The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011018	Escherichia coli strain CI5 chromosome, complete genome	4885378	222473	231915	4885378		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|222473_223400_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
WP_000783120.1|223404_224136_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|224116_224224_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|224283_225015_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|225236_226922_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|226918_227638_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|227684_228155_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|228195_228657_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001349936.1|228781_230782_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001292769.1|230778_231915_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 2
NZ_CP011018	Escherichia coli strain CI5 chromosome, complete genome	4885378	288286	298985	4885378	lysis,tail,integrase	Enterobacteria_phage(75.0%)	12	284114:284128	308226:308240
284114:284128	attL	CGACTGGAAAGCGAG	NA	NA	NA	NA
WP_039264507.1|288286_289360_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.6	3.9e-194
WP_039264506.1|289337_289556_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	2.4e-34
WP_039264505.1|290005_290704_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	83.2	3.9e-102
WP_039264504.1|290834_291002_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	92.7	1.8e-21
WP_024215524.1|290998_291280_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	3.3e-44
WP_024239663.1|291296_291611_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	5.9e-50
WP_000041317.1|291622_292105_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.8	1.4e-79
WP_039264503.1|292770_293214_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	96.6	2.4e-73
WP_039264502.1|293252_293627_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	81.5	4.6e-49
WP_046201413.1|294251_294986_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0K2FIG2	Enterobacteria_phage	94.4	1.7e-87
WP_071885001.1|295050_298401_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_039264499.1|298400_298985_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	7.0e-105
308226:308240	attR	CGACTGGAAAGCGAG	NA	NA	NA	NA
>prophage 3
NZ_CP011018	Escherichia coli strain CI5 chromosome, complete genome	4885378	1019358	1055838	4885378	lysis,tail,terminase	Enterobacteria_phage(36.67%)	37	NA	NA
WP_046201463.1|1019358_1020492_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	5.4e-117
WP_001082294.1|1020632_1021067_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_120795384.1|1021843_1021957_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836772.1|1022025_1022259_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
WP_000086519.1|1022575_1023166_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
WP_000885599.1|1023263_1023839_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	9.1e-105
WP_071886251.1|1023838_1027369_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.9e-11
WP_001233133.1|1027433_1028033_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.0	1.6e-107
WP_046201464.1|1028100_1031580_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
WP_000090943.1|1031640_1032243_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_001349612.1|1032179_1032923_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	8.9e-145
WP_001152432.1|1032928_1033627_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|1033626_1033965_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_000840620.1|1033957_1037191_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.7	1.3e-112
WP_012565075.1|1037664_1038024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|1038174_1039137_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000144678.1|1039163_1039556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|1039552_1039933_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|1039933_1040317_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|1040316_1040712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918490.1|1040934_1042074_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	74.7	1.7e-158
WP_000770036.1|1042172_1042937_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	6.6e-87
WP_001317036.1|1043041_1044154_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	6.0e-113
WP_000763708.1|1044137_1045544_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	6.7e-186
WP_000625347.1|1045546_1046848_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	8.0e-149
WP_000089446.1|1046828_1047923_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.2	4.5e-113
WP_000126788.1|1047926_1048136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204033.1|1048113_1049046_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_001291092.1|1049038_1049833_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	7.5e-49
WP_046201465.1|1049970_1051428_-	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228688.1|1051624_1051810_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001135310.1|1052026_1052524_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_000839565.1|1052523_1052739_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|1052990_1053365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|1053536_1053965_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640162.1|1055008_1055551_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	4.9e-76
WP_000247763.1|1055547_1055838_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
>prophage 4
NZ_CP011018	Escherichia coli strain CI5 chromosome, complete genome	4885378	1062565	1080864	4885378	tRNA,integrase	Escherichia_phage(66.67%)	21	1063902:1063915	1078287:1078300
WP_001676522.1|1062565_1064563_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
1063902:1063915	attL	GCATTCACCTGCAA	NA	NA	NA	NA
WP_001151151.1|1064903_1065326_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262393.1|1065366_1066437_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693853.1|1066508_1066934_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|1066930_1067185_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|1067264_1067684_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001169151.1|1068115_1068271_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|1068267_1068756_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|1069197_1069419_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|1069418_1069589_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|1069663_1069939_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_046201466.1|1070040_1072641_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	2.8e-246
WP_000166319.1|1072633_1073443_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|1073499_1073694_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|1073686_1073896_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|1073974_1074190_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|1074191_1075427_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001153728.1|1075478_1076414_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.0e-145
WP_000123739.1|1076542_1077916_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|1078393_1079377_-	zinc transporter ZntB	NA	NA	NA	NA	NA
1078287:1078300	attR	GCATTCACCTGCAA	NA	NA	NA	NA
WP_000628065.1|1079631_1080864_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 5
NZ_CP011018	Escherichia coli strain CI5 chromosome, complete genome	4885378	1273496	1332437	4885378	tail,capsid,integrase,terminase,tRNA,holin,portal,head	Escherichia_phage(38.78%)	67	1284246:1284263	1340960:1340977
WP_001297484.1|1273496_1274603_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|1274638_1275280_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|1275283_1276654_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|1276821_1277493_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|1277492_1278953_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|1279028_1280150_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_038994720.1|1280295_1281525_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|1281774_1282911_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799399.1|1282894_1283758_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_077781611.1|1283922_1284252_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
1284246:1284263	attL	AATCTGAAAAATCATCCA	NA	NA	NA	NA
WP_034172969.1|1284416_1285091_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	77.1	2.1e-97
WP_034172970.1|1285087_1285312_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_046201470.1|1285321_1286728_-|tail	tail protein	tail	S5MDN9	Escherichia_phage	74.1	1.4e-103
WP_046201471.1|1286796_1286907_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	94.1	1.2e-10
WP_046201472.1|1287103_1290580_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	87.4	0.0e+00
WP_046201473.1|1290821_1291460_-|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	97.8	2.1e-94
WP_034173014.1|1291357_1292101_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.1	4.0e-145
WP_034172975.1|1292106_1292805_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	88.8	1.3e-118
WP_034172976.1|1293010_1294174_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	4.2e-141
WP_034172977.1|1294399_1294729_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	80.7	3.8e-47
WP_046201474.1|1294725_1297308_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.2	0.0e+00
WP_049590271.1|1297288_1297702_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	86.9	8.4e-44
WP_034172979.1|1297728_1298160_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	69.4	2.5e-43
WP_034172980.1|1298179_1298929_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.8	1.3e-130
WP_034172981.1|1298936_1299332_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	5.7e-58
WP_046201475.1|1299328_1299907_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	88.0	3.3e-70
WP_034172983.1|1299921_1300275_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_046201476.1|1300267_1300651_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_034172985.1|1300702_1301731_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	3.9e-114
WP_034172986.1|1301788_1302136_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_034172987.1|1302172_1303678_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.4	4.3e-98
WP_034172988.1|1303667_1305260_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	3.2e-184
WP_046201477.1|1305256_1305463_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	53.8	8.7e-10
WP_034172989.1|1305446_1307375_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	1.1e-263
WP_034172990.1|1307346_1307856_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	34.5	1.5e-13
WP_032317909.1|1308250_1308445_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_139108877.1|1308577_1308763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201478.1|1308810_1309353_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	55.6	1.6e-26
WP_034172993.1|1309427_1309934_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_034172994.1|1309930_1310464_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	89.8	1.9e-93
WP_139108876.1|1310623_1310896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201480.1|1311151_1311367_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.6e-33
WP_034172997.1|1311444_1311750_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_052232680.1|1311775_1311952_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	60.4	4.4e-10
WP_046201481.1|1312114_1314049_-	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	69.9	1.9e-263
WP_034172999.1|1316187_1317246_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.6	1.6e-195
WP_046201482.1|1317395_1317593_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	2.3e-28
WP_034173000.1|1317819_1318641_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	4.6e-78
WP_046201483.1|1318637_1318874_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	41.6	5.5e-16
WP_046201484.1|1318874_1319933_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	3.1e-90
WP_046201693.1|1319934_1320204_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	38.7	1.7e-05
WP_046201485.1|1320378_1320591_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	1.1e-26
WP_072134538.1|1320779_1320884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072134537.1|1321932_1322346_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	1.7e-57
WP_046201488.1|1322346_1322769_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	6.7e-65
WP_046201489.1|1322784_1323555_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	73.0	9.6e-94
WP_046201490.1|1323583_1324321_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	8.9e-113
WP_046201696.1|1324327_1325290_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	53.0	5.8e-72
WP_046201491.1|1325312_1325738_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|1325721_1326003_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362155.1|1326103_1326523_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_053099141.1|1326790_1326943_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001541619.1|1328095_1328284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201493.1|1328280_1328472_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_046201494.1|1328562_1331019_+	exonuclease	NA	V5UQJ3	Shigella_phage	44.6	5.8e-108
WP_046201495.1|1331080_1331350_+	excisionase	NA	NA	NA	NA	NA
WP_046201496.1|1331318_1332437_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.7	4.1e-85
1340960:1340977	attR	AATCTGAAAAATCATCCA	NA	NA	NA	NA
>prophage 6
NZ_CP011018	Escherichia coli strain CI5 chromosome, complete genome	4885378	1565419	1653600	4885378	lysis,tail,capsid,integrase,terminase,protease,tRNA,plate,portal,head	Salmonella_phage(56.45%)	94	1587698:1587711	1654063:1654076
WP_000886683.1|1565419_1566712_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|1566802_1568146_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|1568156_1568768_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077063.1|1568922_1573029_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1573163_1573658_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|1574202_1575168_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|1575290_1577057_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|1577057_1578779_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|1578820_1579525_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1579809_1580028_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|1580950_1583227_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|1583257_1583578_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|1583900_1584125_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|1584197_1586144_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_032215246.1|1586140_1587256_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|1587406_1588363_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
1587698:1587711	attL	TTGCTGGAGGCGTT	NA	NA	NA	NA
WP_000599820.1|1588359_1590018_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|1590443_1591139_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491127.1|1591634_1592534_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|1592677_1594330_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|1594341_1595310_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|1595442_1597161_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|1597197_1598199_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|1598209_1599640_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|1599738_1600752_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|1600748_1601579_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|1601575_1601899_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|1602024_1602540_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1602757_1603486_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|1603503_1604235_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|1604241_1604958_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|1604957_1605626_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|1605917_1606649_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149734.1|1606823_1607951_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	4.6e-28
WP_000389260.1|1607991_1608480_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|1608539_1609385_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105438.1|1609381_1610335_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996024.1|1610344_1611478_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000126072.1|1611572_1612685_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1613036_1613513_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1613600_1614503_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_001402143.1|1614563_1615286_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|1615269_1615557_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|1615716_1615974_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|1616003_1616381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|1616650_1618336_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|1618571_1618790_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_046201500.1|1618880_1619981_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.5	1.7e-176
WP_000980396.1|1619977_1620463_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
WP_046201501.1|1620459_1623537_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.4	0.0e+00
WP_000763311.1|1623529_1623649_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281013.1|1623663_1623966_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_001504081.1|1624020_1624536_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001726272.1|1624545_1625718_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_000905033.1|1625859_1626426_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_071886254.1|1626453_1626843_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	70.0	2.8e-09
WP_046201503.1|1626844_1627288_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	71.4	9.2e-57
WP_000367939.1|1627259_1627862_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	7.8e-99
WP_046201504.1|1627861_1629403_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.3	5.5e-197
WP_001086820.1|1629399_1630005_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_000268301.1|1629997_1630906_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_000177400.1|1630892_1631252_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	1.2e-51
WP_042096888.1|1631248_1631827_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	1.9e-94
WP_000829119.1|1631895_1632342_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	86.3	2.3e-63
WP_001039933.1|1632334_1632766_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	2.2e-71
WP_046201505.1|1632861_1633290_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	78.7	1.5e-48
WP_032200197.1|1633286_1633664_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
WP_046201506.1|1633665_1634178_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	5.8e-87
WP_000171568.1|1634158_1634374_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868170.1|1634377_1634581_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	8.8e-31
WP_000673524.1|1634580_1635045_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000059206.1|1635140_1635791_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	2.5e-111
WP_000742510.1|1635794_1636853_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000216237.1|1636869_1637703_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001098431.1|1637845_1639612_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_046201507.1|1639611_1640640_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.6	8.4e-170
WP_001518830.1|1640686_1642351_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	25.3	9.9e-11
WP_000207842.1|1642645_1643365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|1643487_1643721_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|1643731_1643920_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_046201508.1|1644073_1646488_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.5	0.0e+00
WP_000104133.1|1646484_1647342_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	2.1e-158
WP_000752613.1|1647338_1647566_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244228.1|1647565_1647799_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000996717.1|1647866_1648208_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_097156329.1|1648325_1648592_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	83.3	1.1e-15
WP_000166365.1|1648785_1649244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001350183.1|1649191_1649425_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	86.1	5.2e-11
WP_000460900.1|1649432_1649942_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	2.9e-86
WP_000188450.1|1650006_1650210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350184.1|1650355_1650925_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_001350185.1|1650940_1651123_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	55.9	8.5e-09
WP_000102108.1|1651136_1652468_+	NTPase	NA	R9TRQ8	Vibrio_phage	27.1	3.2e-20
WP_000290937.1|1652547_1653600_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
1654063:1654076	attR	AACGCCTCCAGCAA	NA	NA	NA	NA
>prophage 7
NZ_CP011018	Escherichia coli strain CI5 chromosome, complete genome	4885378	1951503	2007442	4885378	lysis,tail,capsid,integrase,terminase,protease,tRNA,portal,head	Enterobacteria_phage(66.07%)	70	1951035:1951081	1997236:1997282
1951035:1951081	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|1951503_1952457_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_032230883.1|1952643_1954128_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001547145.1|1954311_1954617_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239881.1|1954673_1955342_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_046201517.1|1955396_1955981_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.0e-103
WP_071886259.1|1955980_1959052_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_046201519.1|1959116_1959716_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	6.5e-106
WP_046201520.1|1959783_1963263_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
WP_000090847.1|1963323_1963926_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_047675718.1|1963862_1964606_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	1.4e-145
WP_001499538.1|1964611_1965310_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	3.3e-133
WP_000847379.1|1965309_1965639_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_046201522.1|1965635_1968197_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.7	0.0e+00
WP_000459457.1|1968189_1968624_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479142.1|1968605_1969028_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_001358372.1|1969043_1969784_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.4e-129
WP_000683105.1|1969791_1970187_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_046201523.1|1970183_1970762_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	4.6e-80
WP_000752979.1|1970773_1971127_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_021499141.1|1971138_1971537_-	DNA packaging FI family protein	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063280.1|1971578_1972604_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001358225.1|1972659_1972992_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000123298.1|1973001_1974321_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	6.2e-234
WP_042110164.1|1974301_1975903_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	9.4e-309
WP_000198149.1|1975899_1976106_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_046201524.1|1976102_1978028_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_046201525.1|1978002_1978548_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001307652.1|1978936_1979131_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738423.1|1979490_1979784_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_122985311.1|1979874_1980057_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135254.1|1980273_1980771_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	94.5	1.6e-86
WP_000839596.1|1980770_1980986_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737263.1|1981559_1982642_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_001204774.1|1982830_1983214_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	5.2e-56
WP_032145910.1|1983299_1983440_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099516.1|1983436_1983799_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	2.3e-58
WP_000774490.1|1983795_1984086_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	2.5e-47
WP_000224916.1|1984078_1984249_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_046201527.1|1984248_1984704_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	7.0e-60
WP_072106870.1|1984700_1984802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000622057.1|1984893_1985376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371307.1|1985632_1986385_-	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	36.5	3.9e-31
WP_000145946.1|1986673_1986967_-	winged helix-turn-helix transcriptional regulator	NA	A0A0P0ZCJ0	Stx2-converting_phage	84.9	3.7e-38
WP_001361480.1|1986963_1987665_-	replication P family protein	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_001361484.1|1987661_1988591_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.0e-110
WP_001182887.1|1988677_1989217_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000184665.1|1989247_1989475_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001295669.1|1989585_1990278_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000741702.1|1990407_1991547_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000581650.1|1991543_1992056_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_000233576.1|1992534_1992741_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995430.1|1992817_1993114_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
WP_000100847.1|1993119_1993905_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_046201528.1|1993901_1994582_+	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	98.2	3.9e-131
WP_000682299.1|1994578_1994761_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	98.3	3.7e-28
WP_000548513.1|1994733_1994925_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	95.2	4.0e-25
WP_001386642.1|1994935_1995217_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763387.1|1995315_1995534_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	1.7e-35
WP_000488407.1|1995581_1995860_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446901.1|1995831_1996203_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	82.8	5.5e-47
WP_042109860.1|1996058_1997222_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	1.7e-198
WP_000805428.1|1997556_1998189_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1997236:1997282	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250423.1|1998191_1998707_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691050.1|1998717_1999725_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000988366.1|2002376_2003069_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|2003288_2003831_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729154.1|2004311_2005178_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|2005179_2005392_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143543.1|2005499_2006021_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|2006056_2007442_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 8
NZ_CP011018	Escherichia coli strain CI5 chromosome, complete genome	4885378	2344055	2376204	4885378	plate,transposase,integrase	Vibrio_phage(100.0%)	28	2336617:2336676	2379972:2380048
2336617:2336676	attL	TGGCGGAACGGACGGGACTCGAACCCGCGACCCCCTGCGTGACAGGCAGGTATTCTAACC	NA	NA	NA	NA
WP_000420795.1|2344055_2345192_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_001199686.1|2348008_2348440_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_032141711.1|2348467_2350687_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_100224276.1|2350711_2351059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402126.1|2351079_2351646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024170797.1|2351862_2352639_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_032217617.1|2352638_2356505_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000522897.1|2356504_2356750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060994.1|2356800_2357475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402123.1|2357480_2358797_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_000118770.1|2358793_2360137_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001402122.1|2360140_2360674_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119441.1|2360741_2361227_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000871596.1|2361340_2361712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533466.1|2361708_2362194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000245849.1|2362246_2363761_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996814.1|2363785_2364331_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000144225.1|2364392_2364683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040751.1|2364685_2365249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201555.1|2365261_2367895_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.8	2.5e-80
WP_000804010.1|2368227_2369142_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000183810.1|2369128_2369959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276642.1|2369955_2370450_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371477.1|2370465_2372349_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_039264360.1|2372345_2373341_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000450225.1|2373351_2374398_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_000985079.1|2374397_2374673_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_001396203.1|2375838_2376204_+|integrase	integrase	integrase	NA	NA	NA	NA
2379972:2380048	attR	TGGCGGAACGGACGGGACTCGAACCCGCGACCCCCTGCGTGACAGGCAGGTATTCTAACCGACTGAACTACCGCTCC	NA	NA	NA	NA
>prophage 9
NZ_CP011018	Escherichia coli strain CI5 chromosome, complete genome	4885378	4229455	4306769	4885378	tail,transposase,integrase,protease,tRNA,plate,head	Shigella_phage(56.1%)	85	4299526:4299540	4311203:4311217
WP_000886095.1|4229455_4230436_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_000354046.1|4230678_4230945_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_000244772.1|4230925_4231333_+	membrane protein	NA	NA	NA	NA	NA
WP_001055874.1|4231372_4231894_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_000806638.1|4232005_4232902_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|4232926_4233637_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813215.1|4233642_4235376_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|4235466_4236564_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|4236574_4238092_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192814.1|4238134_4238683_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|4238737_4238809_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|4238805_4238931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|4238932_4240381_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001355763.1|4240816_4242736_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|4242735_4243224_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|4243259_4244627_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|4244662_4245979_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280215.1|4245996_4247397_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_000583616.1|4247561_4250432_-	molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit	NA	NA	NA	NA	NA
WP_000572462.1|4250428_4251208_-	molybdopterin-dependent oxidoreductase FAD-binding subunit	NA	NA	NA	NA	NA
WP_000906276.1|4251258_4252587_-	putative aminohydrolase SsnA	NA	NA	NA	NA	NA
WP_000502424.1|4252589_4255688_-	putative selenate reductase subunit YgfK	NA	NA	NA	NA	NA
WP_001272834.1|4256009_4256588_-	molybdenum cofactor cytidylyltransferase	NA	NA	NA	NA	NA
WP_000835703.1|4256690_4257461_+	putative selenium-dependent hydroxylase accessory protein YqeC	NA	NA	NA	NA	NA
WP_001020381.1|4257508_4259134_+	EF2563 family selenium-dependent molybdenum hydroxylase system protein	NA	NA	NA	NA	NA
WP_000037998.1|4259174_4260107_-	carbamate kinase	NA	NA	NA	NA	NA
WP_001264452.1|4260154_4261540_-	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_001107125.1|4261592_4262804_-	YgeY family selenium metabolism-linked hydrolase	NA	NA	NA	NA	NA
WP_000110493.1|4262861_4264058_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_001303128.1|4264115_4265303_-	knotted carbamoyltransferase YgeW	NA	NA	NA	NA	NA
WP_000417808.1|4265781_4267560_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_001016606.1|4267599_4268079_-	xanthine dehydrogenase iron sulfur-binding subunit XdhC	NA	NA	NA	NA	NA
WP_000459182.1|4268075_4268954_-	xanthine dehydrogenase FAD-binding subunit XdhB	NA	NA	NA	NA	NA
WP_046201602.1|4269501_4270236_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	78.2	2.2e-103
WP_014334043.1|4270189_4270390_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_046201603.1|4270653_4270956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201604.1|4271115_4271370_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_046201605.1|4271405_4271588_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	55.0	5.9e-10
WP_046201606.1|4271724_4273803_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	66.8	4.1e-232
WP_046201709.1|4274107_4274629_+|tail	tail protein	tail	A0A0U2QV64	Escherichia_phage	47.4	8.1e-44
WP_046201607.1|4274660_4275542_-	hypothetical protein	NA	C9DGQ8	Escherichia_phage	39.5	2.8e-28
WP_046201608.1|4275541_4276102_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	47.0	6.6e-44
WP_046201609.1|4276092_4277175_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.5	2.4e-98
WP_046201610.1|4277174_4277612_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	57.6	4.5e-40
WP_077787734.1|4277604_4278219_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.8	1.9e-52
WP_046201612.1|4278208_4279336_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.2	2.0e-95
WP_046201613.1|4279319_4280678_-	multidrug DMT transporter permease	NA	A0A0C4UR32	Shigella_phage	31.9	2.2e-53
WP_046201614.1|4280664_4282722_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	39.4	2.9e-76
WP_046201615.1|4282849_4283326_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	49.6	1.6e-22
WP_046201616.1|4283340_4283706_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_046201617.1|4283714_4285196_-|tail	tail protein	tail	A0A0C4UQS0	Shigella_phage	52.1	2.2e-134
WP_046201618.1|4285195_4285459_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_046201619.1|4285462_4286026_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.1	6.3e-42
WP_046201620.1|4286022_4286442_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	55.0	3.6e-34
WP_046201621.1|4286438_4286888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201622.1|4286931_4287879_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	2.5e-123
WP_046201623.1|4287878_4289012_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	51.6	1.4e-88
WP_046201624.1|4289189_4289663_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.3e-37
WP_046201625.1|4289784_4291116_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.2	9.9e-155
WP_046201710.1|4291099_4292689_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.3	1.6e-167
WP_046201711.1|4292688_4294341_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	71.9	8.9e-230
WP_000360580.1|4294400_4294982_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	4.2e-49
WP_001279080.1|4294984_4295275_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_033816661.1|4295271_4295580_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_046201626.1|4295560_4295788_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_005136374.1|4295798_4296017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144405570.1|4296000_4296429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201628.1|4296463_4296964_-	lysozyme	NA	B6SD29	Bacteriophage	43.9	9.2e-29
WP_000852372.1|4297035_4297458_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_046201629.1|4297528_4298038_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	46.1	4.8e-25
WP_046201630.1|4298034_4298331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201631.1|4298509_4298842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201632.1|4298880_4299066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201633.1|4299062_4299614_-	DNA-binding protein	NA	NA	NA	NA	NA
4299526:4299540	attL	GCAATCAGCAGCGCA	NA	NA	NA	NA
WP_046201634.1|4299617_4300133_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.0	4.7e-44
WP_046201635.1|4300132_4300666_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	65.5	8.8e-62
WP_046201636.1|4300669_4301212_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	39.4	1.4e-27
WP_046201637.1|4301309_4301840_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	56.6	7.2e-48
WP_046201638.1|4301851_4302145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201639.1|4302219_4302474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201640.1|4302486_4302708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201641.1|4302710_4303643_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	49.0	2.8e-71
WP_046201642.1|4303718_4305806_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	44.9	9.7e-165
WP_001575658.1|4305808_4306039_-	DNA-binding protein	NA	A0A0C4UQU0	Shigella_phage	40.8	1.8e-08
WP_046201643.1|4306223_4306769_+	hypothetical protein	NA	A0A2I7S9A5	Vibrio_phage	35.2	5.4e-06
4311203:4311217	attR	TGCGCTGCTGATTGC	NA	NA	NA	NA
>prophage 10
NZ_CP011018	Escherichia coli strain CI5 chromosome, complete genome	4885378	4461962	4469102	4885378		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4461962_4462601_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|4462597_4463860_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|4463856_4464765_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|4464930_4465728_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141330.1|4465778_4466435_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272924.1|4466540_4469102_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 11
NZ_CP011018	Escherichia coli strain CI5 chromosome, complete genome	4885378	4827135	4880135	4885378	tail,transposase,integrase,protease,plate,head	Shigella_phage(53.85%)	65	4836172:4836190	4858265:4858283
WP_000958693.1|4827135_4828293_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	98.7	6.5e-219
WP_000368131.1|4828604_4829537_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000776768.1|4829830_4830586_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937833.1|4830767_4831826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296861.1|4832191_4833532_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|4833903_4834188_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531954.1|4834367_4835678_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001583728.1|4835677_4837822_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
4836172:4836190	attL	AGAGATGATCCTCACCGGA	NA	NA	NA	NA
WP_001195819.1|4838024_4838510_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033328.1|4839184_4839748_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000185422.1|4841939_4842581_-	helix-turn-helix transcriptional regulator	NA	A0A1C6ZDG7	Pseudomonas_phage	43.8	4.8e-06
WP_001266279.1|4842732_4842999_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	46.0	1.4e-07
WP_046201660.1|4843009_4845100_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	46.3	3.1e-163
WP_046201641.1|4845175_4846108_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	49.0	2.8e-71
WP_046201640.1|4846110_4846332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201639.1|4846344_4846599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201661.1|4846673_4846967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129558.1|4846978_4847509_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	2.5e-48
WP_046201662.1|4847606_4848149_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.6	5.8e-29
WP_046201663.1|4848152_4848686_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.8	2.0e-66
WP_046201634.1|4848685_4849201_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.0	4.7e-44
WP_046201633.1|4849204_4849756_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_046201664.1|4849752_4849938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201665.1|4849976_4850309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201666.1|4850301_4850499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201630.1|4850488_4850785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201667.1|4850781_4851291_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	46.1	4.8e-25
WP_000852372.1|4851361_4851784_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_046201668.1|4851855_4852356_+	lysozyme	NA	A0A2H4J3P8	uncultured_Caudovirales_phage	41.4	1.9e-26
WP_144405571.1|4852390_4852819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005136374.1|4852802_4853021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201670.1|4853031_4853259_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_033816661.1|4853239_4853548_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279080.1|4853544_4853835_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_000360581.1|4853837_4854419_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_046201671.1|4854418_4856083_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.0	2.0e-229
WP_046201715.1|4856082_4857672_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	56.3	5.1e-166
WP_046201672.1|4857655_4858987_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.2	2.2e-154
4858265:4858283	attR	TCCGGTGAGGATCATCTCT	NA	NA	NA	NA
WP_000094809.1|4859108_4859582_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	4.6e-38
WP_046201673.1|4859759_4860884_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	46.8	5.9e-76
WP_012908603.1|4860883_4861831_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	7.1e-123
WP_046201674.1|4861874_4862282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201675.1|4862278_4862698_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	2.3e-33
WP_046201676.1|4862694_4863258_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	46.5	3.1e-41
WP_000207438.1|4863261_4863540_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_046201677.1|4863539_4865021_+|tail	tail protein	tail	A0A0C4UQS0	Shigella_phage	52.5	3.3e-135
WP_000015471.1|4865029_4865395_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	50.0	3.8e-24
WP_046201678.1|4865409_4865889_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	49.2	2.3e-21
WP_046201679.1|4866016_4868074_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	38.9	3.7e-76
WP_012908610.1|4868060_4869419_+	DMT family permease	NA	A0A0C4UR32	Shigella_phage	30.3	3.4e-49
WP_046201680.1|4869402_4870530_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.2	1.2e-95
WP_073520730.1|4870519_4871134_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	50.8	1.2e-51
WP_046201681.1|4871126_4871564_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	58.3	5.4e-41
WP_001146843.1|4871563_4872646_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_046201682.1|4872636_4873197_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	4.6e-45
WP_046201683.1|4873196_4874087_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	47.5	5.6e-37
WP_046201684.1|4874138_4874660_+|tail	tail protein	tail	A0A0U2QV64	Escherichia_phage	49.1	7.3e-45
WP_077787742.1|4874694_4875060_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	61.2	9.1e-18
WP_012908617.1|4875154_4875727_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	76.9	1.7e-74
WP_046201685.1|4875812_4877861_+	hypothetical protein	NA	S5MDQ7	Escherichia_phage	63.4	2.3e-227
WP_046201686.1|4877995_4878178_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	57.9	2.6e-10
WP_001114098.1|4878213_4878468_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_046201687.1|4878543_4878744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032164298.1|4878928_4879114_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_046201688.1|4879082_4880135_+	DNA cytosine methyltransferase	NA	H9C177	Pectobacterium_phage	63.7	4.1e-119
>prophage 1
NZ_CP011019	Escherichia coli strain CI5 plasmid unnamed, complete sequence	207265	162966	198615	207265	transposase,protease,integrase	Enterobacteria_phage(21.43%)	32	152399:152412	199075:199088
152399:152412	attL	GCCCGTTGCACGGC	NA	NA	NA	NA
WP_089557530.1|162966_164190_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032325769.1|165173_166172_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000587689.1|167559_168186_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_005015281.1|168305_168485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046201804.1|170397_171054_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046201805.1|171104_171869_-	gluconate 5-dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.4	2.0e-14
WP_046201806.1|171892_172357_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_046201807.1|172368_173304_-	sugar kinase	NA	NA	NA	NA	NA
WP_046201808.1|173300_174272_-	C-terminal binding protein	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	32.3	1.6e-29
WP_046201809.1|174564_175839_+	MFS transporter	NA	NA	NA	NA	NA
WP_001398199.1|176356_176758_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|176690_176948_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_046201810.1|177040_177694_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_046201811.1|178270_182200_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	37.1	3.2e-217
WP_046201812.1|182743_183142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052734131.1|183153_183507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046201814.1|183876_184296_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_000993925.1|185326_185977_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	43.6	4.0e-16
WP_000623562.1|185976_186324_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	4.4e-46
WP_046201816.1|186343_187915_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	1.1e-168
WP_046201817.1|188045_188468_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_139108889.1|188514_188817_-	antirestriction protein	NA	NA	NA	NA	NA
WP_046201818.1|190003_191173_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	84.6	1.3e-177
WP_072134512.1|191176_191386_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	53.4	2.5e-12
WP_046201819.1|191526_192489_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.6	8.0e-114
WP_000817642.1|192485_193691_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.4	5.6e-205
WP_000402944.1|194064_194277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132895.1|194449_194701_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001270421.1|194697_194985_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	5.8e-20
WP_046201820.1|195270_195561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361612.1|196618_197596_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_046201823.1|197874_198615_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.6	3.5e-24
199075:199088	attR	GCCGTGCAACGGGC	NA	NA	NA	NA
