The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	326966	334839	5630311	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
WP_046290475.1|326966_328328_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L277	Tupanvirus	38.6	4.4e-33
WP_046290476.1|328436_330266_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	46.0	2.4e-143
WP_046289972.1|330418_331639_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.6	2.4e-195
WP_046290070.1|331856_332453_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_046290069.1|332464_334009_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	48.5	8.3e-137
WP_046290068.1|334060_334408_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.4	4.1e-36
WP_052652849.1|334404_334839_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	31.6	1.1e-06
>prophage 2
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	1003099	1046498	5630311	tRNA,transposase	uncultured_Mediterranean_phage(23.08%)	41	NA	NA
WP_046289972.1|1003099_1004320_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.6	2.4e-195
WP_046290931.1|1004453_1005431_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.3	5.2e-44
WP_046290932.1|1005455_1007348_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_039396304.1|1007483_1007810_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	47.8	7.1e-14
WP_046290933.1|1007984_1009115_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.2	4.4e-87
WP_046290934.1|1009253_1010336_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_046290935.1|1010464_1012795_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_046290936.1|1012948_1013893_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.5	7.6e-08
WP_157122634.1|1014070_1014235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046290937.1|1014301_1015750_+	catalase	NA	A0A2K9L0T1	Tupanvirus	48.2	1.1e-101
WP_084009602.1|1015847_1016528_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_046290938.1|1016705_1017203_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	34.8	4.3e-18
WP_046290939.1|1017366_1018191_+	YdcF family protein	NA	NA	NA	NA	NA
WP_046290940.1|1018333_1018741_+	heme-binding protein	NA	NA	NA	NA	NA
WP_046290941.1|1019202_1019457_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_046290942.1|1019644_1020121_-	DUF1857 family protein	NA	NA	NA	NA	NA
WP_046290943.1|1020189_1020600_-	OsmC family protein	NA	NA	NA	NA	NA
WP_046290944.1|1020845_1021742_-	pirin family protein	NA	NA	NA	NA	NA
WP_046290945.1|1022002_1022425_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_046290946.1|1022452_1023190_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_052652950.1|1023259_1023979_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_046290947.1|1024336_1024600_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_084009603.1|1024737_1025685_-	glutamate racemase	NA	NA	NA	NA	NA
WP_039396360.1|1025818_1026298_-	bacterioferritin	NA	NA	NA	NA	NA
WP_046290948.1|1026529_1028053_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_046290949.1|1028116_1028686_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	32.5	2.3e-20
WP_046293414.1|1028842_1029730_-	DMT family transporter	NA	NA	NA	NA	NA
WP_046290950.1|1030094_1032077_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	43.4	6.1e-84
WP_065225753.1|1032418_1032880_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_046290951.1|1032876_1034895_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_084009998.1|1035578_1035893_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_052652954.1|1035982_1036441_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_046289885.1|1036437_1036785_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	62.9	1.3e-34
WP_046289884.1|1036843_1038430_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.0	1.4e-142
WP_084009604.1|1038461_1038638_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_157122635.1|1038705_1039792_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157122867.1|1039978_1041112_-	MFS transporter	NA	NA	NA	NA	NA
WP_157122635.1|1041208_1042296_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_046293417.1|1042434_1043118_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157122856.1|1043712_1044922_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	2.0e-98
WP_046290953.1|1045232_1046498_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	7.6e-104
>prophage 3
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	1050345	1086589	5630311	transposase	Mycobacterium_phage(37.5%)	25	NA	NA
WP_046290953.1|1050345_1051611_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	7.6e-104
WP_046290953.1|1052380_1053646_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	7.6e-104
WP_046290956.1|1054320_1055106_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	58.0	1.4e-79
WP_046290957.1|1055102_1056119_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.5	1.3e-74
WP_084009607.1|1056530_1057472_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_157122635.1|1057510_1058597_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_169834982.1|1058787_1060023_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_046289963.1|1060508_1061594_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_046293424.1|1063916_1064843_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_046293425.1|1065063_1065804_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046290960.1|1065813_1066449_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_169834983.1|1066926_1067154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052652962.1|1067386_1067950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046290963.1|1068033_1068315_-	XapX domain-containing protein	NA	NA	NA	NA	NA
WP_046293426.1|1068311_1068755_-	DoxX family protein	NA	NA	NA	NA	NA
WP_046290964.1|1068801_1070655_-	amidohydrolase	NA	NA	NA	NA	NA
WP_046290965.1|1070949_1071630_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_046290966.1|1071719_1072106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052652964.1|1072208_1072694_+	filamentous haemagglutinin family protein	NA	NA	NA	NA	NA
WP_046289884.1|1079204_1080791_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.0	1.4e-142
WP_046289885.1|1080849_1081197_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	62.9	1.3e-34
WP_052654594.1|1081193_1081652_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_046290953.1|1081964_1083230_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	7.6e-104
WP_157122637.1|1083494_1085441_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_157122856.1|1085379_1086589_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	2.0e-98
>prophage 4
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	1839139	1845245	5630311		Staphylococcus_phage(33.33%)	7	NA	NA
WP_046291440.1|1839139_1839940_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.3	5.4e-15
WP_046291441.1|1839936_1840650_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.2	4.2e-11
WP_046291442.1|1840760_1841168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046291443.1|1841312_1842752_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.9	6.1e-17
WP_046291444.1|1842808_1843297_-	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	43.8	1.3e-27
WP_046291445.1|1843293_1844088_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	68.6	3.4e-110
WP_052653060.1|1844147_1845245_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.8e-24
>prophage 5
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	2094830	2103154	5630311		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_046293611.1|2094830_2095643_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	5.1e-29
WP_046291596.1|2095817_2096636_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_046291597.1|2096737_2097499_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.0	3.1e-68
WP_046291598.1|2097495_2098683_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.6	7.0e-35
WP_084010027.1|2098768_2099554_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	36.4	2.6e-09
WP_046291600.1|2099571_2100669_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.5	4.7e-33
WP_039399083.1|2100776_2101553_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_084010028.1|2101672_2103154_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	25.3	1.6e-23
>prophage 6
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	2108776	2165425	5630311	tRNA,transposase,protease	Powai_lake_megavirus(12.5%)	47	NA	NA
WP_046291602.1|2108776_2110153_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_046291603.1|2110185_2110815_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_046293613.1|2110919_2112107_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_046291604.1|2112186_2113524_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_010807283.1|2113650_2113887_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_046291605.1|2113984_2115154_+	GTPase HflX	NA	NA	NA	NA	NA
WP_169834995.1|2115374_2116730_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_046291607.1|2116742_2117642_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_052653116.1|2117713_2117905_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_046291609.1|2117943_2119104_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_046291610.1|2119177_2120518_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	36.4	5.6e-73
WP_046291611.1|2120544_2121081_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_157122678.1|2121151_2122006_+	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_046291613.1|2122071_2124150_-	M3 family metallopeptidase	NA	A0A1V0SID3	Klosneuvirus	26.6	4.7e-50
WP_046291614.1|2124503_2125355_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.6	5.0e-35
WP_046291615.1|2125711_2126359_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_052653118.1|2126355_2128764_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_046291617.1|2129181_2131869_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_046291618.1|2131966_2133649_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_046291619.1|2133727_2134309_+	MFS transporter	NA	NA	NA	NA	NA
WP_046291620.1|2134329_2136126_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.9	1.0e-32
WP_046291621.1|2136396_2136957_-	phasin family protein	NA	NA	NA	NA	NA
WP_046291622.1|2137461_2138403_+	histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	30.3	8.9e-17
WP_084009693.1|2138399_2139446_+	DMT family transporter	NA	NA	NA	NA	NA
WP_046293614.1|2139636_2140320_+	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	33.9	1.3e-28
WP_046291624.1|2140508_2141777_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_046291625.1|2141923_2142751_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157122679.1|2143034_2143949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046290551.1|2144892_2146143_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.7	1.2e-40
WP_046291628.1|2146632_2147193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046291629.1|2147294_2148020_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_046291630.1|2148105_2149515_+	lactate utilization protein	NA	NA	NA	NA	NA
WP_039399031.1|2149624_2150284_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_046291631.1|2150403_2151201_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046291632.1|2151252_2152281_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_046291633.1|2152444_2153233_-	arginyltransferase	NA	NA	NA	NA	NA
WP_046291634.1|2153229_2153994_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_052653120.1|2154071_2154704_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_046291635.1|2155131_2155587_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046293617.1|2155614_2155845_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_046291636.1|2155881_2156802_-	DMT family transporter	NA	NA	NA	NA	NA
WP_052653613.1|2156899_2157670_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046291637.1|2157875_2158760_-	EamA family transporter	NA	NA	NA	NA	NA
WP_046291638.1|2159050_2159272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046290953.1|2159776_2161042_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	7.6e-104
WP_046290016.1|2161908_2162892_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_046289963.1|2164339_2165425_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	2791569	2816933	5630311	plate,tail,transposase	Ralstonia_virus(50.0%)	18	NA	NA
WP_046292000.1|2791569_2795415_-|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_046292001.1|2795475_2795919_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_046292002.1|2795934_2796237_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_046292003.1|2796280_2798071_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_046292004.1|2798075_2798759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046292005.1|2798762_2798957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052653264.1|2798988_2799453_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_046292006.1|2799605_2800064_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_046292007.1|2800197_2801952_-|tail	phage tail sheath family protein	tail	A0A142EZL9	Stenotrophomonas_phage	27.2	1.4e-07
WP_046292008.1|2801974_2802907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046292009.1|2802921_2803497_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_046289972.1|2803835_2805056_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.6	2.4e-195
WP_084009753.1|2805142_2806879_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.1	1.3e-13
WP_157122707.1|2807043_2810310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084009754.1|2810670_2813355_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_046292011.1|2813573_2814596_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046292012.1|2814620_2815562_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_046289972.1|2815712_2816933_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.6	2.4e-195
>prophage 8
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	3355597	3415914	5630311	tRNA,transposase,holin	Stx2-converting_phage(23.08%)	57	NA	NA
WP_046292340.1|3355597_3356473_-|holin	phosphatidylcholine/phosphatidylserine synthase	holin	NA	NA	NA	NA
WP_039397633.1|3356694_3357330_-	phosphatidylserine decarboxylase	NA	A0A1V0SDU9	Indivirus	31.9	1.4e-13
WP_039397631.1|3357539_3358556_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_039397629.1|3358633_3359125_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_046292341.1|3359215_3360985_-	acetolactate synthase 3 catalytic subunit	NA	NA	NA	NA	NA
WP_046292342.1|3361432_3362005_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_046292343.1|3362001_3362430_+	DUF3619 family protein	NA	NA	NA	NA	NA
WP_046292344.1|3362452_3363304_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_084009808.1|3363505_3364117_+	RDD family protein	NA	NA	NA	NA	NA
WP_052653397.1|3364315_3365071_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_046292345.1|3365197_3366196_+	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	46.0	3.2e-65
WP_046292346.1|3366324_3367359_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_046292347.1|3367401_3367836_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_046292348.1|3367977_3368646_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046292349.1|3368649_3369246_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_169835013.1|3369556_3370117_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_046292350.1|3370148_3370769_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	35.1	2.2e-19
WP_046292351.1|3370815_3371547_-|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_157122740.1|3371750_3372332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046292354.1|3372734_3373217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084009809.1|3373243_3373699_-	group II truncated hemoglobin	NA	NA	NA	NA	NA
WP_046292355.1|3373800_3376314_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_084010046.1|3376336_3376975_-	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
WP_039397603.1|3377262_3377580_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_046292356.1|3377753_3378464_-	two-component system response regulator KdpE	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.0e-05
WP_046293838.1|3378456_3381285_-	sensor histidine kinase KdpD	NA	A0A1V0SGX0	Hokovirus	23.9	2.4e-09
WP_046292357.1|3381477_3382062_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_046292358.1|3382141_3384232_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	25.7	6.6e-28
WP_046292359.1|3384296_3386102_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_063389843.1|3386098_3386191_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_052653664.1|3386549_3387422_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_157122741.1|3387616_3388189_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_157122742.1|3388201_3388624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052653405.1|3389462_3389858_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_046293841.1|3389910_3390762_-	thioredoxin	NA	NA	NA	NA	NA
WP_052653407.1|3390875_3393338_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_046293842.1|3393447_3394347_-	pirin family protein	NA	NA	NA	NA	NA
WP_046292361.1|3394564_3395125_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_046292362.1|3395199_3397611_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	31.8	2.6e-12
WP_039397582.1|3397671_3397878_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_046292363.1|3397968_3398646_-	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	28.8	1.3e-09
WP_046292364.1|3398651_3399581_-	YicC family protein	NA	NA	NA	NA	NA
WP_046292365.1|3399793_3400522_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_046292366.1|3400524_3401142_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_046292367.1|3401147_3402368_+	oxygen-independent coproporphyrinogen III oxidase-like protein	NA	NA	NA	NA	NA
WP_046293843.1|3402543_3404166_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.8	2.0e-69
WP_046292368.1|3405000_3405504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046292369.1|3405743_3406340_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_046292370.1|3406351_3407896_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	48.3	1.2e-135
WP_046292371.1|3407947_3408106_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_157122635.1|3408147_3409235_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_084009810.1|3409273_3409492_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	1.9e-18
WP_052652849.1|3409488_3409923_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	31.6	1.1e-06
WP_084009811.1|3410016_3410865_-	caspase family protein	NA	NA	NA	NA	NA
WP_046292373.1|3411780_3413046_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	2.9e-103
WP_046292375.1|3413763_3414135_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_046289963.1|3414828_3415914_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	3573603	3731687	5630311	tRNA,integrase,transposase,protease	Bacillus_phage(14.81%)	120	3641635:3641694	3733011:3734354
WP_052653453.1|3573603_3575433_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_046292454.1|3575536_3576208_+	DUF1345 domain-containing protein	NA	NA	NA	NA	NA
WP_046292455.1|3576466_3577855_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_046292456.1|3577845_3578844_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052653456.1|3578827_3579037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046292457.1|3579098_3579653_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_046292458.1|3579773_3580340_-	GTP cyclohydrolase I FolE	NA	A0A172Q012	Pseudomonas_phage	61.7	1.3e-60
WP_046292459.1|3580713_3581658_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046292460.1|3581830_3582250_+	VOC family protein	NA	NA	NA	NA	NA
WP_046292461.1|3582369_3583074_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_046292462.1|3583737_3585240_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_046292463.1|3585333_3586884_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_046293880.1|3587090_3587885_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	26.5	5.2e-18
WP_046292464.1|3588046_3588550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046292465.1|3589050_3590202_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.1	4.4e-26
WP_046292466.1|3590368_3591826_-	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_046292467.1|3591875_3593072_-	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_046292468.1|3593083_3595684_-	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_046292469.1|3595712_3596864_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_046293881.1|3596891_3597770_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_157122752.1|3598071_3598212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046293882.1|3598180_3600196_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_157122753.1|3600228_3600390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046292470.1|3600530_3601751_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.9	1.1e-195
WP_046292471.1|3601857_3602658_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046293885.1|3604272_3605220_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_046292472.1|3605448_3606276_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_046292473.1|3606364_3607321_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046292474.1|3607594_3608941_+	MFS transporter	NA	NA	NA	NA	NA
WP_046292475.1|3608937_3609726_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_046292476.1|3609779_3611525_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_046292477.1|3611521_3612412_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_084010050.1|3612502_3614152_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_157122755.1|3614302_3615187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084009824.1|3615446_3616349_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157122910.1|3616656_3618948_+	cytochrome P450	NA	NA	NA	NA	NA
WP_046292481.1|3618999_3620214_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_046292482.1|3620399_3621767_-	MFS transporter	NA	NA	NA	NA	NA
WP_046292483.1|3622345_3623044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046292484.1|3623178_3623493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084009825.1|3623670_3625266_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_046292486.1|3625482_3625800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046292487.1|3625801_3626704_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046292488.1|3626908_3628405_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_046292489.1|3628646_3630242_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.9	3.5e-13
WP_046292490.1|3630473_3630830_-	GFA family protein	NA	NA	NA	NA	NA
WP_046292491.1|3631040_3632921_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.0	5.0e-11
WP_157122756.1|3633225_3634584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046292493.1|3635215_3636118_+	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_046292494.1|3636241_3637258_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046292495.1|3637341_3637821_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_046292496.1|3637951_3638842_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_046292497.1|3639021_3639777_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_046292498.1|3640000_3640198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157122757.1|3640602_3641647_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
3641635:3641694	attL	GGGCCTGTCATTAATTTCGTGTTTGAGGCATAACATGTCGCCAAGGAGTGACTATGCCTC	NA	NA	NA	NA
WP_046290551.1|3641687_3642938_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.7	1.2e-40
WP_084010051.1|3644202_3644577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046290551.1|3644921_3646172_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.7	1.2e-40
WP_046292502.1|3647810_3648302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046292470.1|3648557_3649778_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.9	1.1e-195
WP_157122635.1|3650621_3651709_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157122758.1|3652046_3652325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169835059.1|3652363_3653200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046292506.1|3653277_3653490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157122759.1|3653988_3655226_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	88.7	1.2e-146
WP_052653462.1|3658006_3658495_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_046289972.1|3659143_3660364_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.6	2.4e-195
WP_046290953.1|3660545_3661811_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	7.6e-104
WP_046293183.1|3664704_3665727_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_046290067.1|3666098_3667364_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	49.9	2.9e-103
WP_157122911.1|3667499_3668709_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	2.0e-98
WP_044453167.1|3668834_3669656_-	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	30.1	1.0e-08
WP_044458677.1|3669652_3671146_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_084009826.1|3672685_3675085_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	31.2	1.9e-34
WP_157122760.1|3675068_3675383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046292514.1|3675403_3677287_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.8	3.2e-66
WP_046292515.1|3677356_3677803_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.3	5.7e-22
WP_046293889.1|3678273_3679530_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046292516.1|3679620_3680652_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	1.9e-92
WP_046292517.1|3680764_3681574_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_046292518.1|3681773_3683690_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_046292519.1|3683938_3684835_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_046292520.1|3684956_3685229_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_046292521.1|3685457_3686573_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_046292522.1|3686853_3687708_+	DMT family transporter	NA	NA	NA	NA	NA
WP_046292523.1|3687750_3688635_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_084009827.1|3688705_3689632_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_046292524.1|3689756_3690632_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_046293891.1|3690809_3692174_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046292525.1|3692380_3695119_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.0	9.4e-75
WP_046292526.1|3695119_3695854_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	36.1	3.1e-25
WP_046292527.1|3695960_3697193_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_157122762.1|3697551_3697920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046292528.1|3698063_3699035_+	homoserine kinase	NA	NA	NA	NA	NA
WP_046292529.1|3699066_3699879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046292530.1|3699951_3702270_-	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	31.1	9.4e-76
WP_046292531.1|3702380_3705242_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	40.2	1.2e-144
WP_046292532.1|3705271_3706159_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.7	9.2e-72
WP_039402727.1|3706278_3706506_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_046292533.1|3706634_3707165_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_052653673.1|3707417_3708725_+	chloride channel protein	NA	NA	NA	NA	NA
WP_046293894.1|3708751_3709816_-	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_046292534.1|3709967_3710162_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_046292535.1|3710276_3711047_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_046292536.1|3711104_3712358_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_046292537.1|3712576_3715201_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	1.4e-80
WP_046292538.1|3715509_3716733_+	CoA transferase	NA	NA	NA	NA	NA
WP_084010052.1|3718173_3718428_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_046292539.1|3718424_3718760_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_052653466.1|3718982_3719684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046293183.1|3720124_3721147_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_044453167.1|3721473_3722295_-	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	30.1	1.0e-08
WP_044458677.1|3722291_3723785_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_046289963.1|3724293_3725379_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_052652582.1|3726709_3727213_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084009760.1|3727209_3727884_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046289963.1|3728122_3729208_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_169835004.1|3729251_3729680_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046290016.1|3729904_3730888_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_084010053.1|3731171_3731687_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	47.7	2.0e-34
3733011:3734354	attR	GGGCCTGTCATTAATTTCGTGTTTGAGGCATAACATGTCGCCAAGGAGTGACTATGCCTCGCAAACCGAAGACCCCGCCGGTAGAGCTACCGGCAATTCCCGCTGAATTGCTTGAACAATTCGGTAACGGCCCGATGACGGCCGAAGCCATCCACGCCGCGACGCTTGCGCTCAAGAAGGCGCTCATAGAACGCGCGCTGGGGGGCGAGCTCAATCACCATCTCGGCTACGCGCCTGGCGCGGCCAAACCGGCCAGCGTGACCAATCAGCGCAATGGCAAAGGCGCCAAGACGGTTCTGACTGAAGGCGGCCCGATTCGCATCGGGGTGCCCCGCGACCGTGATGGCAGCTTCGAACCACTGTTGATCCCCAAACACGAACGACGCTTTACAGGCTTCGACGACAAGATAGTCGCCATGTACGCCCGGGGTATGACCGTGCGCGAGATTCAGGGCTTTGTTCTGGAGCAGTACGGCACCGAGGTCTCGCCCGAGTTCATCAGCTCAGTCACTGACGAAGTGATGGCTGAAGTCACGGCGTGGCAGGCTCGGCCACTTGAGCCGATGTATCCGGTCGTGTTCTTCGACGCGCTGCGCGTGAAGATCCGCGAGGATGCCGTCGTGCGTAACAAGGCCATTTATCTCGCGCTGGGCATTCTGCCCGACGGCACGCGCGACATCCTGGGCCTGTGGATCGAGAACACCGAGGGGGCCAAGTTCTGGATGAAAGTGTTCAACGATCTGAAAACGCGCGGCGTGGGCGACATCCTGATTGCTGTGACTGACGGCCTCAAAGGCATGCCCGAGGCGTTAGCCGCGGTGTTTCCAGCGACGACGTTGCAAACGTGCATCGTCCACCTGATCCGCAACAGTTTGGATTACGCGAGCTGGAAGGATCGTAAGGGGCTGGCCGCCGCAATCAAGCCGATCTATACGGCACCAAGCGCCGAGGCGGCTCTGGCCGAATTGGACGCATTTTCCCAAGGGCCGTGGGGCCAGAAATTCCCGCCGGTCAGTGCCGCGTGGCGCAATGCCTGGGATCGTGTCATTCCGTTCTTCGCGTTCCCGCCCGCTGTGCGCCGGGTGATCTACACAACGAACGCTATTGAGAACATCAACTCGCAGCTTCGCAAGATCATCAAGACCCGAGGCCATTTCCCAACCGATGATGCGGCAACAAAGCTGATCTGGCTGGCGCTGCGTAACATCACCGCAGATTGGGGCCGCGCCGCTCAAGATTGGAAGACAGCTATGAACCAATTCGCTATCCTTTACGAGGATCGTTTCGTCCGGCCATCCGTGTAAACCTCAACCCCGCCTTGAACACGGAATTTCTGACACCCCC	NA	NA	NA	NA
>prophage 10
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	4225945	4236398	5630311	tail,transposase	Synechococcus_phage(33.33%)	11	NA	NA
WP_046292830.1|4225945_4226491_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_046292831.1|4226500_4227034_+|tail	phage tail protein	tail	F5B3N6	Synechococcus_phage	55.6	1.3e-09
WP_046292832.1|4227054_4227573_+|tail	phage tail protein	tail	A0A2R3ZZT3	Microbacterium_phage	37.9	4.9e-17
WP_046292833.1|4227717_4228128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046292834.1|4228353_4228695_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_046292835.1|4228783_4229065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084009864.1|4229036_4229564_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_084009865.1|4229610_4229784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046289961.1|4229838_4230822_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_046289963.1|4233956_4235042_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_046291943.1|4235132_4236398_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	9.9e-104
>prophage 11
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	4308673	4318171	5630311		Enterobacteria_phage(33.33%)	8	NA	NA
WP_046292888.1|4308673_4309711_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.8	7.8e-06
WP_046292889.1|4309811_4311065_+	cation transporter	NA	NA	NA	NA	NA
WP_046292890.1|4311190_4311739_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.1	2.2e-47
WP_046292891.1|4311780_4312668_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.3	1.6e-100
WP_046292892.1|4312675_4313740_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.1	2.1e-83
WP_046293995.1|4313768_4314353_-	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_046292893.1|4314450_4316199_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	29.4	4.5e-54
WP_046292894.1|4316362_4318171_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	35.5	1.6e-75
>prophage 12
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	5099751	5126425	5630311	plate,transposase	Cronobacter_phage(50.0%)	18	NA	NA
WP_046289955.1|5099751_5100171_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_046289956.1|5100167_5102930_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.4	6.8e-89
WP_046289957.1|5103031_5103529_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_052653519.1|5103617_5105276_-	OmpA family protein	NA	NA	NA	NA	NA
WP_084010087.1|5105302_5106004_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_046289959.1|5106090_5107443_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_157122819.1|5107476_5107848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046289960.1|5107859_5108372_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_046289961.1|5108641_5109625_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_046289963.1|5111072_5112158_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_052652696.1|5112631_5114647_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_046289966.1|5116343_5116631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084009935.1|5116633_5116891_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_046289967.1|5116894_5118160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157122856.1|5118294_5119505_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	2.0e-98
WP_084009936.1|5119515_5122998_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_046289968.1|5122997_5124596_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_046289969.1|5124607_5126425_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 13
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	5273963	5284875	5630311	transposase	Stx2-converting_phage(60.0%)	8	NA	NA
WP_046289963.1|5273963_5275049_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_044458677.1|5276665_5278159_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_044453167.1|5278155_5278977_+	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	30.1	1.0e-08
WP_046293183.1|5279303_5280326_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157122825.1|5281061_5281391_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.6	8.5e-07
WP_046290067.1|5281397_5282663_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	49.9	2.9e-103
WP_046290068.1|5282931_5283279_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.4	4.1e-36
WP_046290069.1|5283330_5284875_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	48.5	8.3e-137
>prophage 14
NZ_CP011253	Pandoraea oxalativorans strain DSM 23570 chromosome, complete genome	5630311	5535160	5589386	5630311	tRNA,transposase,holin	Burkholderia_virus(22.22%)	36	NA	NA
WP_046290217.1|5535160_5537152_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_046290218.1|5538806_5539553_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.9	1.1e-09
WP_052652778.1|5539552_5541349_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A1M7XV31	Cedratvirus	28.8	2.7e-14
WP_039394135.1|5541367_5542423_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_039394138.1|5542624_5543122_-	homoprotocatechuate degradation operon regulator HpaR	NA	NA	NA	NA	NA
WP_039394141.1|5543379_5544525_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046290219.1|5544685_5545468_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_046290220.1|5546050_5547049_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_046290221.1|5547060_5547945_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_046293226.1|5548041_5549235_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039394148.1|5549311_5550085_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_046290222.1|5550093_5550873_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.2e-12
WP_046293227.1|5551529_5552306_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_084009966.1|5552312_5553530_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_046290224.1|5553526_5554366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046290225.1|5554412_5556062_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	7.4e-59
WP_046290226.1|5556197_5557706_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_046290227.1|5557877_5558753_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046290228.1|5559004_5560381_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_046290229.1|5560418_5561315_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	48.8	3.4e-82
WP_046290230.1|5561552_5562842_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	56.2	3.1e-129
WP_157122839.1|5564328_5565519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046290233.1|5565999_5567040_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_046289972.1|5567945_5569166_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.6	2.4e-195
WP_084009967.1|5569181_5569766_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_157122635.1|5569804_5570891_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_084009968.1|5570938_5572186_+	hypothetical protein	NA	Q58MH7	Prochlorococcus_phage	33.6	6.9e-25
WP_046290236.1|5572210_5572999_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	36.6	6.7e-34
WP_084009969.1|5574822_5575608_+	MFS transporter	NA	NA	NA	NA	NA
WP_046289961.1|5575510_5576494_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_046289963.1|5577941_5579027_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157122840.1|5579421_5579946_+	MFS transporter	NA	NA	NA	NA	NA
WP_046293231.1|5580100_5583706_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_039394177.1|5583946_5584408_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_084010094.1|5584744_5587168_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_046290016.1|5588402_5589386_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP011518	Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence	633357	6963	92397	633357	integrase,protease,transposase	Stx2-converting_phage(28.57%)	55	33035:33052	95610:95627
WP_052654276.1|6963_7536_+|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	44.2	3.9e-31
WP_084010097.1|7498_7978_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	47.4	7.7e-25
WP_052654280.1|8313_8514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169835072.1|8633_8783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654283.1|12061_12382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157122930.1|13000_14881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654286.1|15502_17479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157122931.1|18263_18959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157123118.1|19848_20280_-	VirK protein	NA	NA	NA	NA	NA
WP_052654290.1|20775_21165_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_169835073.1|21336_24768_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_052654292.1|25256_26021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157122932.1|26311_26545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654297.1|27393_27909_-	VUT family protein	NA	A0A2H4N7D9	Pectobacterium_phage	49.3	8.6e-30
WP_052654299.1|28287_28665_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_084010152.1|28681_29755_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
33035:33052	attL	GCACGGTCGGCGCCATGG	NA	NA	NA	NA
WP_084010099.1|34988_35663_+	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_065225861.1|35844_37890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654309.1|38358_40263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157122933.1|41231_42596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654313.1|42933_45255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157122937.1|45962_46112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654315.1|46247_46841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654317.1|47863_48514_+	ParA family protein	NA	K7R2R7	Vibrio_phage	33.0	2.3e-19
WP_052654319.1|48525_49557_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_169835074.1|49594_50542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084010153.1|53676_54846_-|protease	aspartyl protease family protein	protease	NA	NA	NA	NA
WP_157122939.1|55005_55626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654325.1|56139_58371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654327.1|58367_58910_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_052654331.1|59950_60307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157122941.1|61766_62678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169835075.1|63811_63916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654338.1|64400_65153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157123122.1|65313_65415_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157122942.1|65415_65928_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	40.4	2.7e-28
WP_052654340.1|66840_68994_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157122947.1|69813_71664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157122949.1|73048_73210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654347.1|73634_73952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654349.1|74035_75118_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	32.7	2.4e-37
WP_052654631.1|75541_76480_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_169835076.1|76539_78372_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_084010104.1|78766_79063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654352.1|80178_80964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157122953.1|82279_82612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654356.1|82884_83832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654358.1|84127_84424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157122955.1|84478_84625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169835077.1|84767_84974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654364.1|85857_86484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654366.1|86937_87960_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_052654368.1|89869_90139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654632.1|90569_91079_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_046292470.1|91176_92397_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.9	1.1e-195
95610:95627	attR	CCATGGCGCCGACCGTGC	NA	NA	NA	NA
>prophage 2
NZ_CP011518	Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence	633357	100736	203709	633357	integrase,protease,transposase	Enterobacteria_phage(25.0%)	53	88385:88401	105026:105042
88385:88401	attL	CGGGGTCGGCCGCCTCG	NA	NA	NA	NA
WP_084010106.1|100736_101180_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046289963.1|101208_102294_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_084010107.1|102532_103207_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_052653696.1|103203_103704_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_084010108.1|103795_103972_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_052654374.1|104879_106880_-	metallophosphoesterase	NA	NA	NA	NA	NA
105026:105042	attR	CGGGGTCGGCCGCCTCG	NA	NA	NA	NA
WP_157122961.1|107325_107661_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_157123124.1|108255_108564_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157122963.1|108560_108731_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_157122967.1|109474_110416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654382.1|111644_112241_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	33.9	1.5e-25
WP_046289972.1|112486_113707_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.6	2.4e-195
WP_157122969.1|115226_115562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157122971.1|116377_116749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654392.1|118193_119051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654394.1|120046_120253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654396.1|121157_122372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654398.1|123926_125864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084010110.1|126603_127137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654406.1|129806_130427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157122973.1|130432_131635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654410.1|131594_132803_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.7	1.1e-40
WP_157122856.1|132872_134083_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	2.0e-98
WP_084010154.1|134581_134761_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169835078.1|135527_136838_-	MFS transporter	NA	NA	NA	NA	NA
WP_157122977.1|138226_140209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157122979.1|141048_143289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654424.1|143746_145387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157122981.1|146211_146496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157122983.1|147651_150381_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_052654434.1|151467_152919_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052654436.1|153065_155957_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	35.4	1.1e-20
WP_052654438.1|156201_157023_+	FkbM family methyltransferase	NA	C7U048	Ostreococcus_tauri_virus	29.1	1.2e-09
WP_052654439.1|157402_157630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084010155.1|157856_158690_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_169835079.1|159704_164711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169835080.1|165185_166916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654444.1|168084_169920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084010113.1|171771_172128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654448.1|172741_174241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654450.1|176276_177131_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_052654452.1|179191_180118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654460.1|183861_184857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157122989.1|186035_187202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654467.1|188952_190446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654469.1|190442_190970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157122991.1|192802_194407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654475.1|196030_197068_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_052654477.1|197567_199226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157122993.1|199739_199901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084010116.1|200359_201715_-	purine permease	NA	Q9KX94	Enterobacteria_phage	27.8	3.6e-19
WP_052654481.1|202169_202676_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_052654483.1|203376_203709_+|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	51.0	2.4e-17
>prophage 3
NZ_CP011518	Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence	633357	217656	294245	633357	transposase,integrase	Bacillus_virus(14.29%)	56	271604:271620	298002:298018
WP_169835081.1|217656_218655_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_052654500.1|218716_219604_-	FliM/FliN family flagellar motor switch protein	NA	NA	NA	NA	NA
WP_052654503.1|219593_220196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654505.1|221033_221315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157122999.1|221673_222816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157123000.1|224674_225847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157123001.1|226660_228628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157123003.1|229560_231600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654514.1|231792_235179_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	28.3	4.2e-16
WP_052654517.1|235347_235728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654519.1|235721_237047_-	FliI/YscN family ATPase	NA	NA	NA	NA	NA
WP_052654521.1|237033_239085_-	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_052654523.1|239071_239449_-	type III secretion protein	NA	NA	NA	NA	NA
WP_052654525.1|239850_240495_+	type III secretion system export apparatus subunit SctR	NA	NA	NA	NA	NA
WP_052654527.1|240505_240775_+	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_052654530.1|240776_241556_+	type III secretion system export apparatus subunit SctT	NA	NA	NA	NA	NA
WP_065225874.1|241552_242869_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_052654532.1|242846_243836_+	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	41.5	8.2e-21
WP_052654534.1|243844_246646_+	two component system sensor kinase	NA	A0A1V0SGX0	Hokovirus	34.8	2.2e-23
WP_052654536.1|246795_247446_-	two component system response regulator	NA	NA	NA	NA	NA
WP_065225875.1|248430_249492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654537.1|249484_250642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654635.1|250638_251193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654538.1|251189_251897_-	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_052654540.1|251893_252217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654541.1|252213_252507_-	EscG/YscG/SsaH family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_157123005.1|252523_253459_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065225877.1|253570_253795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654544.1|253814_254993_-	type III secretion system inner membrane ring subunit SctD	NA	NA	NA	NA	NA
WP_052654546.1|254999_256469_-	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	R9TEZ5	Vibrio_phage	24.9	5.9e-15
WP_052654548.1|256465_256867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654554.1|257667_259065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654556.1|260219_261389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157123006.1|262476_262629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157123008.1|264419_264707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654563.1|265480_266128_+	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	43.3	2.6e-47
WP_084010156.1|267564_267942_-|transposase	transposase	transposase	A4PE56	Ralstonia_virus	63.8	2.7e-17
WP_169835082.1|268844_269045_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_052654567.1|269170_269428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157123010.1|270415_270916_+	hypothetical protein	NA	NA	NA	NA	NA
271604:271620	attL	GCGTTTGCCGGTTACGC	NA	NA	NA	NA
WP_157123012.1|272557_274498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044454374.1|274626_275733_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065225879.1|276434_276764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157123014.1|277029_278355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157123016.1|278903_279068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654583.1|279876_281895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654585.1|282316_283633_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_084010157.1|283640_284006_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169835083.1|284279_284546_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_052654587.1|285122_285575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084010120.1|287002_287263_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_052654589.1|288060_289251_-	MFS transporter	NA	NA	NA	NA	NA
WP_084010158.1|290391_290631_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_052654592.1|290630_291041_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_046290067.1|291555_292821_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	49.9	2.9e-103
WP_046291684.1|293210_294245_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
298002:298018	attR	GCGTAACCGGCAAACGC	NA	NA	NA	NA
>prophage 4
NZ_CP011518	Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence	633357	299741	376304	633357	transposase	Stx2-converting_phage(31.82%)	55	NA	NA
WP_169835084.1|299741_300185_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	33.1	9.4e-09
WP_046289885.1|300181_300529_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	62.9	1.3e-34
WP_046290236.1|301739_302528_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.8	2.0e-33
WP_046290068.1|306229_306577_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.4	4.1e-36
WP_052652849.1|306573_307008_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	43.0	3.3e-14
WP_046289963.1|307572_308658_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_169835004.1|310121_310550_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_046289963.1|310593_311679_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_084009760.1|311917_312592_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052652582.1|312588_313092_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157122856.1|313400_314611_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	2.0e-98
WP_044454374.1|315250_316357_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_052653689.1|316883_317132_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_052653693.1|317986_318865_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_157123022.1|318888_319050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084010122.1|319119_320055_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	29.4	2.9e-07
WP_052653696.1|320193_320694_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157122635.1|320827_321915_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.0	2.1e-46
WP_052653699.1|323718_324003_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	55.9	3.0e-24
WP_052654598.1|323999_324383_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_052653702.1|324715_325399_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_052653705.1|325481_326075_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_052653708.1|326096_326300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052653711.1|326369_326711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157123024.1|328855_330280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653723.1|331962_332151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653726.1|333113_333440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157123026.1|335046_336012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157123126.1|336680_337890_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.4	3.9e-97
WP_052653743.1|338326_339031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654599.1|339079_339433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653746.1|340008_340476_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_084010123.1|340472_340970_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_084010124.1|341060_343460_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.3	1.1e-15
WP_052653749.1|343749_344769_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_052653752.1|344977_345802_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	36.3	3.9e-40
WP_052653755.1|346562_347558_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_052653758.1|348058_348382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157123028.1|350876_352046_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.3	5.7e-37
WP_052653770.1|352339_352570_+|transposase	transposase	transposase	Q6J1X2	Lactobacillus_phage	43.1	2.2e-06
WP_052653776.1|353390_354284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084010127.1|354914_355574_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	61.5	1.1e-10
WP_157123031.1|355721_355871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052653779.1|357000_357264_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_046289972.1|358003_359224_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.6	2.4e-195
WP_157123033.1|360738_361826_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.6	1.4e-45
WP_046290953.1|362668_363934_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	7.6e-104
WP_052653788.1|365382_365679_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084010128.1|365675_366104_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_052653791.1|366618_367104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046290953.1|367702_368968_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	7.6e-104
WP_052653796.1|370802_371192_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	39.1	5.0e-14
WP_052653799.1|371188_371536_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	61.9	2.3e-34
WP_052653802.1|372638_373205_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	43.1	1.0e-28
WP_052653805.1|373340_376304_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP011518	Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence	633357	404422	478744	633357	holin,transposase	Stx2-converting_phage(50.0%)	48	NA	NA
WP_157122635.1|404422_405509_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.0	2.1e-46
WP_046290551.1|405647_406898_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.7	1.2e-40
WP_169835086.1|408221_408479_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_046290070.1|408526_409123_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	37.7	1.4e-20
WP_046290069.1|409134_410679_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	48.5	8.3e-137
WP_046290068.1|410730_411078_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.4	4.1e-36
WP_052652849.1|411074_411509_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	43.0	3.3e-14
WP_157123044.1|411556_412922_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.9	5.0e-77
WP_157123046.1|413256_414606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653856.1|415464_416775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046289963.1|417620_418706_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_084009760.1|418944_419619_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052652582.1|419615_420119_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052653865.1|421656_422103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157123050.1|422526_424752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052653871.1|425028_426615_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	53.2	7.2e-144
WP_052653874.1|426671_427019_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	62.9	5.9e-35
WP_169835070.1|427003_427309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157123052.1|427246_427417_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	60.7	8.5e-11
WP_052653877.1|427755_429459_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_052653880.1|429467_429773_-	urease subunit beta	NA	NA	NA	NA	NA
WP_052653883.1|429790_430093_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_052654607.1|430114_430939_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_084010134.1|431150_431723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653889.1|431769_432387_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_157123055.1|432376_433348_+	cobaltochelatase subunit CobS	NA	NA	NA	NA	NA
WP_052653895.1|433357_435214_+	cobalt chelatase	NA	A0A2H4P735	Pseudomonas_phage	24.8	4.1e-13
WP_157123057.1|435691_437572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052653904.1|439020_439950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169835087.1|440716_442657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653910.1|443261_448613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157123061.1|450142_455605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046289972.1|457357_458578_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.6	2.4e-195
WP_052653919.1|458574_459204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084010135.1|459279_460815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653925.1|462706_463747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653928.1|464261_466112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653931.1|466901_467138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653934.1|467648_468533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052653937.1|468820_469033_-	CsbD family protein	NA	NA	NA	NA	NA
WP_052654609.1|470210_470486_+	DUF883 family protein	NA	NA	NA	NA	NA
WP_052653940.1|470580_470961_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_052653943.1|471070_471508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653946.1|472616_473015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653949.1|473039_473627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169835088.1|473954_474659_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.1	5.6e-24
WP_052653954.1|476481_478107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084010136.1|478462_478744_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	45.2	8.6e-08
>prophage 6
NZ_CP011518	Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence	633357	487944	530302	633357	transposase	Pseudomonas_phage(25.0%)	35	NA	NA
WP_084009614.1|487944_489006_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_052653975.1|489196_489646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157123067.1|490168_490324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157123069.1|490444_490594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046289972.1|491210_492431_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.6	2.4e-195
WP_157123071.1|494598_496917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052653987.1|497145_498630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169835089.1|499519_499696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169835090.1|500252_501374_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_084010138.1|501486_502221_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_052654006.1|502417_502657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084010139.1|503259_503724_+	DUF932 domain-containing protein	NA	NA	NA	NA	NA
WP_052654012.1|503793_504036_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	45.7	2.1e-07
WP_084010140.1|503995_504142_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_157122856.1|504156_505367_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	2.0e-98
WP_084010141.1|506457_507138_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	36.1	3.2e-24
WP_084009614.1|507071_508133_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_046290067.1|509235_510501_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	49.9	2.9e-103
WP_046293183.1|511311_512334_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_044453167.1|512660_513482_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.0	4.7e-30
WP_044458677.1|513478_514972_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_052654613.1|515214_515724_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_169835091.1|515786_516614_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_052654018.1|516619_517789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084010143.1|518182_518569_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_052654024.1|518807_519095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654027.1|519208_519835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157123073.1|519961_520159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654033.1|520595_522407_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.8	6.3e-27
WP_157123075.1|522744_522903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654036.1|523020_523362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654038.1|523466_523757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654041.1|524022_524262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653755.1|525641_526637_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157122856.1|529091_530302_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	2.0e-98
>prophage 1
NZ_CP011519	Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-2, complete sequence	126976	0	68494	126976	transposase	Escherichia_phage(43.75%)	56	NA	NA
WP_157122856.1|888_2098_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	2.0e-98
WP_052654617.1|2481_2835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654050.1|2883_3588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654720.1|3584_4004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654721.1|4301_7268_-	conjugative relaxase	NA	NA	NA	NA	NA
WP_052654722.1|7278_8841_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_157123132.1|8887_9490_-	endonuclease	NA	NA	NA	NA	NA
WP_052654724.1|9515_10103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654725.1|10166_11177_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_052654726.1|11163_12186_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_052654727.1|12196_13435_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_052654728.1|13436_14243_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_052654729.1|14305_14980_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_052654730.1|14976_15840_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_052654731.1|15827_16235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654732.1|16227_16443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654733.1|16489_17158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654768.1|17154_19827_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_052654734.1|19849_20149_-	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_052654735.1|20145_20511_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_052654736.1|20681_21524_+	response regulator	NA	NA	NA	NA	NA
WP_052654737.1|21515_22298_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_084010160.1|22290_24060_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.8	9.5e-28
WP_052654739.1|24056_24551_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_084010161.1|24727_25399_-	recombinase family protein	NA	NA	NA	NA	NA
WP_052654740.1|25734_26025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654741.1|26021_26306_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_052654742.1|26444_26714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654743.1|26811_27528_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.4	1.7e-39
WP_169835099.1|28034_29936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654745.1|30313_31039_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	8.9e-41
WP_052654746.1|31486_31987_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052654747.1|32106_32814_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	31.5	6.1e-18
WP_052654748.1|33723_35949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052654647.1|36595_37297_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.1	8.6e-41
WP_065225911.1|38254_41650_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_052654752.1|42527_43220_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.1	1.2e-39
WP_052654753.1|44079_44592_-	DUF2165 domain-containing protein	NA	NA	NA	NA	NA
WP_084010166.1|44998_46348_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.3	2.5e-36
WP_157123134.1|46993_47638_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	32.8	7.0e-21
WP_052654756.1|48145_48427_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_052654757.1|48423_48921_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046290957.1|50724_51741_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.5	1.3e-74
WP_046290956.1|51737_52523_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	58.0	1.4e-79
WP_046289882.1|52612_54151_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.6	6.3e-44
WP_065225913.1|54996_56331_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_052654760.1|56503_57535_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.6	2.3e-18
WP_052654761.1|57531_58524_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.3	7.7e-11
WP_052654762.1|58525_59410_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_052654763.1|59423_60362_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_052654764.1|60373_61987_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_052654638.1|62149_62356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654639.1|63098_63833_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	31.3	5.7e-19
WP_052654641.1|64077_65445_+	amino acid permease	NA	NA	NA	NA	NA
WP_065225914.1|65823_67362_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_052654647.1|67792_68494_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.1	8.6e-41
>prophage 2
NZ_CP011519	Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-2, complete sequence	126976	73086	95738	126976	transposase	Mycobacterium_phage(20.0%)	14	NA	NA
WP_046289882.1|73086_74625_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.6	6.3e-44
WP_046290953.1|75596_76862_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	7.6e-104
WP_052654661.1|78055_78403_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	63.8	7.8e-35
WP_084010168.1|78399_78858_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	32.9	1.7e-08
WP_065225916.1|79049_80714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654668.1|80995_82321_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.5	4.7e-56
WP_084010169.1|83275_84598_+	serine hydrolase	NA	G1DB24	Mycobacterium_phage	35.2	3.7e-08
WP_052654767.1|85884_87096_+	AAA family ATPase	NA	A0A240F4U1	Ochrobactrum_phage	30.4	1.0e-28
WP_052654670.1|87092_88127_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_157123139.1|88438_89755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654674.1|90042_90999_-	restriction endonuclease	NA	A0A0P0ZG22	Escherichia_phage	84.5	2.1e-159
WP_052654676.1|90995_92465_-	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	74.4	3.2e-215
WP_169835100.1|93400_95113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052653802.1|95171_95738_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	43.1	1.0e-28
>prophage 3
NZ_CP011519	Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-2, complete sequence	126976	105957	110464	126976	integrase,transposase	Sphingobium_phage(33.33%)	8	100372:100387	112320:112335
100372:100387	attL	TTGATGAATGAGGCCG	NA	NA	NA	NA
WP_052654698.1|105957_106656_+|integrase	site-specific integrase	integrase	A0A1W6DWU1	Sphingobium_phage	31.6	3.1e-14
WP_052654700.1|106735_106990_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_052654702.1|106989_107352_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SAB3	Streptococcus_phage	34.4	7.9e-06
WP_052654704.1|107418_107613_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_052654707.1|107894_108167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654709.1|108234_108438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052654710.1|108450_108870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046290953.1|109198_110464_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	7.6e-104
112320:112335	attR	TTGATGAATGAGGCCG	NA	NA	NA	NA
>prophage 4
NZ_CP011519	Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-2, complete sequence	126976	114321	117154	126976	transposase	Mycobacterium_phage(50.0%)	2	NA	NA
WP_046290953.1|114321_115587_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	7.6e-104
WP_046289972.1|115933_117154_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	81.6	2.4e-195
>prophage 5
NZ_CP011519	Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-2, complete sequence	126976	125681	125885	126976		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_052654047.1|125681_125885_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	6.3e-21
>prophage 1
NZ_CP011520	Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-3, complete sequence	75108	30179	38581	75108	transposase	Mycobacterium_phage(33.33%)	6	NA	NA
WP_157123149.1|30179_31043_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.7	3.8e-22
WP_052654047.1|31403_31607_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	6.3e-21
WP_157122856.1|33141_34351_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	2.0e-98
WP_157122635.1|35261_36349_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.0	2.1e-46
WP_046289886.1|36758_37142_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	34.4	3.4e-07
WP_046290953.1|37315_38581_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	50.1	7.6e-104
