726051.1|2531329_2533087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052726052.1|2533102_2534938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336908.1|2536209_2537244_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_155399129.1|2540788_2542006_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_046336909.1|2542089_2542371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399130.1|2542497_2543259_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.9	2.8e-13
WP_012988408.1|2543402_2544059_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_038197469.1|2544068_2544458_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.0	2.2e-06
WP_046336910.1|2544526_2545579_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	34.1	2.7e-06
WP_038197471.1|2545571_2546462_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_038204639.1|2546468_2548100_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.2	2.2e-07
WP_038224139.1|2548155_2549859_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.2	1.1e-09
WP_038197475.1|2550035_2550533_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
2550324:2550341	attL	GTCAATAATGGGAACAAT	NA	NA	NA	NA
WP_038197477.1|2550544_2552710_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
2550324:2550341	attL	GTCAATAATGGGAACAAT	NA	NA	NA	NA
WP_038218845.1|2552716_2553718_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_038197479.1|2553720_2554602_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_038190163.1|2554739_2555321_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_012988397.1|2555323_2555674_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_051870757.1|2558051_2558441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336911.1|2559071_2559677_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	42.3	1.8e-07
WP_010847246.1|2560504_2560717_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	77.1	1.7e-24
WP_038197484.1|2561193_2561703_+	YlaC family protein	NA	NA	NA	NA	NA
WP_155399200.1|2564161_2565003_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.9	3.3e-23
WP_038197486.1|2565655_2566708_+	dihydroorotase	NA	NA	NA	NA	NA
WP_038197376.1|2566943_2567198_+	biofilm formation regulator BssS	NA	NA	NA	NA	NA
WP_038224099.1|2567413_2568007_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_038197374.1|2568099_2569158_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_038197372.1|2569555_2570497_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	44.6	3.3e-64
WP_046336912.1|2571276_2572812_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	58.5	8.8e-163
WP_046336913.1|2572985_2573414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336914.1|2573764_2574985_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.7	3.7e-140
WP_046336915.1|2574981_2575728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012987292.1|2575834_2576116_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_052726056.1|2576134_2576857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399132.1|2576904_2577057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336916.1|2577502_2577685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336917.1|2577875_2578067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071839207.1|2578059_2578230_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_046336918.1|2578232_2578538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336919.1|2578531_2581267_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.1	3.7e-265
WP_046336920.1|2581683_2581872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336921.1|2582108_2583263_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	68.2	2.0e-143
WP_046336922.1|2583308_2583848_+	HNH endonuclease	NA	G0ZNE5	Cronobacter_phage	40.1	8.4e-28
WP_046336923.1|2583844_2584390_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	53.9	1.0e-49
WP_046336924.1|2584392_2585610_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	78.6	2.5e-189
WP_046336079.1|2585602_2585905_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	67.4	2.0e-31
WP_046336925.1|2585904_2586342_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	62.9	1.6e-48
WP_038195049.1|2586616_2586976_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	70.9	4.7e-43
WP_046336926.1|2586987_2588649_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	79.0	4.4e-269
WP_172664721.1|2589117_2589699_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	56.6	1.5e-51
WP_046336927.1|2589699_2589966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336928.1|2590250_2591039_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_038197145.1|2591092_2591599_+	DUF1543 domain-containing protein	NA	NA	NA	NA	NA
WP_038209467.1|2591655_2592798_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_046336929.1|2592836_2594417_-	L-lactate permease	NA	NA	NA	NA	NA
WP_046336930.1|2594734_2595655_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046336931.1|2595862_2596645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336932.1|2597051_2597654_-	serine hydrolase family protein	NA	NA	NA	NA	NA
2596890:2596907	attR	ATTGTTCCCATTATTGAC	NA	NA	NA	NA
WP_038225121.1|2598009_2598447_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
2596890:2596907	attR	ATTGTTCCCATTATTGAC	NA	NA	NA	NA
WP_052726057.1|2598501_2598939_-	NADAR family protein	NA	A0A125SA38	Pseudomonas_phage	45.2	6.4e-18
WP_038181232.1|2599150_2599603_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_038181229.1|2599715_2599910_-	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	63.9	6.7e-12
WP_038209463.1|2600010_2600727_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	41.9	6.7e-41
WP_082243333.1|2601657_2602194_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_038209454.1|2602253_2602796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012987298.1|2603167_2603383_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	1.7e-24
WP_155272332.1|2603882_2605808_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_038181218.1|2606059_2606542_+	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_046336933.1|2606572_2607565_+	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_046336934.1|2607601_2608681_+	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_038209439.1|2608693_2609257_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046336935.1|2609253_2610252_+	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_046336936.1|2610339_2610630_+	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_046336937.1|2610642_2611944_+	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038195336.1|2612622_2613216_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	37.3	1.4e-28
WP_046336938.1|2613353_2613749_+	VOC family protein	NA	NA	NA	NA	NA
WP_038224468.1|2613963_2614398_-	lysozyme	NA	A0A223W0U3	Agrobacterium_phage	53.5	1.0e-36
WP_082243333.1|2616454_2616991_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052726058.1|2618240_2618726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038195343.1|2619090_2619543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399053.1|2620193_2620960_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	2.5e-25
WP_046336939.1|2621376_2622993_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_172664722.1|2623139_2623385_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	59.7	2.3e-17
WP_038195346.1|2623407_2624538_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.3	9.9e-172
WP_038224470.1|2624550_2626842_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	64.1	4.2e-286
WP_046336940.1|2627208_2627943_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_038209399.1|2628136_2630779_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	31.2	4.0e-107
WP_071839208.1|2630961_2633790_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.2	9.5e-38
WP_012987314.1|2633873_2634524_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_046336942.1|2634525_2637228_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_038209413.1|2638160_2639369_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_038209416.1|2639481_2640024_-	porin	NA	NA	NA	NA	NA
WP_046336943.1|2640174_2641575_-	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_038214798.1|2641565_2642561_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_038214800.1|2642560_2643418_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_172664723.1|2643430_2644201_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_046336944.1|2644197_2645883_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_071839209.1|2646157_2646550_-	fimbrial protein	NA	NA	NA	NA	NA
WP_046336946.1|2646542_2647043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082243335.1|2647064_2649245_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_046336947.1|2649259_2650381_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_046336949.1|2650872_2651532_-	molecular chaperone	NA	NA	NA	NA	NA
WP_172664675.1|2651545_2651860_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	64.9	1.8e-22
WP_046336150.1|2651882_2652644_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.4	1.7e-13
WP_046336950.1|2652860_2653139_-|transposase	transposase	transposase	A0A2L1IV22	Escherichia_phage	45.2	3.9e-13
WP_051862971.1|2653349_2653568_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.3	1.8e-13
WP_038195355.1|2653760_2654627_+	DUF817 domain-containing protein	NA	NA	NA	NA	NA
WP_038214685.1|2655448_2656321_-	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_046336953.1|2656698_2656977_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	58.8	1.8e-21
WP_046336954.1|2658292_2658892_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	78.9	6.8e-87
WP_046336955.1|2658884_2660114_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	85.5	7.2e-200
WP_038198114.1|2660103_2660265_-	hypothetical protein	NA	A0A1W6JP78	Morganella_phage	62.3	8.9e-10
WP_046336956.1|2660261_2661992_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	82.2	3.6e-290
WP_038205651.1|2661988_2662483_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	80.5	3.2e-74
WP_038223387.1|2662931_2663282_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	75.0	2.1e-48
WP_155271358.1|2663708_2663867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071826251.1|2663937_2664114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336957.1|2664333_2664735_-	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	56.2	1.5e-34
WP_172664658.1|2664731_2665034_-|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	63.5	9.5e-29
WP_155271357.1|2665845_2665995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038205662.1|2666136_2666601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399133.1|2668604_2668757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336958.1|2671617_2671923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071839194.1|2671925_2672096_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_046336959.1|2672088_2672337_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	51.6	3.4e-08
WP_046336961.1|2672333_2672522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172664676.1|2672655_2672829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336962.1|2673521_2674244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336963.1|2674326_2674542_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	46.2	9.4e-07
WP_052726063.1|2674832_2675561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336964.1|2675573_2675888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336965.1|2676067_2677330_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	36.6	5.9e-64
WP_046336966.1|2677951_2679067_+	acyltransferase	NA	NA	NA	NA	NA
WP_046336494.1|2679121_2679640_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	40.9	1.3e-33
WP_052726010.1|2679632_2680757_-|tail	tail fiber protein	tail	A9YX14	Burkholderia_phage	47.7	2.5e-13
WP_046336967.1|2680764_2681418_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	44.6	1.4e-48
WP_046336968.1|2681414_2682602_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	54.9	1.1e-115
WP_046336969.1|2682605_2682953_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	57.8	4.9e-29
WP_046336970.1|2682952_2683708_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	67.3	5.4e-73
WP_046336971.1|2683704_2684649_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	39.3	1.4e-65
WP_038204514.1|2684701_2685730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038204516.1|2685753_2686053_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	42.7	1.3e-14
WP_046336972.1|2686049_2686673_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	54.2	3.9e-45
WP_052726064.1|2686672_2688868_-	hypothetical protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	54.2	5.0e-111
WP_172664666.1|2688857_2689004_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	48.9	2.1e-05
WP_046336973.1|2689039_2689483_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	35.5	1.6e-16
WP_046336505.1|2689482_2689923_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	68.5	1.9e-49
WP_046336974.1|2689927_2691394_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	49.0	3.7e-126
WP_046336975.1|2691399_2691933_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	57.5	3.3e-53
WP_046336976.1|2691929_2692310_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	67.5	4.2e-42
WP_046336977.1|2692312_2692804_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	56.7	4.3e-47
WP_046336978.1|2692800_2693211_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	66.2	1.7e-44
WP_052726065.1|2693191_2693560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336979.1|2693560_2694499_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	69.3	1.9e-128
WP_046336980.1|2694507_2694999_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	64.8	4.8e-54
WP_046336981.1|2695003_2696224_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	60.5	9.8e-125
WP_172664677.1|2696365_2697088_-|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	72.3	1.3e-76
WP_046336982.1|2696975_2698658_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	73.9	7.8e-197
WP_046336983.1|2698657_2700277_-	bacteriophage TerL protein	NA	A9YWZ6	Burkholderia_phage	71.8	2.5e-237
WP_046336984.1|2700279_2700849_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	70.5	5.5e-62
WP_038212574.1|2700912_2701266_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	37.4	4.4e-09
WP_038212576.1|2701373_2701598_-	hypothetical protein	NA	E9NIF1	Enterobacter_phage	64.8	4.3e-18
WP_046336985.1|2701646_2701844_-	membrane protein	NA	NA	NA	NA	NA
WP_046336986.1|2702063_2702498_-	lysozyme	NA	R9TMH8	Aeromonas_phage	58.0	1.8e-41
WP_046336987.1|2702497_2702719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172664724.1|2702699_2703032_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	58.2	7.7e-24
WP_038207632.1|2703690_2704125_-	antitermination protein Q	NA	U5P0A5	Shigella_phage	44.6	7.2e-22
WP_046336988.1|2704421_2706671_-	PriCT-2 domain-containing protein	NA	B6SCU2	Bacteriophage	63.6	5.6e-275
WP_038212589.1|2706674_2706872_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046336989.1|2707010_2707697_+	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	44.8	1.5e-45
WP_046336990.1|2708273_2708753_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038207644.1|2708741_2708921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336991.1|2709269_2710034_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	41.4	2.2e-26
WP_046336992.1|2710036_2711323_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	61.2	4.8e-146
WP_046336993.1|2711352_2711916_+	DUF2815 family protein	NA	Q3LZQ2	Bacteriophage	61.3	1.3e-55
WP_046336994.1|2711964_2712600_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	49.8	4.4e-44
WP_155399134.1|2712596_2712836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336996.1|2712909_2714964_+	DNA polymerase I	NA	Q775A3	Bordetella_phage	67.9	1.1e-272
WP_046336997.1|2714967_2715336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046336998.1|2715346_2715598_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046336999.1|2715548_2715818_+	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	67.1	5.5e-28
WP_046337000.1|2716223_2716505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337002.1|2716725_2717220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337003.1|2717229_2717409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337004.1|2717405_2717588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337005.1|2717597_2718980_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	75.4	7.3e-217
>prophage 18
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	2854980	2904872	4635301	integrase,lysis,coat,holin,tail,portal	Enterobacteria_phage(15.56%)	75	2851134:2851159	2892011:2892036
2851134:2851159	attL	TTATGTACACAGTTATGTACACAATT	NA	NA	NA	NA
WP_052726073.1|2854980_2856840_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	50.0	1.0e-141
WP_052726074.1|2856824_2858288_-	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	44.6	6.1e-81
WP_046337064.1|2858287_2858962_-	hypothetical protein	NA	A0A0A0P253	Enterobacteria_phage	57.9	4.5e-39
WP_046337065.1|2858964_2859327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337066.1|2859326_2860004_-	hypothetical protein	NA	A0A0U2C3S2	Salmonella_phage	57.5	8.9e-43
WP_046337067.1|2860006_2861425_-	Packaged DNA stabilization protein gp10	NA	I1TEJ1	Salmonella_phage	76.3	1.5e-217
WP_046337068.1|2861384_2861894_-	hypothetical protein	NA	I6RSF6	Salmonella_phage	70.2	3.5e-60
WP_046337069.1|2861871_2862081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337070.1|2862123_2863404_-|coat	coat protein	coat	G5DA99	Enterobacteria_phage	69.5	4.3e-171
WP_046337071.1|2863405_2864305_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	75.5	1.8e-115
WP_046337072.1|2864318_2866409_-|portal	portal protein	portal	C6ZR08	Salmonella_phage	79.8	2.3e-291
WP_046337073.1|2866408_2867857_-	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	69.1	1.3e-200
WP_046337074.1|2867825_2868281_-	hypothetical protein	NA	Q716H4	Shigella_phage	54.0	4.4e-30
WP_038218577.1|2868338_2868563_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	57.5	1.4e-13
WP_038202493.1|2868644_2868884_-	hypothetical protein	NA	A0A2D1GMU2	Marinobacter_phage	57.6	8.6e-17
WP_046335967.1|2868929_2869205_-	hypothetical protein	NA	A0A0A8WEQ1	Clostridium_phage	50.0	2.6e-17
WP_046337075.1|2869197_2869674_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	38.4	2.9e-16
WP_046336957.1|2869670_2870072_-	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	56.2	1.5e-34
WP_172664658.1|2870068_2870371_-|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	63.5	9.5e-29
WP_046335970.1|2870729_2871053_-	negative regulator GrlR	NA	NA	NA	NA	NA
WP_046337845.1|2871236_2871491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337076.1|2872156_2872981_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	44.0	6.1e-54
WP_155399136.1|2872977_2873178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071839213.1|2873122_2873770_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	57.2	7.2e-50
WP_046337078.1|2873870_2874317_-	DUF1367 family protein	NA	A0A096XEN2	Escherichia_phage	64.4	2.2e-50
WP_046337079.1|2874319_2874694_-	hypothetical protein	NA	A0A1W6JP80	Morganella_phage	52.5	2.3e-24
WP_082243340.1|2874683_2874857_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_052726075.1|2874853_2875243_-	DUF2591 family protein	NA	J7I4M3	Pseudomonas_phage	33.8	4.4e-10
WP_046337080.1|2875239_2875530_-	hypothetical protein	NA	A0A1X9Y877	Proteus_phage	44.9	5.3e-13
WP_046337081.1|2875551_2876925_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	59.8	2.1e-152
WP_046337082.1|2876926_2878012_-	replication protein	NA	E5AGE9	Erwinia_phage	57.9	2.0e-105
WP_172664678.1|2878004_2878172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337083.1|2878232_2878622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337084.1|2878755_2878986_-	hypothetical protein	NA	A0A088CE43	Shigella_phage	63.5	6.5e-22
WP_046337085.1|2879074_2879815_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	50.2	4.6e-61
WP_155399137.1|2880270_2880546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038213051.1|2880542_2881064_-	super-infection exclusion protein B	NA	Q76H59	Enterobacteria_phage	39.3	1.1e-27
WP_155399138.1|2881222_2881384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337087.1|2881540_2881825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335989.1|2881981_2882350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337088.1|2882413_2883250_+	hypothetical protein	NA	M9NYX5	Enterobacteria_phage	42.1	3.0e-56
WP_046337089.1|2883297_2883600_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_155399139.1|2883596_2884022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399140.1|2884014_2884191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337090.1|2884183_2884579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172664659.1|2884653_2884794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172664679.1|2884796_2885003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172664680.1|2884999_2885164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335993.1|2885160_2885502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337092.1|2885503_2886181_+	AAA family ATPase	NA	K7PMI2	Enterobacteria_phage	66.2	3.1e-80
WP_046337093.1|2886177_2886783_+	hypothetical protein	NA	A0A2D1GLM1	Escherichia_phage	57.2	1.6e-59
WP_046337094.1|2886885_2887317_+	hypothetical protein	NA	G0YQE7	Erwinia_phage	51.1	5.9e-32
WP_046337095.1|2887313_2888066_+	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	52.1	5.4e-65
WP_155271820.1|2888055_2888226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337096.1|2888218_2888443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052726122.1|2888546_2888726_+	hypothetical protein	NA	A0A2I7QQE5	Vibrio_phage	45.2	2.7e-07
WP_046337097.1|2888738_2888939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337099.1|2889133_2889358_+	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	75.0	5.7e-23
WP_046337100.1|2889332_2889977_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	64.9	5.4e-74
WP_046337101.1|2889957_2890185_+	hypothetical protein	NA	A0A193GYL4	Enterobacter_phage	60.0	1.6e-17
WP_155399141.1|2890217_2890403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337103.1|2890399_2890612_+	hypothetical protein	NA	A0A1P8DTI1	Proteus_phage	56.9	7.9e-14
WP_046337104.1|2890604_2890838_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	70.1	2.9e-25
WP_046337105.1|2890813_2891995_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	71.0	1.4e-165
WP_038206270.1|2892652_2893336_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
2892011:2892036	attR	TTATGTACACAGTTATGTACACAATT	NA	NA	NA	NA
WP_172664726.1|2893673_2894546_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046337107.1|2894542_2895454_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	26.3	4.0e-14
WP_038224894.1|2895450_2896326_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_038206275.1|2896322_2897198_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_038198048.1|2897352_2898216_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_038206281.1|2898555_2899095_-	YniB family protein	NA	NA	NA	NA	NA
WP_038206284.1|2900517_2901360_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	49.1	5.0e-35
WP_038218535.1|2901611_2902046_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	40.3	1.5e-19
WP_155399143.1|2903021_2904188_-	DUF1983 domain-containing protein	NA	O64335	Escherichia_phage	39.5	2.5e-32
WP_046337109.1|2904296_2904872_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	60.0	3.5e-56
>prophage 19
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	2946692	3086648	4635301	lysis,protease,transposase,terminase,tRNA,head,holin,capsid,tail,portal	Morganella_phage(22.22%)	108	NA	NA
WP_046337126.1|2946692_2947649_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_038207558.1|2950266_2951478_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_038207560.1|2951498_2952545_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_046337128.1|2952541_2954020_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_046337129.1|2954056_2955400_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_046337130.1|2955412_2956387_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_038207568.1|2956408_2957833_+	amino acid permease	NA	NA	NA	NA	NA
WP_038223561.1|2958032_2960177_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_038192962.1|2960339_2961542_-	acetate kinase	NA	NA	NA	NA	NA
WP_038207575.1|2961806_2962262_+	DUF412 domain-containing protein	NA	NA	NA	NA	NA
WP_038192969.1|2962411_2962906_+	YfbU family protein	NA	NA	NA	NA	NA
WP_172664727.1|2962933_2963602_+	sugar phosphatase	NA	NA	NA	NA	NA
WP_046337131.1|2963764_2965594_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_038207584.1|2965679_2966261_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	35.0	3.7e-05
WP_038207587.1|2966449_2967664_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_038218819.1|2968476_2969433_+	transcriptional regulator LrhA	NA	NA	NA	NA	NA
WP_038192980.1|2970143_2970587_+	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_038190638.1|2970602_2971277_+	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_172664682.1|2971357_2973157_+	NADH-quinone oxidoreductase subunit C/D	NA	NA	NA	NA	NA
WP_046337134.1|2973159_2973705_+	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_038192984.1|2973701_2975066_+	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_155399201.1|2975148_2977875_+	NADH-quinone oxidoreductase subunit NuoG	NA	NA	NA	NA	NA
WP_012989311.1|2977871_2978849_+	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_012989310.1|2978864_2979407_+	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_038190649.1|2979419_2979947_+	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_012989308.1|2979946_2980249_+	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_038207593.1|2980245_2982096_+	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_038192987.1|2982115_2983636_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_038207597.1|2983642_2985100_+	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_082243379.1|2987385_2988495_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_038193319.1|2988948_2989380_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_046338029.1|2989394_2990903_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_038193316.1|2990977_2992192_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_046337137.1|2992391_2994443_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_038207481.1|2994533_2995067_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038207608.1|2995179_2995614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038215543.1|2995830_2996124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038196183.1|2996698_2996974_-	YfcL family protein	NA	NA	NA	NA	NA
WP_038215541.1|2996996_2997548_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_038215539.1|2997570_2998371_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_046337138.1|2998440_2999526_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	1.5e-87
WP_046338030.1|2999676_3000609_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_046337139.1|3000870_3002244_-	amino acid permease	NA	NA	NA	NA	NA
WP_038215532.1|3002334_3003867_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.1	7.8e-87
WP_172664683.1|3003881_3005591_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_046338031.1|3005881_3006616_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_038196199.1|3006633_3007593_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_046337140.1|3007609_3008863_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_046337141.1|3009124_3009670_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_155399144.1|3010724_3010919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038225121.1|3011551_3011989_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
WP_082243344.1|3012096_3015144_-	host specificity protein J	NA	A0A1W6JNZ7	Morganella_phage	56.4	0.0e+00
WP_172664728.1|3015198_3015798_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	55.6	1.9e-52
WP_038195264.1|3015862_3016204_-	membrane lipoprotein lipid attachment site-containing protein	NA	K7PLP0	Enterobacteria_phage	46.9	2.5e-25
WP_038195263.1|3016263_3016968_-	C40 family peptidase	NA	Q9MCU3	Escherichia_phage	73.1	1.1e-104
WP_155399145.1|3016970_3017723_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	64.3	2.6e-96
WP_038195259.1|3017729_3018062_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	61.1	9.7e-35
WP_046337144.1|3018061_3021439_-	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	35.0	1.1e-141
WP_046337145.1|3021448_3021724_-	DUF4035 domain-containing protein	NA	K7PJX0	Enterobacterial_phage	59.6	6.0e-22
WP_046337146.1|3021732_3022131_-	hypothetical protein	NA	A0A0P0ZE84	Stx2-converting_phage	59.7	3.4e-34
WP_038226528.1|3022136_3022610_-|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	74.3	2.2e-56
WP_046337148.1|3022667_3023003_-	structure; structural component (phage or prophage Related)	NA	A0A1W6JP05	Morganella_phage	59.5	6.3e-34
WP_038202292.1|3022999_3023446_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	65.7	4.8e-45
WP_046337149.1|3023442_3023763_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	60.0	5.7e-32
WP_038217747.1|3023772_3024093_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	59.3	2.9e-28
WP_046337150.1|3024092_3024281_-	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	65.3	3.0e-09
WP_038202284.1|3024334_3025549_-|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	90.1	5.2e-203
WP_046337151.1|3025561_3026386_-|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	72.8	1.0e-109
WP_046337152.1|3026392_3027724_-|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	74.2	2.9e-194
WP_046337153.1|3027724_3029242_-|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	72.8	4.7e-209
WP_046337154.1|3029254_3029731_-|terminase	terminase	terminase	Q77WA1	Escherichia_phage	78.8	3.9e-61
WP_038202271.1|3029856_3030069_-	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	66.2	1.2e-17
WP_046337155.1|3030073_3030406_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	75.7	1.1e-46
WP_046337156.1|3030410_3030626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337157.1|3030642_3030870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337158.1|3031360_3031888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335967.1|3031909_3032185_-	hypothetical protein	NA	A0A0A8WEQ1	Clostridium_phage	50.0	2.6e-17
WP_046337159.1|3032177_3032654_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	43.2	1.5e-17
WP_046335969.1|3032650_3033052_-	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	56.2	1.2e-34
WP_172664658.1|3033048_3033351_-|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	63.5	9.5e-29
WP_046337160.1|3033709_3034033_-	negative regulator GrlR	NA	NA	NA	NA	NA
WP_046338033.1|3034216_3034471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065814053.1|3034913_3035699_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_046336648.1|3035936_3036341_-	antitermination protein	NA	S5M7R9	Escherichia_phage	52.8	2.3e-30
WP_155399146.1|3036333_3036486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337161.1|3036667_3039364_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	55.9	3.4e-279
WP_046337162.1|3039357_3039663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071839194.1|3039665_3039836_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_046336605.1|3039828_3040077_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	53.2	5.2e-09
WP_038222731.1|3040073_3040262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172664676.1|3040395_3040569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337165.1|3042108_3042282_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	47.9	1.9e-05
WP_052726079.1|3042413_3043430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172664651.1|3043598_3043850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038209730.1|3045230_3045560_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_046337166.1|3045574_3045853_-	acylphosphatase	NA	NA	NA	NA	NA
WP_172664684.1|3046075_3046396_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_038221510.1|3046460_3046874_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_046337167.1|3046893_3048957_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.7e-15
WP_046337168.1|3049023_3051186_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_172664685.1|3051246_3063069_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.1	7.7e-174
WP_046337170.1|3077976_3079170_-	MFS transporter	NA	NA	NA	NA	NA
WP_080717510.1|3079295_3080507_-	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_038194986.1|3081241_3081865_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_046337171.1|3082105_3082699_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_038194980.1|3083054_3084188_+	porin OmpA	NA	NA	NA	NA	NA
WP_038179931.1|3084262_3084712_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_038208906.1|3084917_3086648_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 20
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	3101756	3187503	4635301	tRNA,protease,transposase	Bacillus_phage(12.0%)	66	NA	NA
WP_046337179.1|3101756_3102971_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	32.6	2.6e-45
WP_046337180.1|3103177_3104578_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	3.1e-82
WP_155271372.1|3104885_3106028_+	porin	NA	Q1MVN1	Enterobacteria_phage	55.4	2.5e-106
WP_046337181.1|3106272_3107463_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_038208855.1|3107547_3108180_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.8	8.3e-27
WP_038179991.1|3108225_3108774_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	35.8	7.0e-06
WP_038225121.1|3109019_3109457_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
WP_046337182.1|3109815_3111534_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_038218461.1|3111781_3112495_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_046337183.1|3112656_3113520_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046338038.1|3114055_3115123_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_046337184.1|3115215_3116313_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_046337185.1|3116329_3117673_+	radical SAM protein	NA	NA	NA	NA	NA
WP_038218467.1|3117669_3118299_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_052726082.1|3118313_3118925_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_046337186.1|3118952_3120263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038218471.1|3120286_3121381_+	histidinol-phosphate aminotransferase family protein	NA	NA	NA	NA	NA
WP_038218472.1|3121383_3122079_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_046337187.1|3122071_3122605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080718384.1|3122722_3123898_+	MFS transporter	NA	NA	NA	NA	NA
WP_155399147.1|3123945_3125274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337188.1|3125350_3126568_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_046337189.1|3126611_3128501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038225155.1|3128561_3129227_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_051863150.1|3129271_3130207_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_038218476.1|3130206_3130422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337190.1|3131127_3131763_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	36.4	2.6e-20
WP_038225156.1|3132063_3132654_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	32.4	1.6e-08
WP_046337191.1|3132753_3137205_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_046337192.1|3137201_3137924_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_046337193.1|3137904_3139227_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_046337194.1|3139223_3140009_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_038206314.1|3140162_3140969_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_038206315.1|3141058_3141808_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_038180020.1|3141811_3141991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337195.1|3142099_3143095_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_038194925.1|3143091_3144840_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	33.0	1.0e-66
WP_046337196.1|3144875_3147221_-	ComEC family protein	NA	NA	NA	NA	NA
WP_012987387.1|3147425_3147716_-	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	38.9	8.5e-11
WP_046337197.1|3147788_3149462_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_038180049.1|3149655_3150342_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_046337198.1|3150534_3151821_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_046337199.1|3151937_3153026_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	9.8e-84
WP_046337200.1|3153859_3156919_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.8	9.2e-55
WP_038218498.1|3157433_3158483_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_038225167.1|3158631_3160395_+	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_038225121.1|3160548_3160986_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
WP_082243333.1|3162110_3162647_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046337201.1|3163346_3165629_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.3e-157
WP_038195367.1|3165751_3166492_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	29.1	1.3e-18
WP_038206326.1|3167202_3168024_+	membrane protein	NA	NA	NA	NA	NA
WP_046337202.1|3168211_3169018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038201014.1|3169135_3170425_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.9	3.0e-92
WP_038201016.1|3170544_3171888_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.5	8.4e-77
WP_038201018.1|3171898_3172507_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_046337203.1|3172576_3176008_-	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	47.2	4.6e-87
WP_004256338.1|3176140_3176635_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_046337204.1|3177271_3178231_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.0	2.0e-64
WP_046337205.1|3178361_3180131_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.9	4.4e-25
WP_038212353.1|3180133_3181876_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.7	2.3e-18
WP_038225182.1|3181884_3182574_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|3182729_3182948_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_046337206.1|3183060_3185346_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.9	8.7e-167
WP_012987462.1|3185377_3185698_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.3	1.1e-14
WP_046337207.1|3186021_3186252_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	1.6e-15
WP_046336150.1|3186741_3187503_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.4	1.7e-13
>prophage 21
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	3542266	3599491	4635301	tRNA,integrase,transposase	Klebsiella_phage(18.18%)	60	3554117:3554140	3600130:3600153
WP_038218710.1|3542266_3542986_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_046337346.1|3543229_3544270_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_012989710.1|3544299_3544572_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_038221843.1|3544724_3545798_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_046337347.1|3546244_3547306_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_046337348.1|3547333_3548710_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_046337349.1|3548727_3548955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337350.1|3550443_3550680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071839216.1|3550801_3550999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337351.1|3551006_3551981_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.4	3.1e-49
WP_155399156.1|3552056_3552218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337352.1|3552313_3552544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337353.1|3552551_3552929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052726089.1|3553279_3553891_-	hypothetical protein	NA	NA	NA	NA	NA
3554117:3554140	attL	TCACCCGAAAGCGCTTCTCTCAGA	NA	NA	NA	NA
WP_052726090.1|3554231_3554831_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_046337355.1|3554827_3555751_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_046337356.1|3556901_3557411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337357.1|3558010_3558712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337358.1|3558777_3559839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337360.1|3559828_3560647_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_046337361.1|3560740_3561541_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071839217.1|3561544_3562624_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_155271792.1|3562708_3563746_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046337362.1|3563832_3564498_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_046337363.1|3564715_3565378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337364.1|3565374_3566790_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_046337365.1|3566791_3568087_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_046337366.1|3568094_3568940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336253.1|3569023_3570061_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046337367.1|3570082_3570943_-	aminoglycoside 6-adenylyltransferase	NA	NA	NA	NA	NA
WP_046337368.1|3571063_3572155_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_046337369.1|3572151_3572805_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_046337370.1|3572873_3573392_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	74.1	1.7e-46
WP_046337371.1|3573408_3573618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337372.1|3573692_3574157_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_046337373.1|3574132_3574438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337374.1|3574469_3576467_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	2.7e-39
WP_046337375.1|3576480_3577194_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_155399205.1|3577915_3578756_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.9	5.2e-24
WP_046337376.1|3578805_3579783_+	arsenic resistance protein	NA	NA	NA	NA	NA
WP_046337378.1|3579901_3581185_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.4	4.7e-170
WP_046337379.1|3581246_3581600_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	45.1	1.2e-22
WP_046337380.1|3581796_3583020_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046338069.1|3583128_3583383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337381.1|3583402_3583966_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_046337382.1|3584046_3585612_-	ParB family protein	NA	NA	NA	NA	NA
WP_046337384.1|3585614_3586979_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	45.9	2.1e-99
WP_038256038.1|3586962_3587358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337385.1|3587354_3588242_-	ParA family protein	NA	NA	NA	NA	NA
WP_046338070.1|3588416_3589310_+	ParA family protein	NA	NA	NA	NA	NA
WP_046337386.1|3589299_3590670_+	replicative DNA helicase	NA	O80281	Escherichia_phage	51.4	1.6e-115
WP_052726092.1|3590673_3592413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337387.1|3592399_3593011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337388.1|3593016_3593610_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_046337389.1|3593612_3593855_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.8	3.4e-05
WP_046337390.1|3593940_3595158_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046337391.1|3595290_3595983_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_046337392.1|3596029_3596578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337393.1|3596604_3598635_+	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	23.2	2.7e-18
WP_038225121.1|3599053_3599491_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
3600130:3600153	attR	TCTGAGAGAAGCGCTTTCGGGTGA	NA	NA	NA	NA
>prophage 22
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	3878020	3925380	4635301	tRNA,integrase,transposase	Escherichia_phage(17.65%)	48	3882530:3882544	3925304:3925318
WP_155399168.1|3878020_3878941_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071839223.1|3879046_3880594_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	37.6	4.9e-28
WP_038203007.1|3880595_3881078_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_046337493.1|3881241_3882033_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_046337494.1|3882072_3882930_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
3882530:3882544	attL	ATTTCCAGCAAGTGC	NA	NA	NA	NA
WP_038193856.1|3883498_3883879_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_038203015.1|3883961_3884732_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046337495.1|3884728_3885655_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	1.4e-22
WP_012990013.1|3885836_3886490_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_012990014.1|3886566_3887112_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.3	6.7e-17
WP_038215629.1|3887496_3887760_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	61.8	1.9e-17
WP_046338087.1|3887864_3888347_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_038203023.1|3888770_3889142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337496.1|3889192_3889657_-	DUF943 family protein	NA	NA	NA	NA	NA
WP_082243388.1|3889649_3890717_-	DUF3289 family protein	NA	NA	NA	NA	NA
WP_038222488.1|3891078_3891354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038222490.1|3891446_3891794_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_071827758.1|3891867_3892407_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_038216181.1|3892576_3893584_-	2,3-diaminopropionate biosynthesis protein SbnB	NA	NA	NA	NA	NA
WP_038216184.1|3893593_3894529_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JIM2	Lactococcus_phage	30.6	5.2e-33
WP_046337497.1|3894751_3895552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038209825.1|3895555_3896197_+	LysE family translocator	NA	NA	NA	NA	NA
WP_046337499.1|3896469_3897810_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_046337500.1|3897888_3898548_-	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_046337501.1|3898547_3898904_-	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_038196718.1|3898925_3899597_-	CsgG/HfaB family protein	NA	NA	NA	NA	NA
WP_046337502.1|3899918_3900965_-	3-ketoacyl-CoA thiolase	NA	NA	NA	NA	NA
WP_038216194.1|3901802_3903128_+	membrane protein	NA	NA	NA	NA	NA
WP_038196722.1|3904083_3904635_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.0	8.5e-52
WP_046337503.1|3904961_3905915_-	GTPase	NA	NA	NA	NA	NA
WP_046337504.1|3905976_3906180_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_038209839.1|3906299_3908453_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_046337505.1|3908707_3910276_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_046337506.1|3910769_3911375_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	37.1	3.2e-28
WP_046337507.1|3911561_3912599_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046337508.1|3912715_3913633_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_038202374.1|3913625_3914399_-	type IV toxin-antitoxin system AbiEi family antitoxin	NA	NA	NA	NA	NA
WP_038216214.1|3914726_3915155_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	34.7	7.6e-16
WP_012989909.1|3915614_3915827_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	74.3	4.2e-23
WP_046337510.1|3916717_3916987_+|transposase	transposase	transposase	A0A0U2RK18	Escherichia_phage	50.6	1.5e-17
WP_082243360.1|3916965_3917139_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	45.3	3.1e-08
WP_155399205.1|3917191_3918032_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.9	5.2e-24
WP_046337511.1|3918354_3918825_+	SCP2 sterol-binding domain-containing protein	NA	A0A2P0VMX1	Tetraselmis_virus	29.7	1.9e-07
WP_051875985.1|3919000_3919387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046338091.1|3919766_3922328_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.3	1.1e-29
WP_038222509.1|3922494_3923490_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.7	6.1e-32
WP_038222511.1|3923543_3924602_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	37.5	2.5e-07
WP_038202528.1|3924753_3925380_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.0	4.7e-38
3925304:3925318	attR	ATTTCCAGCAAGTGC	NA	NA	NA	NA
>prophage 23
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	4140278	4207055	4635301	tRNA,transposase	Clostridium_botulinum_C_phage(14.29%)	59	NA	NA
WP_046337593.1|4140278_4141661_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_046337595.1|4141934_4142630_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.1	2.3e-38
WP_046337596.1|4142834_4143239_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_038208019.1|4143231_4143474_-	antitoxin	NA	NA	NA	NA	NA
WP_155399172.1|4143546_4143837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337598.1|4144625_4145012_+	VOC family protein	NA	NA	NA	NA	NA
WP_046337599.1|4145076_4147821_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_046337601.1|4149416_4149968_+	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_046337602.1|4149995_4151033_+	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_046337603.1|4151045_4151798_+	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_046337604.1|4151784_4152459_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_046337605.1|4152677_4153670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337606.1|4153669_4154821_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_046338104.1|4154829_4155957_+	DUF4056 domain-containing protein	NA	NA	NA	NA	NA
WP_038223298.1|4156024_4156498_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038216016.1|4156780_4156987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038208065.1|4157664_4158939_+	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.5	6.4e-18
WP_038208068.1|4159021_4159996_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_046338105.1|4160843_4161527_+|tRNA	alanyl-tRNA synthetase	tRNA	NA	NA	NA	NA
WP_046337607.1|4161516_4162434_+	DMT family transporter	NA	NA	NA	NA	NA
WP_038197415.1|4162508_4163039_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038225121.1|4163722_4164160_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
WP_046337608.1|4164271_4165672_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	32.4	9.2e-34
WP_052726107.1|4166794_4168441_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	1.2e-11
WP_046337609.1|4168437_4169370_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_046337610.1|4169699_4170572_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_046337611.1|4170629_4171682_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_038201875.1|4171902_4172682_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_038201873.1|4172678_4173539_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.9	7.9e-12
WP_038201870.1|4173522_4174638_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	35.0	8.3e-30
WP_038201866.1|4175372_4176503_+	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_038201859.1|4176849_4178538_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_038215586.1|4179777_4180293_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038201853.1|4180276_4180570_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_071839225.1|4180634_4180862_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_046337612.1|4181009_4181708_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_046337613.1|4181850_4182747_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046337614.1|4182803_4184072_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_046337615.1|4184495_4185029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071839226.1|4185025_4185607_-	MFS transporter	NA	NA	NA	NA	NA
WP_155399173.1|4185603_4185897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337617.1|4186251_4187208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082243363.1|4187821_4188568_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	43.5	3.2e-54
WP_012987068.1|4189131_4189452_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038201885.1|4190840_4191755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337618.1|4191923_4192667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337620.1|4194212_4194854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038225121.1|4194902_4195340_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
WP_071839227.1|4195549_4196212_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_046337621.1|4196204_4196831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052726108.1|4196939_4197752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038215449.1|4200005_4200275_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	64.6	5.7e-17
WP_155399175.1|4200859_4201117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046337624.1|4201693_4202833_-	hypothetical protein	NA	A0A2H4J138	uncultured_Caudovirales_phage	46.2	4.5e-71
WP_046337626.1|4202807_4203464_-	hypothetical protein	NA	A0A2H4J137	uncultured_Caudovirales_phage	44.5	1.4e-45
WP_046337627.1|4203741_4204086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399176.1|4204126_4204892_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	2.5e-25
WP_046337632.1|4204933_4205713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046336150.1|4206293_4207055_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.4	1.7e-13
>prophage 24
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	4326782	4389261	4635301	tRNA,protease,transposase	Pectobacterium_phage(10.0%)	49	NA	NA
WP_038205927.1|4326782_4327793_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_071826220.1|4327795_4329040_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	28.7	4.7e-05
WP_038191615.1|4329362_4330643_-	GTPase HflX	NA	NA	NA	NA	NA
WP_038191613.1|4330740_4331043_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_046337679.1|4331151_4332093_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_046337680.1|4332085_4334029_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	1.9e-61
WP_046337681.1|4334054_4335380_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.8	7.4e-17
WP_038191607.1|4335394_4335859_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_038218759.1|4336072_4337230_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_046337682.1|4337811_4339245_-	4-hydroxyphenylacetate 3-monooxygenase	NA	NA	NA	NA	NA
WP_155271824.1|4339705_4339936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046338122.1|4340103_4341525_-	amidase family protein	NA	NA	NA	NA	NA
WP_038193651.1|4341587_4341839_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_046337683.1|4342068_4343262_-	MFS transporter	NA	NA	NA	NA	NA
WP_082243391.1|4343436_4343625_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155399055.1|4343656_4344362_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	50.6	5.2e-62
WP_082243366.1|4344381_4345143_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046337684.1|4345755_4349124_+	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_082243367.1|4349338_4350520_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_046337686.1|4350506_4357649_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	31.3	5.3e-77
WP_038205898.1|4357958_4358603_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155271874.1|4359209_4359386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337687.1|4359772_4360318_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.0	2.5e-27
WP_038218768.1|4360428_4361496_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051863100.1|4361595_4362522_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_046337688.1|4362548_4365893_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_046337689.1|4365905_4367111_+	MFS transporter	NA	NA	NA	NA	NA
WP_046337690.1|4367107_4368562_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_038197021.1|4368566_4368998_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_071824483.1|4369274_4369628_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_046337691.1|4370158_4371172_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_038214065.1|4371302_4372700_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_038207779.1|4373283_4374084_-	sugar/pyridoxal phosphate phosphatase YigL	NA	NA	NA	NA	NA
WP_046337692.1|4374105_4375116_-	lysophospholipase L2	NA	NA	NA	NA	NA
WP_046337693.1|4375143_4376970_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.5	1.3e-85
WP_155271463.1|4377048_4377192_-	phospholipase A	NA	NA	NA	NA	NA
WP_038207784.1|4377372_4377858_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_080717485.1|4378330_4378867_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_038214057.1|4379686_4380577_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_012990416.1|4380614_4381565_-	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_046337694.1|4381656_4383831_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.4	2.6e-120
WP_046337695.1|4383886_4384603_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_038248525.1|4384602_4385517_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.0	9.0e-14
WP_155399180.1|4385513_4386233_-	DUF484 domain-containing protein	NA	NA	NA	NA	NA
WP_046337697.1|4386266_4387091_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080717580.1|4387139_4387325_-	lipoprotein	NA	NA	NA	NA	NA
WP_038192732.1|4387404_4387722_+	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_038225121.1|4387899_4388337_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	33.3	8.3e-18
WP_080717485.1|4388724_4389261_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_FO818637	Xenorhabdus bovienii strain CS03	4635301	4575943	4584683	4635301	integrase,capsid	Morganella_phage(50.0%)	9	4575872:4575886	4586864:4586878
4575872:4575886	attL	AGAGTGTACCACTAG	NA	NA	NA	NA
WP_046337758.1|4575943_4577215_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	84.6	3.1e-214
WP_046337759.1|4577211_4577910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337760.1|4578402_4578639_+	AlpA family phage regulatory protein	NA	A0A1W6JPE9	Morganella_phage	66.7	3.5e-23
WP_046337761.1|4578756_4579596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337762.1|4579618_4580638_+|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	46.6	4.1e-76
WP_046337763.1|4580634_4581156_+|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	54.2	2.1e-31
WP_046337764.1|4581229_4581742_+	ash family protein	NA	A0A1W6JPK3	Morganella_phage	57.6	4.2e-37
WP_046337765.1|4581744_4581963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046337766.1|4581962_4584683_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	32.7	1.5e-64
4586864:4586878	attR	AGAGTGTACCACTAG	NA	NA	NA	NA
>prophage 1
NZ_FO818638	Xenorhabdus bovienii strain CS03	177250	3486	135057	177250	protease,transposase,tRNA,integrase,plate	Escherichia_phage(50.91%)	120	7923:7952	157817:157846
WP_155399208.1|3486_4179_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	40.1	4.5e-34
WP_038197338.1|4327_4627_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038197339.1|4623_4974_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_038196315.1|6002_6335_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_046338158.1|6324_6660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172664735.1|6985_7660_+|transposase	transposase	transposase	Q8QNB6	Ectocarpus_siliculosus_virus	25.5	4.7e-12
WP_071839248.1|7667_7739_-|transposase	transposase	transposase	NA	NA	NA	NA
7923:7952	attL	GGGGTATTGTGCCCAATTCAGCGAAAAGTT	NA	NA	NA	NA
WP_046338161.1|7962_8181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046338162.1|8492_9452_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046338164.1|9471_10386_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_046338165.1|10438_11680_-	MFS transporter	NA	NA	NA	NA	NA
WP_046338264.1|12024_13176_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_046338166.1|13325_15791_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	45.6	2.2e-195
WP_038245175.1|15813_16227_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_046338167.1|16248_16839_-	VOC family protein	NA	NA	NA	NA	NA
WP_071839241.1|16841_17597_-	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	36.0	2.6e-11
WP_046338169.1|17633_18608_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_038245197.1|18680_19460_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_052726150.1|19595_20603_-	asparaginase	NA	K7Y9W2	Megavirus	29.3	5.6e-17
WP_046338172.1|21643_22279_-	recombinase family protein	NA	NA	NA	NA	NA
WP_038222953.1|22512_23109_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.6	4.8e-24
WP_071839243.1|24021_24177_+	putative rSAM-modified RiPP, XyeA family	NA	NA	NA	NA	NA
WP_046338175.1|24231_25410_+	XyeB family radical SAM/SPASM peptide maturase	NA	G5DEQ6	Salmonella_phage	32.4	1.6e-07
WP_046338176.1|25406_26270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046338178.1|26271_27492_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_046338179.1|27495_29622_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.3	2.1e-29
WP_046338182.1|30365_30647_-	helix-turn-helix transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	65.2	6.3e-27
WP_038207060.1|30643_30958_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	79.8	5.0e-41
WP_046338184.1|31222_31456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399209.1|31487_31655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052726126.1|34886_35249_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046338189.1|35453_35717_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052726127.1|36236_36602_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046338269.1|36739_37762_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	41.9	1.7e-69
WP_046338192.1|38579_39500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046338270.1|39642_41100_-	hypothetical protein	NA	A0A077SK57	Escherichia_phage	63.6	4.4e-180
WP_046338193.1|41162_42329_-	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	27.7	3.0e-30
WP_046338194.1|42604_43792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046338195.1|43792_44305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046338196.1|44294_44690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046338197.1|44854_45163_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155399211.1|45572_45839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399212.1|45922_46084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046338200.1|46443_47016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046338201.1|47019_47607_-	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	51.5	8.5e-34
WP_046338202.1|47982_48246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046338203.1|48245_48686_-	hypothetical protein	NA	A0A222YZ35	Escherichia_phage	50.7	5.8e-35
WP_046338204.1|48727_49873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046338205.1|49917_50955_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052726129.1|50987_56561_-	hypothetical protein	NA	A0A077SK04	Escherichia_phage	48.3	0.0e+00
WP_052726130.1|56640_58314_+	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	57.5	3.7e-175
WP_046338206.1|58347_59379_+	hypothetical protein	NA	A0A222YWA7	Escherichia_phage	51.6	4.0e-87
WP_046338207.1|59566_59761_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_046338208.1|60388_61321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046338209.1|61466_61718_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_046338210.1|61714_62002_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	46.3	1.3e-19
WP_155399215.1|62109_62325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155399220.1|62366_62888_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_046338211.1|63146_63416_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_046338212.1|63399_64629_-	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	26.5	4.7e-10
WP_052726132.1|64618_66193_-	VRR-NUC domain-containing protein	NA	A4JX24	Burkholderia_virus	29.3	2.6e-08
WP_082243394.1|66189_68229_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.4	1.1e-16
WP_155399055.1|68253_68960_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	50.6	5.2e-62
WP_046338213.1|69157_71896_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	40.2	1.3e-177
WP_082243395.1|71899_72310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046338214.1|72302_72488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046338215.1|72598_72805_-	AlpA family transcriptional regulator	NA	B7SYF9	Stenotrophomonas_phage	50.0	8.2e-08
WP_046338216.1|75786_76413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046338218.1|77250_79008_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_155399221.1|79053_81078_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.1	2.1e-23
WP_046338219.1|81086_81881_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_046338220.1|81896_83843_+	lipase family protein	NA	A0A2R8FER2	Brazilian_cedratvirus	31.1	4.4e-10
WP_046338221.1|83826_84591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046338222.1|84742_85519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046338280.1|86762_87722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172664736.1|88031_88199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046338223.1|88493_88859_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052726137.1|89280_89796_+	transcriptional regulator	NA	K4K6E9	Caulobacter_phage	32.6	4.6e-07
WP_052726116.1|92246_93356_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_172664737.1|94008_94218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052726138.1|94214_94586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155399222.1|94628_95666_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_046338226.1|95872_97507_-	hypothetical protein	NA	A0A222YWB9	Escherichia_phage	41.6	3.4e-40
WP_052726152.1|97506_97656_-	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	60.9	2.4e-09
WP_172664738.1|98029_98770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052726140.1|99087_99726_-	hypothetical protein	NA	A0A222YWB7	Escherichia_phage	51.0	3.6e-54
WP_046338228.1|99741_101154_-|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	53.2	1.6e-139
WP_046338229.1|101153_101507_-	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	47.9	1.3e-24
WP_052726141.1|101509_105478_-	hypothetical protein	NA	A0A222YXR4	Escherichia_phage	32.9	5.1e-98
WP_172664739.1|105600_106356_-	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	47.8	2.4e-60
WP_046338231.1|107186_107741_-	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	54.4	1.8e-54
WP_046338232.1|107744_108236_-|plate	baseplate protein	plate	A0A222YWE4	Escherichia_phage	63.8	3.3e-55
WP_082243396.1|108248_108824_-	hypothetical protein	NA	A0A222YY02	Escherichia_phage	52.6	6.4e-50
WP_052726143.1|108869_109598_-	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	37.4	1.1e-30
WP_046338233.1|109616_111197_-	hypothetical protein	NA	A0A222YWC8	Escherichia_phage	44.9	9.4e-128
WP_046338234.1|113212_113629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046338235.1|113669_114047_+	DUF2591 family protein	NA	J7I4M3	Pseudomonas_phage	38.9	3.8e-11
WP_046338236.1|114377_114701_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_046338237.1|114755_115052_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155399224.1|115053_115170_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_052726145.1|115460_115913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046338239.1|115921_116662_-	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	28.5	2.6e-19
WP_046338240.1|116958_117795_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	52.6	4.0e-77
WP_052726146.1|117787_118720_-	recombination-associated protein RdgC	NA	A0A1P8DTT8	Salmonella_phage	36.8	3.1e-46
WP_046338241.1|118934_119180_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046338292.1|119179_119530_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_052726147.1|119667_121014_-	DNA cytosine methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	45.0	4.1e-116
WP_052726153.1|121274_121817_-	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	63.6	1.5e-45
WP_046338242.1|121879_122812_-	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	44.2	2.4e-75
WP_046338243.1|122795_123593_-	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	30.6	4.1e-31
WP_046338244.1|124313_125528_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	58.0	2.0e-114
WP_046338245.1|125520_125853_-	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	53.3	3.7e-26
WP_052726149.1|125849_126503_-	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	38.1	3.3e-34
WP_172664740.1|126714_127056_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_046338247.1|127063_127405_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_155399218.1|127987_128554_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	36.8	2.2e-23
WP_038222025.1|128720_129761_-	zinc-dependent alcohol dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	24.8	3.2e-15
WP_046338249.1|130022_130718_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	1.1e-40
WP_046338250.1|130957_131698_-	thioesterase	NA	NA	NA	NA	NA
WP_046338251.1|131721_135057_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	24.9	4.4e-58
157817:157846	attR	GGGGTATTGTGCCCAATTCAGCGAAAAGTT	NA	NA	NA	NA
