The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_HF571988	Yersinia enterocolitica (type O:5) str. YE53/03 isolate host faecal sample	4940199	401855	408521	4940199		Escherichia_phage(50.0%)	11	NA	NA
WP_004704739.1|401855_402464_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	39.8	1.7e-13
WP_004391853.1|402772_402982_+	CsbD family protein	NA	NA	NA	NA	NA
WP_046051957.1|403266_403776_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_046050059.1|404208_404466_-	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	55.4	2.6e-19
WP_046050060.1|404524_404839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050298924.1|404980_405547_-	hypothetical protein	NA	A0A0U4KRZ0	Arthrobacter_phage	62.5	3.6e-05
WP_050146095.1|405543_405840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052705587.1|405836_406499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046050061.1|406671_407202_-	hypothetical protein	NA	A0A291AX04	Escherichia_phage	58.7	2.4e-51
WP_046050062.1|407295_408117_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	60.0	9.3e-87
WP_046050063.1|408164_408521_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	67.8	7.0e-39
>prophage 2
NZ_HF571988	Yersinia enterocolitica (type O:5) str. YE53/03 isolate host faecal sample	4940199	411664	481234	4940199	head,integrase,tail,protease,terminase,tRNA,portal,capsid,plate	Morganella_phage(15.0%)	78	438032:438046	480484:480498
WP_046050067.1|411664_411922_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	55.0	8.1e-13
WP_046050068.1|411950_412478_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	29.0	6.3e-12
WP_046051962.1|412669_412852_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	56.7	5.3e-11
WP_052705588.1|412848_413865_+	helix-turn-helix domain-containing protein	NA	A0A1V0E8B1	Vibrio_phage	44.8	1.5e-14
WP_046050069.1|413861_414983_+	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	46.3	6.3e-86
WP_032908960.1|414979_415234_+	hypothetical protein	NA	M9NZE6	Enterobacteria_phage	65.1	9.7e-19
WP_046050070.1|415230_415614_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	64.2	2.5e-42
WP_046050071.1|415716_416415_+	phage antirepressor KilAC domain-containing protein	NA	A0A059VF66	Pseudomonas_phage	61.1	7.2e-64
WP_046050072.1|416411_417413_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	49.7	2.1e-93
WP_046050073.1|417489_418308_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	37.4	1.8e-50
WP_046050074.1|418735_418945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050075.1|418959_419871_+|protease	serine protease	protease	NA	NA	NA	NA
WP_046050076.1|420044_420362_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	60.2	1.2e-26
WP_046050077.1|420345_420852_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.0	3.1e-48
WP_046050078.1|420836_421172_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_046050079.1|421425_421767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050080.1|421855_422500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157881593.1|422567_422987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050082.1|423338_423905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050083.1|423846_425955_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	36.5	3.0e-97
WP_046050084.1|425963_426227_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_046050085.1|426295_427879_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.8	1.7e-97
WP_046050086.1|427875_428733_+	S49 family peptidase	NA	K7P7A7	Enterobacteria_phage	41.0	4.6e-52
WP_046050087.1|428732_429320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050088.1|429319_429721_+|head	head decoration protein	head	NA	NA	NA	NA
WP_046050089.1|429830_430877_+|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	30.0	2.4e-39
WP_046050090.1|430878_431364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050091.1|431363_431708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050092.1|431704_432250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050093.1|432255_432447_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_046050094.1|432446_433937_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.0	7.6e-103
WP_046050095.1|433949_434324_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_046050096.1|434325_434628_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_046050097.1|434745_436548_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	51.7	4.5e-25
WP_145530433.1|436616_437054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050099.1|437201_438608_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	27.4	7.3e-23
438032:438046	attL	TGCTGCCACCGATGC	NA	NA	NA	NA
WP_046050100.1|438604_439678_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.6	2.0e-41
WP_046050101.1|439674_440268_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_046050102.1|440264_440702_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	41.7	5.8e-19
WP_046050103.1|440705_441842_+|plate	baseplate J/gp47 family protein	plate	B6SBU6	Clostridium_virus	26.0	6.8e-11
WP_046050104.1|441838_442435_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	37.2	1.3e-32
WP_046050105.1|442485_443328_+|tail	tail fiber protein	tail	Q7Y3Z0	Yersinia_phage	30.2	2.3e-16
WP_046050106.1|443330_443705_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	40.5	5.3e-05
WP_046050107.1|443739_444162_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.3	3.5e-13
WP_046050109.1|444646_445219_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	72.4	2.2e-66
WP_046050110.1|445293_445554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050089897.1|445882_446449_+	SocA family protein	NA	NA	NA	NA	NA
WP_046050111.1|446864_447944_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	70.0	3.6e-147
WP_046050112.1|448033_449080_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005165239.1|449286_449505_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_046050113.1|449845_450172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046050114.1|450384_451368_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005165232.1|451552_452959_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.7	7.4e-193
WP_046050115.1|452988_454068_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.3	8.9e-29
WP_046050116.1|454125_455319_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_019082203.1|455636_455990_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_046050117.1|456048_458880_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.3e-308
WP_019080106.1|459283_459835_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	88.5	1.5e-56
WP_019080105.1|460030_460702_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_019080104.1|461062_462430_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	74.1	4.1e-164
WP_019080103.1|462644_464294_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_019080102.1|464309_465227_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019080101.1|465355_465781_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_046050118.1|465773_466460_+	LrgB family protein	NA	NA	NA	NA	NA
WP_172654773.1|466530_467256_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	1.5e-19
WP_019080100.1|467300_468410_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_020424093.1|468419_469598_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019080098.1|469660_470686_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	36.9	5.6e-65
WP_046050119.1|471106_472645_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_019080096.1|472717_473638_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	8.0e-79
WP_026017912.1|473996_475409_-	anion permease	NA	NA	NA	NA	NA
WP_005163087.1|475999_476212_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.4e-25
WP_019080092.1|476483_476696_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	81.4	3.4e-25
WP_005163090.1|476967_477180_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	1.7e-24
WP_019080091.1|477560_478031_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_046050120.1|478316_479876_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.4	2.1e-18
WP_002210061.1|479947_480244_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_019080089.1|480268_481234_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
480484:480498	attR	GCATCGGTGGCAGCA	NA	NA	NA	NA
>prophage 3
NZ_HF571988	Yersinia enterocolitica (type O:5) str. YE53/03 isolate host faecal sample	4940199	501980	543583	4940199	integrase,head,tail,holin,protease,terminase,portal,capsid,plate	Cronobacter_phage(75.0%)	47	500234:500249	542666:542681
500234:500249	attL	CAAGCGGCATTGCAGG	NA	NA	NA	NA
WP_046050126.1|501980_503426_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_019080077.1|503479_504391_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_005174323.1|504703_504907_+	AaeX family protein	NA	NA	NA	NA	NA
WP_005174322.1|504914_505850_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_019082213.1|505851_507807_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_046050127.1|508007_509501_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_046050128.1|509598_510072_+	ribonuclease	NA	NA	NA	NA	NA
WP_019082215.1|510076_510343_+	barstar family protein	NA	NA	NA	NA	NA
WP_005174310.1|510395_510941_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_046050129.1|511078_512071_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	60.4	7.3e-110
WP_046050130.1|512146_512446_-	helix-turn-helix transcriptional regulator	NA	Q1JS31	Enterobacteria_phage	66.7	5.9e-31
WP_157881594.1|512555_512888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157881595.1|513016_513412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050133.1|513417_513708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046050134.1|513850_514072_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_046050135.1|514086_514443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050136.1|514515_514782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050137.1|514781_515597_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	55.8	4.8e-75
WP_071387001.1|515952_518358_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	50.6	5.5e-204
WP_049525352.1|518403_518664_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	64.3	1.3e-26
WP_046050140.1|518714_519740_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	66.6	2.9e-138
WP_046050141.1|519736_521524_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	66.2	4.1e-236
WP_046050142.1|521693_522554_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	46.2	2.2e-54
WP_046050143.1|522619_523651_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	76.7	4.2e-145
WP_046050144.1|523660_524359_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.4	2.2e-65
WP_072087891.1|524454_524907_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	56.0	1.4e-39
WP_046050146.1|524903_525395_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	45.1	5.5e-34
WP_046050147.1|525391_526093_+	phage virion morphogenesis protein	NA	F1BUL6	Cronobacter_phage	71.7	1.8e-91
WP_046050148.1|526095_527235_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	66.5	1.2e-137
WP_046050149.1|527231_527687_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	61.6	2.6e-46
WP_046050150.1|527696_527987_+|holin	phage holin family protein	holin	S4TP56	Salmonella_phage	55.1	4.7e-17
WP_046050151.1|527983_528325_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	84.2	4.8e-45
WP_046050152.1|528324_528666_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	43.0	7.4e-14
WP_046050154.1|528815_529082_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	53.7	2.3e-18
WP_046050155.1|529269_531246_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	48.0	4.3e-170
WP_046050156.1|531245_531578_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	69.2	8.8e-36
WP_046050157.1|531570_532755_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	66.8	1.3e-153
WP_046050158.1|532747_533356_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	64.1	1.1e-68
WP_046050159.1|533355_535026_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	64.9	6.5e-119
WP_046050160.1|535041_535527_+|tail	tail fiber assembly protein	tail	F1BUP0	Erwinia_phage	48.1	3.0e-40
WP_046050161.1|535516_536248_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	46.2	1.4e-41
WP_046050162.1|536213_536759_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	64.8	1.1e-54
WP_046050163.1|536755_538411_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	53.4	2.0e-168
WP_046050164.1|538487_539039_+	YfbU family protein	NA	NA	NA	NA	NA
WP_046050165.1|539612_540473_+	DNA processing protein DprA	NA	NA	NA	NA	NA
WP_046050166.1|540477_541794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019082216.1|542242_543583_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
542666:542681	attR	CAAGCGGCATTGCAGG	NA	NA	NA	NA
>prophage 4
NZ_HF571988	Yersinia enterocolitica (type O:5) str. YE53/03 isolate host faecal sample	4940199	1642777	1750010	4940199	integrase,head,tail,protease,terminase,portal,capsid,plate	Shigella_phage(16.13%)	98	1662866:1662883	1721065:1721082
WP_019082044.1|1642777_1643284_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_019082045.1|1643380_1643638_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	68.8	3.1e-20
WP_011815971.1|1643641_1644772_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	3.1e-173
WP_019082046.1|1644857_1647143_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	65.1	1.2e-285
WP_046050590.1|1647659_1648388_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_046050591.1|1648532_1651157_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.9	7.8e-103
WP_046051995.1|1651281_1654149_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.6	5.3e-44
WP_004389433.1|1654376_1655024_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_046050593.1|1655026_1657720_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_019082051.1|1657742_1658897_-	MFS transporter	NA	NA	NA	NA	NA
1662866:1662883	attL	TATCAATGGCACAGAGGC	NA	NA	NA	NA
WP_098057235.1|1672317_1673703_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_046050594.1|1673878_1676014_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.6	9.1e-25
WP_026018275.1|1676026_1677196_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_046050595.1|1677862_1678963_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.4	1.4e-117
WP_005171542.1|1679477_1680620_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_019082058.1|1680799_1682326_-	MFS transporter	NA	NA	NA	NA	NA
WP_019083517.1|1682738_1683728_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_046050596.1|1683752_1685585_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.9	6.4e-11
WP_046050597.1|1685911_1686847_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_005159352.1|1687011_1687254_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	70.9	5.1e-25
WP_011815980.1|1687501_1688224_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	1.1e-62
WP_019082062.1|1688498_1688978_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	61.6	7.9e-38
WP_019082064.1|1689244_1689523_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	47.2	1.4e-15
WP_046050598.1|1689559_1689889_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_019082066.1|1689941_1690109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019082067.1|1690194_1690725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019083513.1|1690729_1690924_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	57.4	4.5e-08
WP_046050599.1|1690920_1692429_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.6	3.1e-104
WP_019082070.1|1692496_1692865_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_019082071.1|1692866_1693166_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_052705592.1|1693286_1694642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050601.1|1694729_1696130_+	DNA circularization protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	37.7	6.2e-06
WP_046050602.1|1696126_1697197_+|tail	tail protein	tail	M4M9L5	Vibrio_phage	29.4	3.0e-37
WP_046050603.1|1697212_1697809_+|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	35.5	2.0e-06
WP_019082076.1|1697805_1698258_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	45.4	6.6e-18
WP_019082077.1|1698261_1699398_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.6	2.0e-34
WP_046050604.1|1699394_1699991_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	36.2	2.8e-32
WP_019082080.1|1700759_1701179_+|tail	tail assembly chaperone	tail	U5P083	Shigella_phage	37.1	8.3e-15
WP_019082081.1|1701199_1701385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046050605.1|1701394_1702168_-	hypothetical protein	NA	A9YX14	Burkholderia_phage	45.8	1.8e-39
WP_019083504.1|1702258_1702834_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	70.2	1.4e-65
WP_046050606.1|1702966_1703707_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046050607.1|1703872_1705414_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_005171472.1|1705502_1706939_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_046050608.1|1707213_1707948_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_019079959.1|1708257_1709289_-	methyltransferase	NA	NA	NA	NA	NA
WP_046050609.1|1709820_1710999_-|integrase	phage integrase SAM-like domain-containing protein	integrase	A0A2D1GN00	Marinobacter_phage	30.7	1.2e-31
WP_046050610.1|1711002_1711221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046050612.1|1711699_1712194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046050614.1|1713759_1714290_-	hypothetical protein	NA	A0A291AX04	Escherichia_phage	58.7	1.8e-51
WP_046050615.1|1714379_1715207_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	60.2	8.5e-88
WP_046050616.1|1715244_1715616_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	74.2	1.8e-45
WP_072084135.1|1716026_1716290_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_046050617.1|1716269_1716458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046050618.1|1716684_1717326_-	LexA family transcriptional regulator	NA	A0A1W6JP50	Morganella_phage	62.0	2.9e-59
WP_005174518.1|1717428_1717626_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	65.5	1.2e-16
WP_019083784.1|1717654_1718182_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	29.7	6.3e-12
WP_046050619.1|1718347_1718545_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_046050620.1|1718541_1719663_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	44.6	1.4e-37
WP_046050621.1|1719659_1720547_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	57.1	6.5e-94
WP_046050622.1|1720543_1722424_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	62.0	3.0e-242
1721065:1721082	attR	TATCAATGGCACAGAGGC	NA	NA	NA	NA
WP_046050623.1|1722420_1722804_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	64.2	7.2e-42
WP_046050071.1|1722906_1723605_+	phage antirepressor KilAC domain-containing protein	NA	A0A059VF66	Pseudomonas_phage	61.1	7.2e-64
WP_046050624.1|1723601_1724627_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	49.4	6.4e-93
WP_025379076.1|1724623_1725046_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	57.7	2.1e-34
WP_046050625.1|1725162_1725690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050626.1|1726142_1726952_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	46.9	3.8e-64
WP_046050627.1|1727247_1727463_+	peptidoglycan-binding protein LysM	NA	H9C183	Pectobacterium_phage	54.0	1.5e-12
WP_046050628.1|1727462_1727993_+	lysozyme	NA	Q7Y3V3	Yersinia_phage	71.4	2.1e-71
WP_046050629.1|1727985_1728318_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_046050630.1|1728687_1729311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050631.1|1729387_1729717_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	63.3	7.4e-35
WP_046050632.1|1729866_1730334_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	1.1e-44
WP_046050633.1|1730287_1732033_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.2	1.5e-134
WP_046050634.1|1732032_1733364_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	76.4	4.7e-189
WP_046050635.1|1733369_1734227_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	72.3	1.3e-110
WP_046050636.1|1734239_1735451_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	84.8	4.6e-191
WP_046050637.1|1735499_1735751_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	70.2	3.7e-10
WP_046050638.1|1735760_1736072_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	50.9	1.2e-23
WP_046050639.1|1736074_1736467_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_046050640.1|1736466_1736985_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	56.8	6.3e-49
WP_046050641.1|1736981_1737533_+	hypothetical protein	NA	S5FM61	Shigella_phage	56.5	1.8e-57
WP_019081889.1|1737539_1737746_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	71.4	3.9e-10
WP_046050642.1|1737742_1739236_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	68.8	3.3e-183
WP_038277325.1|1739236_1739593_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	85.6	9.1e-55
WP_046050643.1|1739589_1739856_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	63.5	9.5e-25
WP_046050644.1|1739997_1741827_+|tail	phage tail tape measure protein	tail	M1FQW0	Enterobacteria_phage	61.2	7.0e-175
WP_046050645.1|1741844_1742360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050646.1|1742421_1742781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050647.1|1742838_1744143_+	DNA circularization N-terminal domain-containing protein	NA	S5FUX4	Shigella_phage	56.3	2.5e-134
WP_046050648.1|1744139_1745213_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	64.6	3.3e-132
WP_046050649.1|1745212_1745779_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	48.9	2.0e-32
WP_046050650.1|1745782_1746196_+	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	59.1	1.2e-42
WP_046050651.1|1746188_1747247_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	62.5	2.7e-131
WP_046050652.1|1747237_1747819_+	YmfQ family protein	NA	O22003	Shigella_phage	63.9	2.3e-71
WP_154294745.1|1748889_1749060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050653.1|1749151_1749412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046050654.1|1749572_1750010_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.9	2.4e-33
>prophage 5
NZ_HF571988	Yersinia enterocolitica (type O:5) str. YE53/03 isolate host faecal sample	4940199	2054536	2063782	4940199	holin	Cronobacter_phage(28.57%)	9	NA	NA
WP_019079764.1|2054536_2056096_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	51.4	1.3e-36
WP_046050763.1|2056665_2057934_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.5	1.5e-155
WP_046050764.1|2057933_2058290_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	44.8	3.8e-21
WP_046050765.1|2058685_2059024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019079758.1|2058999_2059500_-	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	57.8	1.8e-48
WP_019079757.1|2059471_2059693_-|holin	class II holin family protein	holin	M9NZI9	Enterobacteria_phage	66.2	2.3e-16
WP_046050766.1|2059772_2060609_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046050767.1|2060932_2061997_-	linear amide C-N hydrolase	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	27.7	2.0e-20
WP_019083379.1|2062504_2063782_+	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	30.1	3.4e-19
>prophage 6
NZ_HF571988	Yersinia enterocolitica (type O:5) str. YE53/03 isolate host faecal sample	4940199	2137009	2143133	4940199		Tupanvirus(16.67%)	7	NA	NA
WP_046050796.1|2137009_2138749_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.8	1.3e-37
WP_046050797.1|2139259_2139679_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	32.8	4.8e-15
WP_046050798.1|2140079_2140724_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	29.5	7.5e-15
WP_019083270.1|2141474_2141894_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	63.0	3.1e-38
WP_005170265.1|2142069_2142246_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_005161370.1|2142472_2142649_+	hypothetical protein	NA	B6SD15	Bacteriophage	60.7	2.2e-14
WP_046050799.1|2142650_2143133_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	65.0	3.8e-56
>prophage 7
NZ_HF571988	Yersinia enterocolitica (type O:5) str. YE53/03 isolate host faecal sample	4940199	2212215	2280763	4940199	transposase,integrase,head,tail,holin,terminase,tRNA,portal,capsid,plate	Cronobacter_phage(44.83%)	71	2246109:2246131	2277521:2277543
WP_026017861.1|2212215_2212914_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_019079618.1|2213020_2213626_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_046050825.1|2213966_2215661_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.4	2.7e-32
WP_046050826.1|2215758_2216880_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|2217016_2217286_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005163000.1|2217289_2218102_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_005169220.1|2218127_2218814_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_046050827.1|2219365_2219728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005162995.1|2219807_2220080_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_046050828.1|2220118_2221192_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_019079614.1|2221272_2221929_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_019079613.1|2222043_2222490_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_019079548.1|2222555_2222912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019083200.1|2223465_2224254_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_011816443.1|2224410_2224941_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_019083199.1|2225170_2226745_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_005162963.1|2227055_2227775_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_013649969.1|2227860_2229396_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_046050829.1|2229904_2231209_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_046050830.1|2231326_2232403_+	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_019083196.1|2232410_2233601_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	28.2	2.4e-27
WP_046050831.1|2233771_2236366_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_046050832.1|2236711_2237584_-	pirin family protein	NA	NA	NA	NA	NA
WP_046050833.1|2237752_2238658_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046050834.1|2238670_2239117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019079539.1|2239311_2240361_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026017852.1|2240463_2241741_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	2.0e-11
WP_019079537.1|2241852_2243787_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_005169267.1|2244209_2244980_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_046050835.1|2245053_2245932_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
2246109:2246131	attL	AATAAAAAAGCCACCCGGAGGTG	NA	NA	NA	NA
WP_046050836.1|2246242_2247226_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	57.3	1.1e-105
WP_046050837.1|2247292_2247592_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	63.6	7.7e-31
WP_046050838.1|2247713_2247986_+	regulatory protein	NA	Q1JS60	Enterobacteria_phage	69.2	2.3e-34
WP_046050839.1|2247982_2248201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050840.1|2248391_2248898_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	32.3	2.9e-14
WP_046050841.1|2249042_2249264_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_046050842.1|2249272_2249623_+	DUF5347 family protein	NA	E5G6L5	Salmonella_phage	32.7	3.3e-09
WP_046050843.1|2249693_2249930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072085980.1|2249929_2250598_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	59.0	6.1e-12
WP_046050844.1|2250581_2250962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050130716.1|2250958_2253235_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	52.9	1.8e-188
WP_046050845.1|2253384_2253861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050846.1|2253894_2254989_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_050130714.1|2255161_2255491_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_072085979.1|2255494_2256592_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	61.8	1.3e-123
WP_046050848.1|2258627_2259584_+|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	54.3	9.3e-38
WP_046050849.1|2259666_2260833_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	49.7	1.4e-83
WP_046050850.1|2260847_2261609_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	51.9	3.3e-62
WP_046050851.1|2261598_2261850_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	69.1	1.3e-26
WP_046050852.1|2262000_2262453_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	48.0	4.7e-32
WP_046050853.1|2262449_2262968_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_046050854.1|2262957_2263653_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	44.3	2.8e-44
WP_046050855.1|2263649_2264828_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	55.4	3.3e-109
WP_046050856.1|2264830_2265289_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	55.3	4.3e-41
WP_072085978.1|2265292_2265613_+|holin	holin	holin	C7BGD7	Burkholderia_phage	44.8	1.6e-13
WP_046050857.1|2265609_2265951_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	80.0	2.4e-44
WP_046050858.1|2265950_2266322_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	42.3	4.0e-13
WP_046050860.1|2266436_2266712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050861.1|2266908_2268966_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	38.8	4.7e-127
WP_046050862.1|2268962_2269289_+	DUF2590 family protein	NA	Q1I0Y6	Pasteurella_virus	59.3	6.0e-29
WP_046050863.1|2269288_2270473_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	59.8	1.2e-130
WP_046050864.1|2270459_2271089_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	61.2	2.6e-60
WP_046050865.1|2272782_2273256_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_046050866.1|2273245_2273953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046050867.1|2273945_2274500_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	47.3	2.0e-32
WP_046050868.1|2274496_2276194_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	49.0	1.6e-128
WP_050130702.1|2276286_2276694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005162909.1|2277571_2278567_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
2277521:2277543	attR	AATAAAAAAGCCACCCGGAGGTG	NA	NA	NA	NA
WP_019079534.1|2278914_2279328_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_019079533.1|2279401_2279674_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_046050665.1|2279800_2280763_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.1	8.5e-23
>prophage 8
NZ_HF571988	Yersinia enterocolitica (type O:5) str. YE53/03 isolate host faecal sample	4940199	2615452	2623284	4940199	tRNA	Bacillus_phage(16.67%)	9	NA	NA
WP_032908420.1|2615452_2615749_+	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	68.8	8.1e-17
WP_002211830.1|2615961_2616258_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_046050986.1|2616262_2618650_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
WP_046050987.1|2618664_2619648_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	9.9e-35
WP_152414234.1|2619996_2620044_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004393357.1|2620112_2620469_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004713020.1|2620506_2620704_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_011816226.1|2620800_2621352_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_005170086.1|2621355_2623284_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	7.4e-127
>prophage 9
NZ_HF571988	Yersinia enterocolitica (type O:5) str. YE53/03 isolate host faecal sample	4940199	2738591	2851760	4940199	transposase,head,integrase,tail,holin,tRNA,terminase,lysis,portal,capsid,plate	Salmonella_phage(21.74%)	124	2770818:2770834	2852258:2852274
WP_046051037.1|2738591_2739218_-|tRNA	serine-tRNA(Ala) deacylase AlaX	tRNA	NA	NA	NA	NA
WP_046051038.1|2739307_2740240_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046051039.1|2740290_2741160_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_019082979.1|2741304_2741619_-	cytochrome c	NA	NA	NA	NA	NA
WP_005168973.1|2741618_2742107_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_005164408.1|2742096_2742810_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-17
WP_172653834.1|2742813_2743926_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046051040.1|2743960_2745253_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046051041.1|2745255_2746662_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_004390794.1|2746797_2747325_-	iron transporter	NA	NA	NA	NA	NA
WP_046051042.1|2747405_2749343_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_046051043.1|2749516_2750035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005179195.1|2750150_2751791_-	MFS transporter	NA	NA	NA	NA	NA
WP_046051044.1|2751902_2752910_-	glutaminase A	NA	NA	NA	NA	NA
WP_046051045.1|2753350_2754130_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_019079190.1|2754132_2754756_-	aldolase	NA	A0A077SK32	Escherichia_phage	78.2	6.8e-90
WP_046051046.1|2754752_2756015_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.5	1.9e-139
WP_019079188.1|2756367_2757147_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	64.3	3.5e-83
WP_019079187.1|2757390_2759067_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_019079186.1|2759059_2759779_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_046051047.1|2759890_2761249_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	69.9	3.9e-29
WP_046051048.1|2762323_2763838_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_019079183.1|2763986_2764340_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_019079182.1|2764372_2764831_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_019082967.1|2765085_2765478_-	VOC family protein	NA	NA	NA	NA	NA
WP_046051049.1|2765655_2766681_+	ROK family protein	NA	NA	NA	NA	NA
WP_046051050.1|2766918_2768091_+	MFS transporter	NA	NA	NA	NA	NA
WP_019079178.1|2768271_2769090_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_072076895.1|2770128_2770365_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
2770818:2770834	attL	GTAGAGAGCGCTATATT	NA	NA	NA	NA
WP_046051051.1|2771688_2772693_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	54.5	9.0e-100
WP_046051052.1|2772914_2773565_-	membrane protein	NA	NA	NA	NA	NA
WP_046051053.1|2773580_2773973_-	helix-turn-helix domain-containing protein	NA	Q6QID2	Burkholderia_phage	51.7	2.4e-24
WP_046051054.1|2774251_2774455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051055.1|2774466_2774703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051056.1|2774760_2775069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051057.1|2775145_2777758_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	35.5	1.2e-119
WP_046051058.1|2777738_2777969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051059.1|2777965_2778310_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	43.9	2.5e-17
WP_046051060.1|2778612_2781231_+	PHP domain-containing protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	25.7	9.8e-21
WP_046051061.1|2781799_2782486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051062.1|2782486_2783527_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	63.8	2.4e-132
WP_046051063.1|2783526_2785290_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	63.2	3.4e-227
WP_046051064.1|2785458_2786271_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	46.6	1.3e-56
WP_046051065.1|2786307_2787363_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	63.0	3.0e-122
WP_046051066.1|2787369_2788023_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	47.0	1.3e-43
WP_046051067.1|2788255_2788747_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	48.4	6.0e-33
WP_046051068.1|2788746_2788950_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	64.2	4.4e-22
WP_072083002.1|2788980_2789367_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_046051069.1|2789353_2789749_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	70.2	7.7e-47
WP_046051070.1|2789753_2790179_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	45.4	2.1e-21
WP_046051071.1|2790277_2790745_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	55.9	1.4e-42
WP_046051072.1|2790741_2791188_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	50.0	1.3e-34
WP_046051073.1|2791199_2791799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051075.1|2792355_2793057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051077.1|2793394_2794030_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	62.3	2.7e-65
WP_046051078.1|2794026_2794383_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	57.4	6.3e-32
WP_046051079.1|2794382_2795291_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	74.2	4.9e-121
WP_046051080.1|2795283_2795832_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	73.1	3.5e-74
WP_046051082.1|2797368_2797983_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_005170383.1|2798025_2798304_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_046051083.1|2798310_2798571_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_046051084.1|2798951_2799158_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_046051085.1|2799147_2799468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051086.1|2799911_2800100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072088421.1|2800294_2801191_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.6	1.3e-73
WP_046051088.1|2801759_2801954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051089.1|2802256_2803432_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	80.4	2.1e-180
WP_046051090.1|2803443_2803959_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	66.9	1.6e-60
WP_046051091.1|2804119_2804431_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	53.6	4.5e-18
WP_049530285.1|2804445_2804565_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	56.4	2.3e-07
WP_046051092.1|2804557_2807485_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	46.0	7.8e-152
WP_046051093.1|2807496_2807961_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	65.1	1.6e-43
WP_098057494.1|2807963_2809064_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	66.4	3.3e-127
WP_046051095.1|2809138_2809354_+	ogr/Delta-like zinc finger family protein	NA	S4TNZ3	Salmonella_phage	60.6	3.7e-19
WP_019082965.1|2809777_2811307_-	recombinase family protein	NA	NA	NA	NA	NA
WP_110129298.1|2811617_2812845_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.4	1.3e-145
WP_046051096.1|2813120_2816180_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	48.1	4.4e-105
WP_072083000.1|2816238_2816679_-|tail	tail fiber assembly protein	tail	Q7Y3Y8	Yersinia_phage	53.0	1.1e-20
WP_046051098.1|2816687_2818499_-	hypothetical protein	NA	A0A1L7DQU7	Yersinia_phage	43.8	2.5e-39
WP_046051099.1|2818524_2819229_-	hypothetical protein	NA	A0A2D2W721	Pectobacterium_phage	25.2	6.9e-06
WP_019079554.1|2819228_2819495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051100.1|2819497_2820463_-	DUF1983 domain-containing protein	NA	Q5G8W0	Enterobacteria_phage	49.7	1.3e-76
WP_154393687.1|2820563_2821713_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.9	9.4e-93
WP_046051102.1|2823130_2823481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816460.1|2823890_2824208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051103.1|2824419_2824767_-	TonB family protein	NA	NA	NA	NA	NA
WP_046051104.1|2824926_2825676_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	54.0	4.0e-60
WP_046051105.1|2825700_2826084_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	66.1	9.1e-45
WP_046051106.1|2826080_2826449_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	68.0	1.2e-41
WP_046051107.1|2826450_2826801_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	50.9	3.3e-25
WP_154235943.1|2826730_2826925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051108.1|2827111_2827483_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	77.5	1.5e-47
WP_046051109.1|2827485_2827851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051110.1|2827860_2828937_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	76.0	4.1e-159
WP_046051111.1|2828947_2829388_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	63.7	1.4e-41
WP_046051112.1|2829391_2830789_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	59.3	1.4e-151
WP_080342205.1|2830958_2831840_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.0	2.3e-107
WP_046051113.1|2831877_2833335_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	66.1	1.1e-170
WP_046051114.1|2833345_2834818_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	2.8e-251
WP_046051115.1|2834817_2835420_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	73.0	7.1e-68
WP_046052036.1|2835918_2836107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051117.1|2836448_2836982_-	lysozyme	NA	H6WRZ4	Salmonella_phage	67.8	1.3e-68
WP_046051118.1|2836981_2837248_-	hypothetical protein	NA	Q7Y3V4	Yersinia_phage	78.4	7.0e-36
WP_046051119.1|2837687_2838260_-	DUF1133 family protein	NA	NA	NA	NA	NA
WP_046051120.1|2838256_2838541_-	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	77.7	2.0e-36
WP_046051121.1|2838549_2839143_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	55.8	1.7e-61
WP_046051122.1|2839246_2839510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051123.1|2839552_2839906_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	59.0	9.0e-31
WP_046051124.1|2839902_2842068_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	51.1	4.2e-219
WP_046051125.1|2842064_2842571_-	hypothetical protein	NA	L0ASX3	Klebsiella_phage	37.2	3.2e-05
WP_046051126.1|2842567_2842819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051127.1|2842823_2843204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051128.1|2843248_2844610_-	replicative DNA helicase	NA	K7P852	Enterobacteria_phage	44.6	6.0e-107
WP_046051129.1|2844606_2845581_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	62.1	4.3e-38
WP_046051130.1|2845583_2845808_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	64.9	2.2e-22
WP_046051131.1|2845824_2846289_-|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	56.1	1.8e-34
WP_046051132.1|2846349_2846535_-	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	68.9	2.1e-18
WP_172666731.1|2846627_2847290_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	70.6	8.9e-88
WP_154235942.1|2847530_2847686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051133.1|2847996_2848332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051134.1|2848387_2850586_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	38.4	9.1e-129
WP_046051135.1|2850582_2851083_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	74.8	4.5e-60
WP_019082908.1|2851128_2851311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046051137.1|2851523_2851760_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	43.5	2.9e-09
2852258:2852274	attR	AATATAGCGCTCTCTAC	NA	NA	NA	NA
>prophage 10
NZ_HF571988	Yersinia enterocolitica (type O:5) str. YE53/03 isolate host faecal sample	4940199	3490340	3507949	4940199	terminase	Pseudomonas_phage(21.74%)	26	NA	NA
WP_026018205.1|3490340_3490586_-	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	52.9	2.0e-13
WP_046051387.1|3490648_3490960_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	60.2	3.6e-31
WP_046051388.1|3490972_3491893_-	Ig-like domain-containing protein	NA	I6PBN6	Cronobacter_phage	45.9	1.3e-57
WP_046051389.1|3491959_3492367_-	DUF4128 domain-containing protein	NA	A0A1B0VMI0	Pseudomonas_phage	38.2	9.5e-16
WP_046051390.1|3492363_3492948_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	54.2	3.8e-50
WP_042569850.1|3492949_3493300_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	7.6e-30
WP_046051391.1|3493299_3493782_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.4	1.7e-27
WP_046051392.1|3493829_3495035_-	Ig-like domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_046051393.1|3495048_3495822_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	61.9	8.3e-69
WP_046051394.1|3495943_3497056_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	59.1	2.1e-121
WP_046051395.1|3497056_3498445_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	52.6	9.4e-132
WP_046051396.1|3498444_3499932_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	83.9	1.8e-253
WP_046051397.1|3499931_3500534_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	73.5	1.8e-71
WP_046051398.1|3500710_3500956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051399.1|3501137_3501509_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	41.2	3.8e-11
WP_046051400.1|3501487_3502009_-	lysozyme	NA	I6PBN2	Cronobacter_phage	55.2	7.3e-45
WP_046051401.1|3502011_3502311_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	62.2	7.9e-28
WP_046051403.1|3503117_3503606_-	DUF1133 family protein	NA	G8C7N2	Escherichia_phage	73.5	2.7e-65
WP_046051404.1|3503602_3504211_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	50.7	8.5e-45
WP_019079588.1|3504185_3504332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051405.1|3504473_3504944_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	55.8	9.5e-44
WP_046051406.1|3504958_3505552_-	hypothetical protein	NA	I3PUZ9	Vibrio_phage	38.5	1.3e-34
WP_071988898.1|3505551_3505800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051408.1|3506620_3506899_-	regulatory protein	NA	K7PMG0	Enterobacteria_phage	57.3	3.0e-21
WP_046051409.1|3507020_3507206_-	Cro/Cl family transcriptional regulator	NA	K7PHK4	Enterobacteria_phage	80.3	2.4e-19
WP_046051410.1|3507298_3507949_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.9	1.1e-37
>prophage 11
NZ_HF571988	Yersinia enterocolitica (type O:5) str. YE53/03 isolate host faecal sample	4940199	4361422	4427675	4940199	transposase,protease,tRNA,integrase	Enterobacteria_phage(18.75%)	55	4369507:4369521	4405732:4405746
WP_005156425.1|4361422_4362427_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_005175505.1|4362430_4363714_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_019080715.1|4363811_4365113_-	GTPase HflX	NA	NA	NA	NA	NA
WP_004392473.1|4365211_4365517_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_046051717.1|4365633_4366575_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_046051718.1|4366567_4368475_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.9	1.6e-60
WP_046051719.1|4368490_4370368_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	M1HNA7	Bacillus_virus	27.0	3.8e-27
4369507:4369521	attL	CCTGCTTACGCGCCA	NA	NA	NA	NA
WP_005156441.1|4370465_4370936_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_046051720.1|4370946_4372461_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_046051721.1|4372459_4373614_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011815420.1|4374531_4375077_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.7	4.5e-29
WP_011815419.1|4375254_4376307_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_019084265.1|4376431_4377313_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_019080723.1|4377353_4380713_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_019080724.1|4380796_4381774_-	elongation factor P--(R)-beta-lysine ligase	NA	NA	NA	NA	NA
WP_013649124.1|4382292_4384116_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.3	6.6e-16
WP_005156463.1|4384108_4384843_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_005175556.1|4384859_4385252_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_005175559.1|4385268_4385625_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_019084267.1|4385804_4386344_+	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	57.0	3.9e-49
WP_046051722.1|4386345_4386660_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_004392446.1|4386838_4386970_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005156473.1|4387155_4387722_-	elongation factor P	NA	NA	NA	NA	NA
WP_046051723.1|4387757_4388789_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_005175566.1|4388855_4389194_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_046051724.1|4389311_4389539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019080728.1|4389576_4391223_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	66.9	3.3e-184
WP_004391824.1|4391277_4391571_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	36.8	5.6e-10
WP_019080729.1|4391824_4392352_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_005175569.1|4392793_4394230_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005156507.1|4394349_4395651_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_032900961.1|4395855_4396176_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_046051725.1|4396151_4397900_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_046051726.1|4397947_4399111_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.6	2.3e-46
WP_026017989.1|4399422_4399998_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_046051727.1|4400412_4401669_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.3	4.9e-79
WP_157881598.1|4402516_4403664_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	91.1	1.2e-145
WP_046051731.1|4405424_4406375_+	restriction endonuclease subunit S	NA	A0A1W6JNN3	Staphylococcus_phage	27.4	3.7e-10
4405732:4405746	attR	CCTGCTTACGCGCCA	NA	NA	NA	NA
WP_046051732.1|4406492_4408826_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_046051733.1|4408800_4409466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046052091.1|4409446_4410679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051734.1|4410801_4412919_-	family 16 glycosylhydrolase	NA	NA	NA	NA	NA
WP_046051735.1|4412943_4413777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046051736.1|4413880_4415494_-	proline dehydrogenase	NA	A0A292GAM4	Xanthomonas_phage	30.3	7.3e-43
WP_052705595.1|4415614_4416415_-	SANT/Myb domain-containing protein	NA	NA	NA	NA	NA
WP_003100847.1|4417714_4418272_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|4418265_4418637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|4418633_4419134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|4419130_4419457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118639.1|4419606_4420530_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	91.8	1.6e-164
WP_075261940.1|4420678_4420891_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_046051737.1|4420906_4422667_-	DUF853 family protein	NA	NA	NA	NA	NA
WP_046051738.1|4422656_4423850_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_046051739.1|4423934_4424501_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	45.6	2.5e-38
WP_046051740.1|4424660_4427675_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	63.0	0.0e+00
>prophage 12
NZ_HF571988	Yersinia enterocolitica (type O:5) str. YE53/03 isolate host faecal sample	4940199	4729348	4735446	4940199		Synechococcus_phage(50.0%)	9	NA	NA
WP_050123130.1|4729348_4730074_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.9	4.9e-07
WP_050919803.1|4730070_4730811_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_019081614.1|4730894_4731221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019081615.1|4731222_4731945_-	hypothetical protein	NA	A0A1D8KNV9	Synechococcus_phage	30.0	3.0e-28
WP_032901223.1|4731934_4732588_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	40.1	1.7e-35
WP_019081617.1|4732596_4733223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019081618.1|4733219_4733981_-	NTP transferase domain-containing protein	NA	A0A1D8KNV9	Synechococcus_phage	50.2	3.4e-59
WP_019081619.1|4734014_4734563_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	52.5	1.2e-50
WP_019081620.1|4734567_4735446_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	38.9	7.0e-40
