The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011071	Muricauda lutaonensis strain CC-HSB-11 chromosome, complete genome	3274259	152943	204725	3274259	protease,transposase	Acidithiobacillus_phage(27.27%)	50	NA	NA
WP_045800687.1|152943_154488_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	37.3	3.4e-90
WP_045800688.1|154967_155207_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045803133.1|155202_156135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045800689.1|156192_157593_+	DNA (cytosine-5-)-methyltransferase	NA	H9C177	Pectobacterium_phage	44.3	3.3e-76
WP_157517925.1|157970_159063_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	3.9e-40
WP_045800692.1|159136_160927_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_052698845.1|160992_161367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045800693.1|161370_161718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045800694.1|161962_163018_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_045800695.1|163209_164046_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045800696.1|164246_165137_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	2.4e-19
WP_045800697.1|165129_168633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045800698.1|168786_169125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045800694.1|169611_170667_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_045800687.1|170851_172396_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	37.3	3.4e-90
WP_045800686.1|172420_173158_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	41.4	2.0e-43
WP_045800699.1|173466_173760_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	40.7	8.3e-14
WP_045800700.1|173762_174119_+	helix-turn-helix domain-containing protein	NA	A0A0P0ZCT8	Stx2-converting_phage	49.1	1.4e-23
WP_045800701.1|174435_175545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157517927.1|175726_176119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045800703.1|176115_177444_-	2TM domain-containing protein	NA	NA	NA	NA	NA
WP_045800704.1|177447_178074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045803135.1|178326_180489_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_045800705.1|180714_181137_+	DoxX family protein	NA	NA	NA	NA	NA
WP_045800706.1|181165_181900_-	response regulator	NA	NA	NA	NA	NA
WP_045800707.1|181902_183867_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_170218301.1|184051_184576_+	ester cyclase	NA	NA	NA	NA	NA
WP_045800708.1|184612_185380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045800709.1|185416_186181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045800710.1|186227_186746_+	RidA family protein	NA	NA	NA	NA	NA
WP_157517929.1|186769_187672_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_045803139.1|187685_188267_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_045800711.1|188310_189078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084598132.1|189235_189991_+	DUF3179 domain-containing protein	NA	NA	NA	NA	NA
WP_045800714.1|190037_191147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045800715.1|191265_191877_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_045800716.1|191890_192271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084598133.1|192346_194044_-	PorP/SprF family type IX secretion system membrane protein	NA	NA	NA	NA	NA
WP_045800717.1|194432_194852_+	DUF2141 domain-containing protein	NA	NA	NA	NA	NA
WP_045800718.1|194955_195435_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	34.5	9.1e-18
WP_045800719.1|195534_196476_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045800720.1|196472_196862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084598135.1|196941_197139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045800722.1|197248_198559_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_045803141.1|198627_199206_-	GDP-mannose pyrophosphatase NudK	NA	NA	NA	NA	NA
WP_045800723.1|199279_200083_-	patatin-like phospholipase family protein	NA	A0A1V0SCG0	Catovirus	27.8	4.8e-19
WP_052698848.1|200174_200609_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_052698849.1|200701_201178_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_045800724.1|201378_202569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045800725.1|202802_204725_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A9YVR1	Ostreococcus_tauri_virus	42.2	2.8e-110
>prophage 2
NZ_CP011071	Muricauda lutaonensis strain CC-HSB-11 chromosome, complete genome	3274259	677381	686361	3274259	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_045801102.1|677381_678062_+	GTP cyclohydrolase I FolE	NA	A0A218M2Y0	Acidovorax_phage	57.1	3.2e-56
WP_045801103.1|678061_679549_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.8	1.2e-44
WP_084598152.1|679555_679777_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	52.1	2.2e-14
WP_045801104.1|679974_680946_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_045801105.1|680957_681437_+	DUF192 domain-containing protein	NA	A0A222YVT9	Synechococcus_phage	38.0	2.8e-14
WP_045801106.1|681436_681967_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_084598259.1|682059_683244_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	3.5e-10
WP_045801107.1|683397_686361_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.8	3.0e-34
>prophage 3
NZ_CP011071	Muricauda lutaonensis strain CC-HSB-11 chromosome, complete genome	3274259	2520175	2591036	3274259	tRNA,integrase,transposase	Acidithiobacillus_phage(27.27%)	59	2531862:2531893	2575325:2575356
WP_045802553.1|2520175_2522116_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	38.3	1.2e-127
WP_045803423.1|2527958_2528594_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_045802554.1|2528607_2529279_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_045802555.1|2529336_2530494_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_045802556.1|2530636_2531833_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	27.1	7.1e-27
2531862:2531893	attL	AAAATTAGCGGGGGCATGCCCCCGCTAATTTT	NA	NA	NA	NA
WP_045802557.1|2531975_2532917_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_045802558.1|2532921_2534112_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_045802559.1|2534361_2535750_+	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_045802560.1|2536034_2537897_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_045802561.1|2537960_2539598_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.1	2.6e-144
WP_045802562.1|2539653_2539890_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_045802563.1|2539934_2540798_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_045802564.1|2540822_2541626_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_045802565.1|2541709_2542255_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_045802566.1|2542361_2543876_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_045802567.1|2544040_2544583_-	DUF922 domain-containing protein	NA	NA	NA	NA	NA
WP_045802568.1|2544570_2544975_-	OsmC family protein	NA	NA	NA	NA	NA
WP_157518073.1|2544971_2547119_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_045802570.1|2547115_2548648_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_045802571.1|2548725_2549451_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_045802572.1|2549504_2550167_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_157518076.1|2550223_2552089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084598223.1|2552310_2554281_+	thiol-activated cytolysin family protein	NA	NA	NA	NA	NA
WP_045802576.1|2554501_2555047_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_045802577.1|2555068_2556670_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
WP_045803424.1|2556822_2559273_+	zinc carboxypeptidase	NA	NA	NA	NA	NA
WP_045802578.1|2559387_2560494_+	AraC family transcriptional regulator	NA	S5VXW9	Leptospira_phage	42.1	1.1e-10
WP_045802579.1|2560660_2561971_+	carboxypeptidase-like regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_157518079.1|2562094_2562715_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A075BS18	Microcystis_phage	40.7	7.7e-09
WP_045802580.1|2562719_2563997_-	ornithine--oxo-acid transaminase	NA	NA	NA	NA	NA
WP_045802581.1|2564189_2565599_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	32.1	4.4e-60
WP_045802582.1|2565603_2566110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045802583.1|2566090_2566846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045802584.1|2566837_2567905_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.0	5.2e-29
WP_045803426.1|2568132_2568423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157518082.1|2568432_2568654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045802585.1|2568805_2569315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045803427.1|2569471_2570017_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_045802586.1|2570195_2570492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045802587.1|2570496_2571060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045802588.1|2571204_2571621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045802589.1|2572001_2572616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157518085.1|2572741_2573764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170218323.1|2573913_2574408_+	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_045802591.1|2574567_2575311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045802154.1|2575384_2576581_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	27.5	5.4e-27
2575325:2575356	attR	AAAATTAGCGGGGGCATGCCCCCGCTAATTTT	NA	NA	NA	NA
WP_045800694.1|2576929_2577985_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_045802592.1|2578369_2579107_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	41.4	1.5e-43
WP_045800687.1|2579131_2580676_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	37.3	3.4e-90
WP_045802593.1|2580790_2581768_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_045802594.1|2581764_2582151_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_045802595.1|2582816_2583077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045802596.1|2583079_2583349_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_045802597.1|2583640_2584438_+	type IV toxin-antitoxin system AbiEi family antitoxin	NA	NA	NA	NA	NA
WP_045802598.1|2584434_2585223_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_045802599.1|2585365_2586622_+	DNA double-strand break repair nuclease NurA	NA	NA	NA	NA	NA
WP_045802600.1|2586635_2588420_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_045802601.1|2588421_2589324_+	Myb-like DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_045800687.1|2589491_2591036_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	37.3	3.4e-90
