The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011974	Bacillus filamentosus strain Hbe603 chromosome, complete genome	4865574	359676	369510	4865574		Cyanophage(25.0%)	9	NA	NA
WP_040060860.1|359676_360969_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.0	2.9e-18
WP_019395154.1|361039_361759_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SYW1	Cyanophage	43.7	1.2e-45
WP_019395155.1|361751_362003_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A1D7SRI3	Cyanophage	37.0	7.1e-06
WP_019395156.1|361999_362683_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_040060855.1|362666_364895_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	1.3e-159
WP_040060852.1|364870_366283_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.8	2.6e-52
WP_019395159.1|366301_367339_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	44.4	6.5e-69
WP_040060850.1|367335_367920_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.8	6.3e-29
WP_040060848.1|367971_369510_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.7	2.2e-73
>prophage 2
NZ_CP011974	Bacillus filamentosus strain Hbe603 chromosome, complete genome	4865574	1441812	1480687	4865574	protease,tail,integrase	Bacillus_phage(44.0%)	31	1435573:1435594	1477328:1477349
1435573:1435594	attL	CTATAAACGTTGATATAACAGC	NA	NA	NA	NA
WP_046216860.1|1441812_1445637_-	hypothetical protein	NA	A0A0N9RTX0	Staphylococcus_phage	28.2	1.4e-79
WP_046216861.1|1445648_1446416_-|tail	phage tail family protein	tail	A0A1W6JL81	Lactococcus_phage	31.6	3.4e-22
WP_046216862.1|1446476_1454291_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	24.1	1.4e-94
WP_046216863.1|1454458_1456054_-|tail	phage tail tape measure protein	tail	A0A0H3UYV0	Geobacillus_virus	23.6	7.5e-32
WP_046216864.1|1456117_1456732_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	27.7	3.9e-13
WP_046216865.1|1456787_1458332_-	hypothetical protein	NA	A0A1W6JK82	Lactococcus_phage	50.0	1.4e-06
WP_082864700.1|1458522_1458675_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046216866.1|1458791_1459796_-|integrase	site-specific integrase	integrase	A0A0H3V0P2	Geobacillus_virus	69.0	1.6e-128
WP_046216867.1|1459825_1460311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046216868.1|1460303_1460837_-	hypothetical protein	NA	A0A0H3UZC0	Geobacillus_virus	35.8	1.7e-20
WP_046216869.1|1460916_1461669_-	hypothetical protein	NA	A0A0H3UZ43	Geobacillus_virus	56.9	1.3e-71
WP_046216870.1|1461695_1462430_-	hypothetical protein	NA	A0A0H3V0N8	Geobacillus_virus	34.2	3.0e-28
WP_048896729.1|1462429_1462906_-	hypothetical protein	NA	A0A1P8CWR3	Bacillus_phage	39.0	7.9e-22
WP_046216871.1|1462892_1463552_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	38.9	3.4e-39
WP_046216872.1|1463538_1463772_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	48.2	1.3e-09
WP_046216873.1|1463768_1464164_-	hypothetical protein	NA	Q331W4	Clostridium_botulinum_C_phage	35.6	1.3e-14
WP_046216874.1|1464177_1464645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046216875.1|1464722_1465739_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	60.1	1.2e-115
WP_046216876.1|1465794_1466325_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	64.0	2.5e-56
WP_046216877.1|1466360_1467800_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	54.8	1.1e-135
WP_046216878.1|1467807_1469181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046216879.1|1469396_1470914_-	hypothetical protein	NA	O64068	Bacillus_phage	53.5	9.0e-152
WP_046217473.1|1470944_1471823_-	hypothetical protein	NA	A0A0K2FLD6	Brevibacillus_phage	28.0	1.9e-21
WP_046216880.1|1472731_1473661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046216881.1|1473784_1474366_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	U5J9X0	Bacillus_phage	31.2	4.1e-20
WP_046216882.1|1474406_1475597_-	metallophosphoesterase family protein	NA	A0A2R2ZHF5	Clostridioides_phage	38.9	2.9e-65
WP_046216883.1|1475609_1475807_-	YonK family protein	NA	NA	NA	NA	NA
WP_046216884.1|1475863_1476514_-	PhoH family protein	NA	F8WPX9	Bacillus_phage	48.1	4.7e-41
WP_046216885.1|1476908_1477187_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	61.1	1.3e-21
WP_048896730.1|1477361_1478099_-	hypothetical protein	NA	A0A0D3MV88	Staphylococcus_phage	45.6	2.0e-19
1477328:1477349	attR	CTATAAACGTTGATATAACAGC	NA	NA	NA	NA
WP_046216886.1|1478095_1480687_-	hypothetical protein	NA	O64076	Bacillus_phage	48.8	3.7e-230
>prophage 3
NZ_CP011974	Bacillus filamentosus strain Hbe603 chromosome, complete genome	4865574	1506778	1515444	4865574		Bacillus_phage(50.0%)	20	NA	NA
WP_048896734.1|1506778_1507435_+	HNH endonuclease	NA	A0A1P8CWZ4	Bacillus_phage	34.6	1.2e-23
WP_046216916.1|1507580_1507778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158512797.1|1507792_1507966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216917.1|1508203_1508419_+	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	60.3	4.7e-14
WP_046216918.1|1508405_1508681_+	hypothetical protein	NA	R9TMG2	Paenibacillus_phage	43.1	1.7e-05
WP_046216919.1|1508713_1508914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217481.1|1508952_1509162_+	hypothetical protein	NA	G0X530	Salmonella_phage	51.9	1.2e-09
WP_046216920.1|1509303_1509552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216921.1|1509721_1509994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158512798.1|1510239_1510854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048896735.1|1510900_1511902_+	hypothetical protein	NA	A0A290GDU0	Caldibacillus_phage	39.5	2.7e-19
WP_046216923.1|1511901_1512249_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	60.3	3.4e-14
WP_046216924.1|1512369_1512555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216925.1|1512554_1512959_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	42.1	1.7e-17
WP_158512799.1|1512993_1513161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216927.1|1513174_1513471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216928.1|1513495_1513777_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046216929.1|1513889_1514204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216930.1|1514246_1514579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048896736.1|1514613_1515444_+	hypothetical protein	NA	O64016	Bacillus_phage	44.9	3.0e-24
>prophage 4
NZ_CP011974	Bacillus filamentosus strain Hbe603 chromosome, complete genome	4865574	1547773	1575212	4865574		Bacillus_phage(42.11%)	34	NA	NA
WP_046216984.1|1547773_1549273_+	hypothetical protein	NA	Q332G8	Clostridium_botulinum_C_phage	39.8	1.5e-90
WP_046216985.1|1549284_1550307_+	hypothetical protein	NA	Q332G7	Clostridium_botulinum_C_phage	36.2	7.9e-51
WP_046216986.1|1550307_1551417_+	PD-(D/E)XK nuclease family protein	NA	Q332G6	Clostridium_botulinum_C_phage	38.1	5.3e-61
WP_048896740.1|1551433_1554457_+	PHP domain-containing protein	NA	A0A2R2ZGP4	Clostridioides_phage	47.3	5.9e-280
WP_048896741.1|1554505_1555279_+	hypothetical protein	NA	A0A0S2MUE5	Bacillus_phage	40.2	4.3e-09
WP_046216987.1|1555391_1555853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216988.1|1556092_1556290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216989.1|1556403_1556694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216990.1|1556817_1557114_+	hypothetical protein	NA	A0A127AWG6	Bacillus_phage	53.8	1.4e-21
WP_046216991.1|1557139_1557466_+	thermonuclease family protein	NA	A0A1W6JQ32	Staphylococcus_phage	47.1	1.9e-22
WP_046216992.1|1557490_1557781_+	hypothetical protein	NA	G3MAW6	Bacillus_virus	42.3	3.7e-06
WP_046216993.1|1557822_1558656_+	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_053102075.1|1558642_1559335_+	methyltransferase domain-containing protein	NA	A0A0N9SHZ9	Staphylococcus_phage	47.8	1.5e-53
WP_048896742.1|1559383_1560586_+	DNA (cytosine-5-)-methyltransferase	NA	A0A218MND0	uncultured_virus	36.7	1.2e-50
WP_046216994.1|1560622_1560802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216995.1|1560879_1561224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216996.1|1561235_1561541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216997.1|1561537_1561750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216998.1|1561904_1562108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046216999.1|1562172_1562550_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A076GDF1	Bacillus_phage	56.9	5.7e-31
WP_046217491.1|1562530_1565776_+	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	73.9	0.0e+00
WP_046217000.1|1565797_1566772_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	73.3	2.3e-132
WP_046217001.1|1566819_1567068_+	thioredoxin family protein	NA	A0A1P8CX24	Bacillus_phage	54.3	2.8e-18
WP_046217002.1|1567178_1567811_+	NUDIX domain-containing protein	NA	A0A127AYS1	Bacillus_phage	45.8	4.7e-46
WP_046217003.1|1567869_1568316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217004.1|1568353_1568962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217005.1|1569022_1569460_+	DUF3920 family protein	NA	NA	NA	NA	NA
WP_046217006.1|1569488_1570289_+	thymidylate synthase	NA	E5DV96	Deep-sea_thermophilic_phage	65.0	1.5e-102
WP_046217007.1|1570288_1570789_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	47.0	2.4e-37
WP_046217008.1|1570788_1571232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048896745.1|1571245_1571977_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_046217009.1|1572014_1572566_+	Holliday junction resolvase RecU	NA	A0A1P8CX67	Bacillus_phage	59.9	3.6e-50
WP_158512807.1|1572565_1572709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082864703.1|1572830_1575212_+	glutaminase A	NA	A0A0H3UZF2	Geobacillus_virus	42.0	7.8e-126
>prophage 5
NZ_CP011974	Bacillus filamentosus strain Hbe603 chromosome, complete genome	4865574	2343448	2391247	4865574	plate,integrase,holin,terminase,head	Aeribacillus_phage(23.81%)	72	2343346:2343362	2391408:2391424
2343346:2343362	attL	ATTAGTATGATGTCTTC	NA	NA	NA	NA
WP_046217232.1|2343448_2344642_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	53.9	3.1e-115
WP_046217233.1|2344716_2345484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048896785.1|2345572_2346082_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_046217234.1|2346522_2346861_-	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	51.5	3.3e-14
WP_046217235.1|2347026_2347251_+	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	59.1	2.9e-14
WP_046217236.1|2347279_2348056_+	phage antirepressor	NA	A0A2H4JCR9	uncultured_Caudovirales_phage	51.0	5.9e-67
WP_158512812.1|2348071_2348209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217237.1|2348205_2348511_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046217238.1|2348614_2349127_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046217239.1|2349123_2349408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158512813.1|2349545_2349707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217240.1|2349693_2349906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217241.1|2350002_2350935_+	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	63.7	3.5e-114
WP_046217242.1|2350949_2351870_+	recombinase RecT	NA	Q38143	Bacillus_phage	44.4	2.5e-56
WP_046217243.1|2352038_2352791_+	DnaD domain protein	NA	A0A1L2JY26	Aeribacillus_phage	39.4	2.8e-13
WP_108745566.1|2352684_2353455_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	61.0	4.1e-84
WP_046217244.1|2353468_2353663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108745567.1|2353662_2353839_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_046217246.1|2353926_2354373_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	74.5	3.0e-55
WP_046217247.1|2354394_2355123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217248.1|2355170_2355500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217249.1|2355549_2355798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217250.1|2355769_2356024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217251.1|2356063_2356246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217252.1|2356242_2356476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217253.1|2356453_2357008_+	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	46.3	2.5e-35
WP_082864720.1|2357090_2357270_+	DUF3954 domain-containing protein	NA	NA	NA	NA	NA
WP_046217254.1|2357304_2357523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193399804.1|2357819_2358200_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	50.8	2.3e-24
WP_158512814.1|2358469_2358634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046217256.1|2358741_2358996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217257.1|2359056_2359545_+	hypothetical protein	NA	A5GYP7	Lactococcus_phage	60.8	5.6e-47
WP_046217533.1|2359555_2361007_+|terminase	phage terminase large subunit	terminase	A8ATG0	Listeria_phage	48.2	2.1e-126
WP_046217258.1|2361009_2361210_+	hypothetical protein	NA	A0A1L2JY50	Aeribacillus_phage	55.4	3.3e-14
WP_046217259.1|2361239_2362583_+	DUF1073 domain-containing protein	NA	A8ATG1	Listeria_phage	53.4	1.7e-138
WP_046217534.1|2362575_2363340_+|head	phage head morphogenesis protein	head	A0A2H4N7C8	Pectobacterium_phage	29.1	8.3e-21
WP_046217260.1|2363393_2364053_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_046217261.1|2364117_2365200_+	DUF2213 domain-containing protein	NA	A8ATG4	Listeria_phage	47.3	5.2e-85
WP_046217262.1|2365212_2365671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217263.1|2365685_2366561_+	DUF2184 domain-containing protein	NA	A8ATG6	Listeria_phage	46.4	5.7e-66
WP_046217264.1|2366560_2366893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217265.1|2366907_2367243_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_048896920.1|2367271_2367865_+	hypothetical protein	NA	A8ATG9	Listeria_phage	48.0	5.2e-47
WP_046217266.1|2367857_2368208_+	hypothetical protein	NA	A0A1L2JY57	Aeribacillus_phage	49.1	9.0e-23
WP_046217267.1|2368204_2368687_+	hypothetical protein	NA	A0A1L2JY58	Aeribacillus_phage	47.5	2.3e-37
WP_046217268.1|2368690_2369704_+	DUF3383 family protein	NA	A0A1L2JZ70	Aeribacillus_phage	54.0	6.3e-101
WP_046217269.1|2369717_2370113_+	hypothetical protein	NA	A0A2H4J4R5	uncultured_Caudovirales_phage	44.9	6.6e-22
WP_046217535.1|2370219_2370480_+	hypothetical protein	NA	A0A1L2JY66	Aeribacillus_phage	48.2	3.7e-13
WP_158512815.1|2370499_2370667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048896787.1|2370699_2374485_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1L2JY60	Aeribacillus_phage	46.3	1.9e-166
WP_082864723.1|2374825_2375398_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	41.8	8.3e-26
WP_046217271.1|2375397_2375943_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1L2JY61	Aeribacillus_phage	54.2	2.3e-49
WP_046217272.1|2375942_2376296_+	hypothetical protein	NA	A0A2H4J6L1	uncultured_Caudovirales_phage	52.3	6.9e-31
WP_046217273.1|2376295_2377126_+	hypothetical protein	NA	A0A1L2JY62	Aeribacillus_phage	60.6	1.5e-87
WP_046217274.1|2377125_2377467_+	hypothetical protein	NA	A8ATI0	Listeria_phage	37.1	8.0e-08
WP_046217275.1|2377477_2377837_+	DUF2634 domain-containing protein	NA	A0A1L2JY67	Aeribacillus_phage	45.4	1.1e-18
WP_046217276.1|2377829_2379005_+|plate	baseplate J/gp47 family protein	plate	A0A2H4J8D2	uncultured_Caudovirales_phage	53.2	1.0e-115
WP_046217277.1|2379001_2379631_+	hypothetical protein	NA	A0A2H4J4S3	uncultured_Caudovirales_phage	55.5	1.4e-61
WP_046217278.1|2379659_2379869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046217279.1|2379894_2380230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053102080.1|2380241_2382125_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A1W6JSD2	Bacillus_phage	33.5	2.9e-67
WP_046217280.1|2382212_2383700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053102081.1|2383924_2384854_+	hypothetical protein	NA	A0A0S2SXG9	Bacillus_phage	29.0	1.3e-15
WP_046217281.1|2384869_2385199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040057606.1|2385310_2385580_+	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_046217282.1|2385594_2385846_+|holin	phage holin	holin	A0A0E3T7M8	Bacillus_phage	54.1	2.4e-14
WP_063592700.1|2385847_2386915_+	M15 family metallopeptidase	NA	A0A0H3V0Q8	Geobacillus_virus	47.7	1.3e-59
WP_046217283.1|2387905_2388130_-	helix-turn-helix transcriptional regulator	NA	S5MBY6	Brevibacillus_phage	47.3	8.3e-14
WP_046217284.1|2388460_2389789_+	hypothetical protein	NA	A0A0K1LLI3	Bacillus_phage	55.7	8.2e-133
WP_082864724.1|2389724_2390315_+	replication-relaxation family protein	NA	B3RH37	Bacillus_virus	58.7	8.5e-66
WP_048896788.1|2390454_2390898_+	hypothetical protein	NA	A0A0K1LLM8	Bacillus_phage	36.8	3.0e-15
WP_046217285.1|2390908_2391247_+	hypothetical protein	NA	A0A0K1LMH6	Bacillus_phage	39.3	8.1e-13
2391408:2391424	attR	ATTAGTATGATGTCTTC	NA	NA	NA	NA
