The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011134	Escherichia coli VR50 chromosome, complete genome	5000386	203549	268829	5000386	plate,protease,tRNA,transposase	Emiliania_huxleyi_virus(11.11%)	54	NA	NA
WP_001295561.1|203549_204902_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|204931_207364_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|207485_207971_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|207974_209000_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|209104_209560_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|209563_210352_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|210351_211500_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|211496_212093_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|212129_215612_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|215624_216584_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|216682_218824_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|218880_219270_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176549.1|219334_220633_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|220681_220942_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|220928_221129_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|221294_221840_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|221836_222259_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_046072786.1|222272_222983_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001336393.1|223182_224007_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|224060_225779_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|225890_226598_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|226594_226999_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|227116_227932_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|227971_228625_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594006.1|228617_229649_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001140187.1|229836_230412_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|236170_236974_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|236970_237885_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|238125_238926_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000644685.1|239600_240959_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|241030_241786_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|241819_242542_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|242538_243006_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|243070_243802_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086141.1|244338_245124_+	lipoprotein	NA	NA	NA	NA	NA
WP_001236645.1|245260_245740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908066.1|245749_246664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|246707_247190_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_046072787.1|247213_248566_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_123009675.1|248576_252011_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_046072788.1|252119_253532_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088852.1|253536_254280_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614325.1|254276_257042_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|257050_257812_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246443.1|257816_259148_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|259150_259675_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113714.1|259671_260952_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|260976_262059_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|262022_263873_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|263876_264290_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|264296_265772_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|265822_266047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|266081_266582_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_139371347.1|267616_268829_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
>prophage 2
NZ_CP011134	Escherichia coli VR50 chromosome, complete genome	5000386	300657	316026	5000386	integrase	Enterobacteria_phage(81.82%)	15	291109:291122	311434:311447
291109:291122	attL	ACGATGACCGCCAG	NA	NA	NA	NA
WP_046072790.1|300657_301833_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.7	2.5e-141
WP_046072791.1|301833_303534_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_046072792.1|303530_305153_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	24.4	8.2e-10
WP_021546004.1|305354_305927_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	99.5	1.8e-97
WP_000984202.1|305941_306187_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
WP_046072793.1|306183_306918_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	8.8e-129
WP_001149160.1|307470_307737_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_046072794.1|307733_308333_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	1.7e-50
WP_001244665.1|308325_308613_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_046072795.1|308605_309061_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|309196_309517_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_046072796.1|309531_311865_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
311434:311447	attR	CTGGCGGTCATCGT	NA	NA	NA	NA
WP_001111348.1|312472_312883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121359.1|312861_313818_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|313827_316026_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 3
NZ_CP011134	Escherichia coli VR50 chromosome, complete genome	5000386	799414	868106	5000386	terminase,tail,head,portal,capsid,lysis,transposase	Enterobacteria_phage(60.0%)	74	NA	NA
WP_136952279.1|799414_800627_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
WP_000145897.1|800677_800851_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	89.1	2.1e-20
WP_001224617.1|800997_801492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379696.1|802129_802330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141579.1|802438_802540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053012.1|802536_802992_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
WP_000224907.1|802991_803162_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774486.1|803154_803445_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099518.1|803441_803804_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.8	6.2e-59
WP_000971068.1|803800_803941_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001405603.1|804026_804410_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	1.7e-54
WP_000737270.1|804599_805682_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	9.2e-167
WP_000839596.1|806254_806470_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135280.1|806469_806967_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228695.1|807183_807366_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|807456_807750_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001307652.1|808111_808306_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453568.1|808694_809240_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	3.1e-94
WP_001027320.1|809214_811140_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198149.1|811136_811343_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001405604.1|811339_812941_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000123287.1|812921_814241_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	4.0e-233
WP_001299443.1|814250_814583_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063278.1|814638_815664_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	1.9e-190
WP_000158905.1|815705_816104_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000753007.1|816115_816469_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000975070.1|816480_817059_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683104.1|817055_817451_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	97.7	6.5e-70
WP_001405605.1|817458_818199_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	1.5e-131
WP_046072806.1|818214_818637_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.1	1.0e-57
WP_000459457.1|818618_819053_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840232.1|819045_821601_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.2	0.0e+00
WP_000847345.1|821597_821927_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001534232.1|821926_822625_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	6.2e-132
WP_032158359.1|822630_823374_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	3.6e-146
WP_046072807.1|823974_827454_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001228249.1|827521_828121_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_016238675.1|828185_830585_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	55.2	3.9e-133
WP_000654163.1|830581_830863_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	4.1e-18
WP_001405874.1|830872_831913_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	1.7e-125
WP_001405607.1|831955_832249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000767389.1|832887_833364_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001295303.1|833422_834712_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
WP_000951213.1|834798_835839_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_000118826.1|835835_836990_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000246761.1|836976_837732_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000044843.1|837724_838402_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000042533.1|838980_841002_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_001295302.1|841193_842102_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_001340186.1|842498_843488_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_000084639.1|843509_844022_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_000080885.1|844024_844510_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000598619.1|844502_844748_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000852296.1|844749_845202_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000373624.1|845338_846043_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_046072808.1|846247_846961_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000045450.1|846996_847953_-	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000650337.1|847952_849194_-	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_001113348.1|849190_849952_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000871982.1|850084_850495_+	YbhQ family protein	NA	NA	NA	NA	NA
WP_000469031.1|850456_851563_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000070131.1|851573_852707_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000996107.1|852699_854436_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|854428_855424_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|855426_856098_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|856326_857691_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|857922_858405_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_001340191.1|858524_860675_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386551.1|860702_861665_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443530.1|861805_862891_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|863119_863380_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146347.1|863644_863911_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	1.5e-06
WP_000990177.1|863984_864662_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000483767.1|866759_868106_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011134	Escherichia coli VR50 chromosome, complete genome	5000386	1077576	1127554	5000386	terminase,tail,head,holin,portal,lysis,transposase,integrase	Enterobacteria_phage(36.67%)	68	1077118:1077132	1090561:1090575
1077118:1077132	attL	GCCATTTACGCGGCA	NA	NA	NA	NA
WP_000066490.1|1077576_1077789_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1077799_1077988_+	cold-shock protein	NA	NA	NA	NA	NA
WP_032149548.1|1077962_1078193_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1078182_1078356_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829662.1|1078404_1079478_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001300633.1|1079549_1082294_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_001554871.1|1082388_1083462_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	99.2	1.8e-199
WP_001303849.1|1083439_1083658_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001554873.1|1083743_1084367_-	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	87.4	4.0e-98
WP_046072812.1|1084708_1085245_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	44.7	8.6e-57
WP_023150379.1|1085246_1085882_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	55.9	4.0e-53
WP_021561777.1|1085878_1086424_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	57.5	7.6e-45
WP_023150376.1|1086595_1086892_-	DUF2856 family protein	NA	A0A220NRR0	Escherichia_phage	99.0	8.6e-51
WP_001016185.1|1086908_1087457_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	98.4	1.6e-103
WP_000098523.1|1087465_1087972_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
WP_000018646.1|1087968_1088436_-	HNH endonuclease	NA	A0A2I7QWC6	Vibrio_phage	62.0	1.2e-46
WP_046072814.1|1088436_1089144_-	recombinase	NA	K7PKU3	Enterobacteria_phage	98.7	6.1e-135
WP_001183771.1|1089398_1089569_-	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000167585.1|1089763_1090234_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_001077327.1|1090296_1090521_-	hypothetical protein	NA	K7PJZ1	Enterobacterial_phage	100.0	8.0e-33
WP_046072921.1|1090524_1090833_-	hypothetical protein	NA	A0A075B8K6	Enterobacteria_phage	67.6	2.3e-30
1090561:1090575	attR	TGCCGCGTAAATGGC	NA	NA	NA	NA
WP_014532159.1|1091186_1091882_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	97.0	2.0e-130
WP_000067727.1|1091957_1092173_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000438534.1|1092282_1092579_+	hypothetical protein	NA	G9L678	Escherichia_phage	98.0	2.0e-47
WP_000166207.1|1092611_1092758_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_024215533.1|1092750_1093611_+	replication protein	NA	K7PL20	Enterobacteria_phage	99.7	5.1e-160
WP_046072815.1|1093718_1095599_+	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	98.9	0.0e+00
WP_102384962.1|1095727_1096955_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_021561742.1|1097017_1097629_+	HNH endonuclease	NA	A0A2I6PIF0	Escherichia_phage	98.5	1.3e-109
WP_046072816.1|1097689_1097905_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	97.2	5.5e-31
WP_000184657.1|1097915_1098071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000814611.1|1098103_1098514_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_001254249.1|1098510_1098687_+	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.0e-27
WP_000386657.1|1098689_1099049_+	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.8	1.2e-62
WP_000950975.1|1099048_1099225_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	9.7e-26
WP_046072817.1|1099217_1099829_+	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	1.3e-98
WP_000144614.1|1099825_1100032_+	phage NinH family protein	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_046072818.1|1100009_1100681_+	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	97.3	8.6e-131
WP_001554889.1|1100671_1101190_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	2.0e-95
WP_000658763.1|1101384_1101897_+	HNH endonuclease	NA	K7PL52	Enterobacteria_phage	99.4	4.0e-96
WP_000286100.1|1102353_1102557_+|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001504512.1|1102534_1103032_+	lysozyme RrrD	NA	I6R0P2	Salmonella_phage	99.4	2.9e-91
WP_001385991.1|1103028_1103466_+|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	98.6	8.5e-71
WP_000839225.1|1103667_1104165_+	KilA-N domain-containing protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
WP_001283921.1|1104161_1104419_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000807788.1|1104771_1105014_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001554891.1|1105049_1105538_+	DNA-packaging protein	NA	G8EYI7	Enterobacteria_phage	99.4	3.1e-90
WP_001549451.1|1105515_1107012_+|terminase	terminase large subunit	terminase	A0A2D1GLW6	Escherichia_phage	93.8	8.2e-283
WP_001554892.1|1107011_1109213_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.9	0.0e+00
WP_001554893.1|1109303_1110200_+	hypothetical protein	NA	A0A088CPT0	Enterobacteria_phage	84.2	1.4e-112
WP_001554894.1|1110220_1111480_+	hypothetical protein	NA	A0A088CQ56	Enterobacteria_phage	66.1	6.3e-151
WP_000078363.1|1111520_1111709_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	87.1	7.4e-24
WP_001140511.1|1111689_1112151_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	99.3	2.1e-83
WP_001554896.1|1112160_1113579_+	packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	98.9	3.0e-274
WP_023150354.1|1113578_1114280_+	hypothetical protein	NA	A5VW68	Enterobacteria_phage	99.1	2.1e-119
WP_046072819.1|1114279_1114735_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	9.7e-86
WP_001529837.1|1114737_1115427_+	hypothetical protein	NA	A5VW66	Enterobacteria_phage	98.3	9.8e-114
WP_046072820.1|1115437_1116787_+	phage DNA ejection protein	NA	Q9AYZ0	Salmonella_phage	99.3	3.3e-246
WP_001029857.1|1116786_1118955_+	hypothetical protein	NA	Q9AYY9	Salmonella_phage	93.4	0.0e+00
WP_000895335.1|1118955_1119285_-	hypothetical protein	NA	Q9AYY8	Salmonella_phage	99.1	1.7e-52
WP_000136767.1|1119441_1120410_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	48.6	8.5e-71
WP_000170104.1|1120425_1120680_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000410309.1|1120789_1120942_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_023150345.1|1120938_1121160_+	hypothetical protein	NA	I6RSG6	Salmonella_phage	95.9	2.7e-33
WP_046072821.1|1121222_1122125_+	antirepressor	NA	Q0H8C7	Salmonella_phage	95.0	1.9e-165
WP_046072822.1|1122225_1125171_+|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	98.7	0.0e+00
WP_001264933.1|1125860_1126889_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120125.1|1126861_1127554_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
>prophage 5
NZ_CP011134	Escherichia coli VR50 chromosome, complete genome	5000386	1369606	1436157	5000386	terminase,tail,protease,head,holin,portal,capsid,integrase	Escherichia_phage(39.62%)	79	1362358:1362372	1390048:1390062
1362358:1362372	attL	CCCAGCAGCCAGCAG	NA	NA	NA	NA
WP_000113681.1|1369606_1370737_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1370714_1370963_-	excisionase	NA	NA	NA	NA	NA
WP_016238688.1|1371027_1373499_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090200.1|1373591_1373783_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449191.1|1373779_1373968_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000358769.1|1374539_1374818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394529.1|1374777_1375179_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_001171958.1|1375201_1375420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379612.1|1375579_1375735_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_000753626.1|1375988_1376450_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	99.3	7.6e-78
WP_001053425.1|1376557_1376833_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	97.6	1.1e-39
WP_000702041.1|1376816_1377242_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262415.1|1377313_1378354_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.8	1.0e-98
WP_001309414.1|1378265_1378808_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450702.1|1378841_1379612_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	6.7e-87
WP_001151161.1|1379627_1380053_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|1380227_1380893_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018428.1|1381073_1381286_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	3.1e-26
WP_001004956.1|1381451_1382102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|1382082_1383186_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000687431.1|1383343_1383517_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	68.5	6.8e-16
WP_001403449.1|1383576_1383849_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	1.0e-10
WP_001265091.1|1383850_1384897_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	4.5e-110
WP_001554974.1|1384909_1385269_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.8	3.5e-38
WP_001064895.1|1385265_1385955_+	antiterminator	NA	I6PDF8	Cronobacter_phage	45.1	1.1e-51
WP_001336255.1|1386026_1386866_+	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	40.2	1.8e-45
WP_000615423.1|1386862_1387606_+	protein phosphatase 2C domain-containing protein	NA	I6PCV8	Cronobacter_phage	43.1	1.6e-48
WP_077466990.1|1387716_1388043_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	96.8	2.0e-45
WP_000874518.1|1389317_1391171_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.2	0.0e+00
1390048:1390062	attR	CCCAGCAGCCAGCAG	NA	NA	NA	NA
WP_000284510.1|1391321_1391537_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193304.1|1391541_1391886_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_000369850.1|1391851_1392124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001554972.1|1392229_1392763_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	3.6e-100
WP_021566721.1|1392919_1393102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|1393116_1393248_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_071606003.1|1393470_1393656_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	90.2	7.3e-24
WP_000347013.1|1394068_1394209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|1394341_1394527_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_001102142.1|1394914_1395463_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.0	6.7e-57
WP_001348272.1|1395434_1397363_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_000259005.1|1397346_1397553_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_016238691.1|1397549_1399142_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	2.9e-185
WP_001253979.1|1399131_1400637_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_000256823.1|1400673_1401021_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|1401078_1402107_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201501.1|1402158_1402542_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_016239229.1|1402534_1402888_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_001571311.1|1402903_1403479_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.7e-50
WP_000683079.1|1403475_1403871_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235037.1|1403878_1404625_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_001299690.1|1404643_1405075_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533402.1|1405101_1405515_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000847298.1|1408065_1408395_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_016238696.1|1408394_1409093_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	95.3	7.8e-127
WP_001405642.1|1409103_1409847_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	5.6e-147
WP_137432919.1|1409792_1410425_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	3.2e-103
WP_046072828.1|1410768_1414242_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.3	0.0e+00
WP_001233154.1|1414309_1414909_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	4.5e-107
WP_000216487.1|1415060_1418087_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.5	7.0e-55
WP_000885577.1|1418086_1418671_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|1418725_1419394_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1419450_1419720_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1419834_1420005_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079505.1|1420493_1421000_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056490.1|1421045_1421546_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1421631_1421811_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1422191_1422998_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1422997_1424191_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_077787712.1|1424202_1425564_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763511.1|1425564_1427160_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194582.1|1427159_1428722_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1428813_1428858_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1428995_1429877_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001335990.1|1429873_1430494_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001326916.1|1430521_1432417_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|1432627_1433503_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|1433542_1434133_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559286.1|1434129_1434888_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|1435107_1436157_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP011134	Escherichia coli VR50 chromosome, complete genome	5000386	2277592	2387123	5000386	terminase,tail,head,holin,portal,capsid,lysis,tRNA	Escherichia_phage(40.62%)	109	NA	NA
WP_000476011.1|2277592_2278954_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001318299.1|2279284_2279602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807356.1|2280007_2280907_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_000178552.1|2280988_2281768_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|2281867_2282908_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|2282955_2284311_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823270.1|2284314_2284599_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|2284629_2285082_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853883.1|2285091_2286354_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001307281.1|2286382_2287237_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2287544_2288597_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|2288853_2290131_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000846217.1|2290127_2291132_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000012001.1|2291128_2292094_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|2292067_2292814_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351783.1|2292865_2293684_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822274.1|2293748_2294549_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195564.1|2294545_2295334_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2295556_2295829_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134636.1|2295949_2296774_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000405713.1|2297412_2298447_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945447.1|2298462_2300943_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677393.1|2300958_2301633_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830456.1|2301712_2302255_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|2302547_2302829_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2303091_2304201_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001300883.1|2304332_2306366_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
WP_001215617.1|2306506_2310301_+	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_021561853.1|2310310_2313943_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636925.1|2314003_2314321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300974.1|2314627_2315716_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294387.1|2315726_2318006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333512.1|2317998_2319135_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001375261.1|2319131_2321132_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2321256_2321718_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2321757_2322228_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2322274_2322994_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2322990_2324676_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001261928.1|2325190_2325439_+	DinI-like family protein	NA	H6WZN4	Escherichia_phage	84.0	1.8e-30
WP_000355615.1|2325556_2325853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204578.1|2325862_2326141_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	47.3	2.3e-21
WP_016248048.1|2326137_2328201_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	65.7	4.2e-152
WP_046072852.1|2328265_2328865_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.0	1.6e-104
WP_046072853.1|2328932_2332625_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_148425920.1|2332968_2333601_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.1	4.6e-102
WP_000194723.1|2333546_2334290_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_046072855.1|2334300_2334999_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	7.6e-130
WP_000847298.1|2334998_2335328_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_046072856.1|2335324_2337898_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000533402.1|2337878_2338292_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479094.1|2338318_2338750_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	78.1	3.7e-42
WP_000235117.1|2338763_2339516_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.0e-132
WP_000683080.1|2339523_2339919_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	4.4e-58
WP_000974980.1|2339915_2340449_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|2340464_2340818_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|2340810_2341194_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|2341245_2342274_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|2342331_2342679_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_046072857.1|2342715_2344221_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	1.8e-99
WP_032199004.1|2344210_2345803_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	2.9e-185
WP_000259002.1|2345799_2346006_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_046072858.1|2345989_2347918_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.0e-261
WP_001405844.1|2347889_2348396_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	48.5	1.6e-33
WP_001329960.1|2348831_2349017_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|2349149_2349290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001028465.1|2349998_2350520_-	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_001082564.1|2350721_2351159_-|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	95.2	2.3e-68
WP_000992062.1|2351457_2351991_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	8.1e-100
WP_046072927.1|2352054_2352405_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	87.7	2.5e-49
WP_000284510.1|2352409_2352625_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001405839.1|2352700_2352970_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	76.4	1.8e-10
WP_001405838.1|2353007_2353190_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	91.5	9.4e-24
WP_000737268.1|2356875_2357958_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.9	2.4e-167
WP_001204776.1|2358145_2358529_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_001258396.1|2358528_2359386_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	91.2	1.2e-148
WP_000844628.1|2359385_2360354_-	toprim domain-containing protein	NA	A0A1B5FPA8	Escherichia_phage	99.7	1.9e-187
WP_000424041.1|2360355_2362014_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	96.0	0.0e+00
WP_000402986.1|2363205_2363661_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000930865.1|2363773_2364217_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	45.6	3.6e-08
WP_000781553.1|2364218_2364410_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	98.4	1.7e-28
WP_000632554.1|2364406_2364598_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	95.2	8.6e-28
WP_000148631.1|2364782_2365142_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	77.3	8.0e-43
WP_000002323.1|2365141_2365357_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	62.0	5.0e-16
WP_000566776.1|2365543_2365936_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	56.4	4.4e-34
WP_000734576.1|2366181_2367009_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.8	9.0e-130
WP_001028556.1|2367052_2367802_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	83.1	1.3e-116
WP_000586690.1|2367798_2368368_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	3.0e-28
WP_000687969.1|2368364_2368598_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	62.0	4.1e-16
WP_000014163.1|2368584_2368950_+	ead/Ea22-like family protein	NA	G9L663	Escherichia_phage	58.2	9.4e-15
WP_000108289.1|2369176_2369554_+	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	86.0	6.9e-45
WP_000457739.1|2369638_2369881_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	90.0	8.6e-33
WP_001030155.1|2369884_2370019_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.2	5.4e-21
WP_001193437.1|2370037_2370292_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000073302.1|2370325_2371612_+	DUF3596 domain-containing protein	NA	H6WZF6	Escherichia_phage	98.6	2.1e-250
WP_042101647.1|2371647_2372334_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
WP_001216963.1|2372393_2372501_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2372481_2373213_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569315.1|2373217_2374144_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000220837.1|2374136_2375294_-	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_001130308.1|2375300_2376218_-	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000871504.1|2376428_2378726_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_000097403.1|2378921_2380637_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001319943.1|2380674_2381607_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_001295454.1|2381780_2382368_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_001296821.1|2382537_2383116_+	DedA family protein	NA	NA	NA	NA	NA
WP_046072859.1|2383245_2384007_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001078139.1|2384059_2385496_-	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000691708.1|2385719_2385803_+	protein YohP	NA	NA	NA	NA	NA
WP_001264861.1|2386175_2387123_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP011134	Escherichia coli VR50 chromosome, complete genome	5000386	2769064	2814967	5000386	holin,integrase,tail,terminase	Escherichia_phage(44.44%)	59	2770901:2770917	2811853:2811869
WP_000017552.1|2769064_2769217_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|2769234_2769426_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|2769736_2770255_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_046072870.1|2770270_2770810_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	94.4	6.9e-38
2770901:2770917	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_046072871.1|2771027_2771510_-	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	91.9	4.5e-73
WP_046072872.1|2771506_2772136_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	95.2	3.5e-110
WP_046072873.1|2772125_2772434_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	7.8e-47
WP_001276090.1|2772420_2772825_-	membrane protein	NA	G9L6E6	Escherichia_phage	94.8	7.4e-61
WP_046072874.1|2773131_2776251_-|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	95.4	0.0e+00
WP_024220803.1|2776446_2776704_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	98.8	4.9e-42
WP_000451763.1|2776726_2777455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110221350.1|2777718_2777805_+	ash family protein	NA	NA	NA	NA	NA
WP_046072875.1|2777850_2778543_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	80.2	2.9e-97
WP_000125783.1|2778643_2778811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000671199.1|2778831_2779272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000559990.1|2779376_2779517_-	hypothetical protein	NA	A0A0F6R7N3	Escherichia_coli_O157_typing_phage	97.8	5.2e-14
WP_046072876.1|2779526_2782001_-	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.0	0.0e+00
WP_046072877.1|2782006_2783809_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	98.3	0.0e+00
WP_046072878.1|2783805_2786319_-	bacteriophage protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	93.9	0.0e+00
WP_000332878.1|2786318_2786864_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
WP_033813655.1|2786863_2787328_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
WP_033813654.1|2787327_2789799_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.0	0.0e+00
WP_033813653.1|2789798_2790404_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	2.3e-111
WP_000424495.1|2790403_2790727_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_033813652.1|2790777_2791113_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	1.7e-55
WP_033813651.1|2791123_2791561_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.2	8.5e-71
WP_033813650.1|2791612_2792599_-	phage protein	NA	A0A0F6TJQ9	Escherichia_coli_O157_typing_phage	99.4	1.2e-186
WP_033813649.1|2792613_2793309_-	peptidase	NA	G9L6C4	Escherichia_phage	97.0	1.4e-91
WP_000133160.1|2793311_2793608_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_033813648.1|2793604_2795284_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	98.7	6.8e-302
WP_000335899.1|2795298_2795505_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_033813647.1|2796207_2796627_+	hypothetical protein	NA	A0A2H4ZJ80	Enterobacter_phage	82.0	7.5e-16
WP_033813646.1|2796717_2798193_-	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.0	4.2e-295
WP_033813645.1|2798189_2798864_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.1	7.6e-119
WP_001129685.1|2798904_2799243_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	2.9e-58
WP_023908375.1|2799235_2799517_-	ASCH domain-containing protein	NA	A0A077SLL0	Escherichia_phage	96.7	1.2e-46
WP_077775469.1|2799509_2800247_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	72.2	1.8e-57
WP_000224220.1|2800257_2800521_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_046072879.1|2800522_2801026_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	83.5	2.3e-43
WP_033813642.1|2801022_2801823_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	72.4	6.0e-38
WP_000738196.1|2801831_2802242_-	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	72.8	1.5e-29
WP_046072880.1|2802238_2802871_-	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	66.7	2.7e-62
WP_001231258.1|2802932_2803280_-	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	2.0e-59
WP_001066741.1|2803397_2804183_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
WP_000086414.1|2804179_2804995_-	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
WP_000402893.1|2805010_2805211_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
WP_001282459.1|2805361_2805592_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|2805746_2806331_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001198620.1|2806484_2806637_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_033813640.1|2806639_2806939_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	9.9e-47
WP_000985082.1|2806935_2807835_+	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	90.6	1.6e-156
WP_033813639.1|2807844_2808867_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	92.6	7.8e-176
WP_000675390.1|2808916_2809165_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001335975.1|2809322_2809574_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_033813638.1|2809566_2810217_+	adenine methylase	NA	G9L699	Escherichia_phage	97.7	6.2e-126
WP_001077944.1|2810213_2810408_+	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	98.4	9.7e-27
WP_001567237.1|2810411_2811662_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	3.6e-239
WP_000138270.1|2811854_2813432_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2811853:2811869	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001299507.1|2813500_2814967_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 8
NZ_CP011134	Escherichia coli VR50 chromosome, complete genome	5000386	3017296	3030165	5000386		Escherichia_phage(44.44%)	11	NA	NA
WP_001272928.1|3017296_3019858_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141322.1|3019963_3020620_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3020670_3021438_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000590403.1|3022224_3023487_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|3023483_3024122_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3024126_3024903_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|3024991_3026356_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3026449_3027442_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3027504_3028644_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3028783_3029410_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3029403_3030165_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 9
NZ_CP011134	Escherichia coli VR50 chromosome, complete genome	5000386	3256852	3311655	5000386	integrase,protease,tRNA,transposase	Enterobacteria_phage(50.0%)	51	3274110:3274125	3307073:3307088
WP_001336269.1|3256852_3257611_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_001169551.1|3257666_3258410_-	2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_046072887.1|3258396_3259506_-	D-glucosaminate-6-phosphate ammonia lyase	NA	NA	NA	NA	NA
WP_160371798.1|3259509_3260370_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_000380262.1|3260366_3261116_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001284302.1|3261141_3261627_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_000214202.1|3261637_3262066_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001405772.1|3262184_3264710_-	transcriptional regulator DagR	NA	NA	NA	NA	NA
WP_046072933.1|3264760_3264982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105566.1|3265239_3266160_-	agmatinase	NA	NA	NA	NA	NA
WP_000758894.1|3266295_3267027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3267172_3269149_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3269157_3269289_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3269424_3269640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3269943_3271098_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3271533_3272928_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3273004_3273502_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3273596_3274304_+	deoxyribonuclease I	NA	NA	NA	NA	NA
3274110:3274125	attL	ATTGCGCGCACCTACT	NA	NA	NA	NA
WP_001300912.1|3274383_3275115_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3275127_3276078_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3276186_3276750_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3276749_3277166_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055632.1|3277378_3278359_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3278376_3279081_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3279098_3279665_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3279661_3279952_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174738.1|3279959_3280553_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239986.1|3280545_3281682_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|3281994_3282981_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000394132.1|3284369_3285416_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984791.1|3285591_3286311_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107566.1|3286547_3286874_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3286873_3287593_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001309725.1|3287753_3288806_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3288833_3289109_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001336290.1|3289173_3290253_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3290454_3291711_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839808.1|3291756_3293892_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234490.1|3294290_3294998_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001522333.1|3295355_3296534_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	52.8	1.3e-121
WP_187415415.1|3297747_3300432_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.3	9.7e-258
WP_113328817.1|3300612_3301644_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_046072888.1|3302906_3303389_-	Dr family adhesin structural subunit	NA	NA	NA	NA	NA
WP_000527471.1|3303590_3303764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522328.1|3304142_3304586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522324.1|3304601_3307184_-	AfaC-I/III family usher protein	NA	NA	NA	NA	NA
3307073:3307088	attR	AGTAGGTGCGCGCAAT	NA	NA	NA	NA
WP_001522323.1|3307223_3308021_-	Dr fimbrial biogenesis chaperone DraB	NA	NA	NA	NA	NA
WP_001522322.1|3308323_3308629_-	AFA-III adhesin operon transcriptional regulator AfaA	NA	NA	NA	NA	NA
WP_001522321.1|3309430_3309688_+	Dr hemagglutinin AFA-III operon transcriptional regulator AfaF	NA	NA	NA	NA	NA
WP_001522318.1|3310126_3310369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193376830.1|3310442_3311655_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
>prophage 10
NZ_CP011134	Escherichia coli VR50 chromosome, complete genome	5000386	3326726	3388816	5000386	lysis,integrase,protease,transposase	Enterobacteria_phage(45.45%)	43	3323095:3323110	3380744:3380759
3323095:3323110	attL	GCTGCCGGTACATCCG	NA	NA	NA	NA
WP_139371347.1|3326726_3327939_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001522292.1|3329156_3330311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046072891.1|3330394_3331267_+	GTPase family protein	NA	NA	NA	NA	NA
WP_046072892.1|3331598_3334721_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001522287.1|3335037_3335856_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	5.2e-45
WP_001522285.1|3335855_3336032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001522284.1|3336126_3336600_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	1.9e-12
WP_001186724.1|3336614_3337091_+	RadC family protein	NA	NA	NA	NA	NA
WP_001522281.1|3337271_3338771_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_001522280.1|3338767_3339523_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.1	2.4e-33
WP_023909484.1|3339574_3339796_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	47.8	2.7e-09
WP_001522275.1|3339875_3340250_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_023909482.1|3340296_3340671_+	toxin	NA	NA	NA	NA	NA
WP_001522269.1|3340667_3341159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001522268.1|3341170_3341368_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001522267.1|3341452_3342319_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001143297.1|3342390_3342654_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001522265.1|3342650_3342977_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001218878.1|3343440_3344706_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.8	1.3e-76
WP_000147018.1|3344961_3346005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447126.1|3347565_3348117_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000597754.1|3350573_3351140_-	P fimbria major subunit PapA	NA	NA	NA	NA	NA
WP_000006214.1|3352065_3352299_+	major pilus subunit operon transcriptional regulator PapI	NA	NA	NA	NA	NA
WP_001513409.1|3354166_3354280_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|3356113_3356374_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109148.1|3356415_3356976_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|3357015_3357444_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_105955809.1|3358152_3359380_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	2.5e-168
WP_001223354.1|3359880_3361971_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001363144.1|3362832_3363075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000751583.1|3363162_3363354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405924.1|3363365_3363734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266541.1|3363737_3363953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139371347.1|3369766_3370979_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001034084.1|3371277_3375165_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	38.9	1.2e-227
WP_011076574.1|3375415_3375559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973519.1|3376109_3378311_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|3378392_3379670_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|3379666_3381409_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
3380744:3380759	attR	CGGATGTACCGGCAGC	NA	NA	NA	NA
WP_001287501.1|3381408_3382356_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|3382356_3384081_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074484.1|3384216_3385410_+	MFS transporter	NA	NA	NA	NA	NA
WP_172685630.1|3387602_3388816_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	6.5e-169
>prophage 11
NZ_CP011134	Escherichia coli VR50 chromosome, complete genome	5000386	3638667	3699833	5000386	protease,transposase	Staphylococcus_phage(11.11%)	60	NA	NA
WP_001107467.1|3638667_3640602_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000145975.1|3640701_3641331_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_001054420.1|3641456_3641750_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_001148001.1|3641905_3642382_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_001212619.1|3642629_3644063_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_000673575.1|3644248_3645421_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_000813037.1|3645436_3646402_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000940595.1|3646528_3646786_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_000271401.1|3646806_3647118_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_001047336.1|3647376_3648348_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|3648575_3648854_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_000357259.1|3648901_3650161_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000429656.1|3650215_3650470_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_000004488.1|3650629_3650923_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_000476487.1|3650922_3651558_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_001296448.1|3651576_3652128_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_000925795.1|3652132_3652915_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_000438245.1|3652922_3653732_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|3653941_3654919_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|3654932_3655919_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|3655939_3656506_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|3656502_3657078_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|3657046_3657604_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|3657610_3658336_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|3658383_3659817_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|3659839_3660127_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|3660244_3660736_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|3660781_3661636_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|3661632_3661905_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|3662118_3662751_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|3662747_3663476_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|3663472_3664126_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|3664355_3666692_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|3666787_3667717_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_001300352.1|3668391_3672852_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_000081674.1|3672864_3674283_+	glutamate synthase subunit GltD	NA	NA	NA	NA	NA
WP_000465371.1|3674842_3675607_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_001311157.1|3675778_3676453_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_193376831.1|3677746_3678959_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
WP_102384962.1|3679240_3680468_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_001405708.1|3680453_3681503_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_000821351.1|3681499_3682045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067008.1|3682041_3682758_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_000445116.1|3682942_3684070_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979882.1|3684129_3684594_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209011.1|3684590_3685466_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|3685462_3686152_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|3686199_3687690_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000224714.1|3687798_3688692_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000523845.1|3688813_3689605_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000467018.1|3689984_3691352_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000366129.1|3691394_3691892_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000257293.1|3691897_3692536_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|3692930_3693323_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|3693338_3693767_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001192332.1|3693985_3695113_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|3695306_3695705_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001295271.1|3695858_3697226_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|3697315_3698383_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_000483767.1|3698486_3699833_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP011134	Escherichia coli VR50 chromosome, complete genome	5000386	4163429	4173822	5000386	integrase	Enterobacteria_phage(100.0%)	12	4163244:4163269	4174296:4174321
4163244:4163269	attL	TTCGACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218975.1|4163429_4164611_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.7	4.3e-210
WP_000334847.1|4164746_4166183_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000342408.1|4166191_4167118_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001673082.1|4167321_4167894_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	98.9	3.1e-97
WP_000984202.1|4167908_4168154_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
WP_001283018.1|4168150_4168885_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	3.6e-130
WP_001149160.1|4169436_4169703_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980247.1|4169699_4170290_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	98.5	8.2e-69
WP_001673085.1|4170282_4170570_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	1.5e-47
WP_001673086.1|4170562_4171018_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	1.4e-63
WP_000856729.1|4171153_4171474_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001673087.1|4171488_4173822_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
4174296:4174321	attR	TTCGACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 13
NZ_CP011134	Escherichia coli VR50 chromosome, complete genome	5000386	4820831	4879291	5000386	holin,protease,tRNA,transposase	Vibrio_phage(16.67%)	47	NA	NA
WP_001162171.1|4820831_4822184_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232251.1|4822366_4822753_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106233.1|4822797_4823262_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187773.1|4823420_4825559_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	1.1e-264
WP_001336303.1|4825952_4827608_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001405502.1|4827657_4829079_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181307.1|4829197_4830145_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_001387276.1|4830329_4830383_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471897.1|4830523_4833220_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	2.4e-46
WP_000047538.1|4833425_4833812_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4833884_4834346_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4834358_4835294_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|4835297_4835432_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230274.1|4835712_4836108_-	RidA family protein	NA	NA	NA	NA	NA
WP_046072914.1|4836238_4836952_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256663.1|4837022_4837616_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336307.1|4837760_4838213_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_000036440.1|4838335_4839988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012917.1|4840060_4841065_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4841226_4841643_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059397.1|4841688_4842192_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046072915.1|4842384_4843581_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416426.1|4843636_4846492_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_000786393.1|4846491_4846935_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4847288_4848800_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_046072916.1|4849066_4850167_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4850166_4851249_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_046072917.1|4851409_4852912_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
WP_001309159.1|4852989_4853988_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128347.1|4854054_4855374_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|4855436_4856201_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197411.1|4856224_4857256_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|4857472_4858036_+	gluconokinase	NA	NA	NA	NA	NA
WP_001318460.1|4858039_4859059_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_000483767.1|4863616_4864963_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179691.1|4865571_4866789_+	MFS transporter	NA	NA	NA	NA	NA
WP_000611568.1|4866800_4867919_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000594405.1|4867961_4868087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254999.1|4868139_4868397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113772487.1|4868710_4869877_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	5.8e-183
WP_000625671.1|4869812_4870226_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|4870288_4872286_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_139371347.1|4873581_4874795_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000531571.1|4874820_4875876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000397910.1|4876373_4876538_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_046072918.1|4876714_4878127_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000181202.1|4878370_4879291_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.6e-61
>prophage 1
NZ_CP011136	Escherichia coli VR50 plasmid pVR50B, complete sequence	97864	2634	70255	97864	integrase,transposase	Enterobacteria_phage(38.89%)	56	678:737	43162:45064
678:737	attL	TGTCAGCGCCAGTGATATAAGACGGTAATTCACCATTTGGATTGTCCGCTCCACCCAACA	NA	NA	NA	NA
WP_193376833.1|2634_3844_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	3.3e-165
WP_000977394.1|4847_5639_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001298664.1|5645_7616_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_106378881.1|7897_9125_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.9e-168
WP_001072359.1|10023_11193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001332784.1|11554_11743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066935.1|11863_12604_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361610.1|12888_13866_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_139371347.1|14783_15996_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_139371347.1|16843_18056_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_046072950.1|19605_20787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280972.1|20922_21777_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000993248.1|21789_22308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001696651.1|22354_23578_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001442123.1|23654_24566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000549075.1|24562_25561_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001233385.1|26905_27877_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.9	1.5e-112
WP_001442122.1|27873_29079_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.2	9.5e-205
WP_000504263.1|29699_30431_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	32.2	1.8e-25
WP_000016968.1|31110_31917_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.4	3.7e-56
WP_001159871.1|31917_32223_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813630.1|32224_32443_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001554929.1|33037_33307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001554928.1|33294_33891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001554927.1|33908_34256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001554926.1|34366_34714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744815.1|35369_35558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001673230.1|35685_36801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200414.1|37073_37757_+	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_001554923.1|37756_39481_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	34.6	1.6e-19
WP_000673985.1|40258_40645_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	50.4	2.5e-26
WP_000493532.1|40641_40866_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	43.2	1.1e-05
WP_001554960.1|41150_41948_-	IS21-like element IS21 family helper ATPase IstB	NA	U5N3V8	Enterobacteria_phage	99.2	5.6e-145
WP_024192676.1|43532_43742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023144239.1|44284_44632_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001529697.1|44792_46451_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
43162:45064	attR	TGTTGGGTGGAGCGGACAATCCAAATGGTGAATTACCGTCTTATATCACTGGCGCTGACAAACAGGGATATTGCGACAATTCACAGCAATATCGTGCAGGAATACAACACCCTTAAAGGGTATAGCTGGAAATGGCTGGGTGGGGTGTCAGTGGCTTTTCTGGTTATGTTCTGTGTGCTCGGATGGGGAATGAAAACAATACTCGACAGGAACTACAACGCCACAGCGGCGGTGTATCAGAAAGTTGTGACACTGGAAGATAAACTGGTGGAGAAACCTGTCACGGGGAAGAGCCGGAAAAACTGACGCGCTTCGCTTGTCCAACGCCTCACGACCCGCGAAAGAATTTCGCGAACCGTTCACCGTTTTTTTCAATATGATTCTGTCTGCTTTGGTCGATAAAGCAGACGATAGTATTCCAGCCTTCGTATATATAACGGTACGTGCTCATCAGTAAGAGCTGGCGGTATTGTGTTATCAGGGGGAAGTTTTTTCAGATACTCACGAAATGCCTGGCTTGATGCCATAAAATCTACAGCTGCATCGATAATATGTGGGATATTTTCATCTAATTTTGTCATGATGATTGATCTGATATTATCACGGTTCGTGAATTATAGTATGTCACTATTATTTATGCTTTAGTGAACCAGAAAAAATCCCCCGTTGGTATAGGGGGATATGTAAGGAGAAATAACTTCGCAGGTGTTCTTGTTTGTATTATAACGTGAAAAGAATGCACGCAACTTAATTAATCTGCCGTACTTCCTTTCAGTTTTCAAGATAAGGTTTATAATAAAACATGGAATGGAAGCAAGCTTTAAGGTTTCAGCTCTAAAATTTTTAATATCTATTAACTAGCTAGTTGTTGTCCTTGTGAGCATGTTGTATATAAAAGCTAGGATAATATCCTGACCGGAGTATTCATATTCCTTATCCCCTCTGTGTTCTCAGAGGTTTTTTTCTGTATTTAATGATATGAGCTGGAATGCGATTCCGGCCCCCCCCGTTTACATAATTCTCCCTGACATACGGCACCGGAATCGCATTGATTTTGCATTGCTAATGTCTAACTGTGCTGGTGAATGTTGGGGGCAGTTTGGATATCGAAAATTATTGTACGTTAAGGTTGTTTTTTGACCTTGTCGGGGTCCGCCTGCGGGCAGTAGAGATCATATAAGGTATTCAATAACGTCATGATGCGGTTATCCCCGATACGGTAATATACCATTTTACCTGCCCGTCGGGTCTCGACCAGCTTCAGGCGACGCATGACACCCAACTGCTGAGACAGGGTCGGCTGAGTGATACCGACCGCCGCTTCCAGCTCGGTCACATTCGCTTCCCCCTGGCTTAACTGACACATCAACAATAGCCGGTCGCTGTTGGCCAGTCCCCGTAGGACATCTGCTGCCCCCAGGGCTGCATTTTTCATATCAGTCTGACGTTTTGTGTCTTCATTCATGGGCATTGCTGGTTTCTTATATTATGTATTTTTATATAATATTGTTCAGTATAATGATAGTGGCGTAATTTTGCCACCGTGATCTTCAGGTCTGCAGCGTCCAGCTGGACCGGGTAACTAATTATATATGGCAGATATTTTGCCCCGAGTGAACAGAGAGGATGTAATGAAAATAGTGATTGTTGGTGGTGTTGCCGGGGGAGCATCCGCTGCAGCCAGGGCTCGTCGGTTATCAGAGGATGTCAGTATTGTTGTGTTTGAGCGGGGAAGCGATGTCTCTTTCGCCAACTGTGGATTGCCTTATCATATAGGCGGAAAAATTCCGTTACGGCAGTCGCTGATTCTGAAAACCCCGGAGGATTTTAAATCCCGTTTTAACATAGACGTCCGTATCCGTCATGAAGTGATGTCAGTAGACCCGGTTAATAAGATGGTGAC	NA	NA	NA	NA
WP_046072951.1|47209_47566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001523032.1|47762_48566_+	replication initiation protein	NA	NA	NA	NA	NA
WP_001224623.1|48898_49774_+	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_000981091.1|49781_50558_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_001100763.1|50726_52988_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001020413.1|53056_54232_+	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_136952279.1|55085_56298_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	100.0	2.2e-169
WP_046072954.1|56319_56871_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	43.5	5.2e-25
WP_000874189.1|58854_59340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001554949.1|59364_59850_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|59836_60532_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001554947.1|60536_61667_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|61656_62940_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|62942_64322_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|64425_64953_-	iron transporter	NA	NA	NA	NA	NA
WP_123009678.1|64993_66880_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|67226_68042_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949451.1|68224_68731_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_077633307.1|68720_68948_-	DsbA family protein	NA	NA	NA	NA	NA
WP_001067855.1|69550_70255_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
