The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007483	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175, complete genome	4731596	1155883	1218977	4731596	integrase,tail,lysis,capsid,head,terminase,portal,tRNA,plate	Salmonella_phage(90.91%)	64	1155722:1155768	1189920:1189966
1155722:1155768	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_006493480.1|1155883_1157110_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	65.4	3.6e-151
WP_006493482.1|1157116_1158133_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	5.0e-191
WP_023136550.1|1158134_1158767_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	96.7	5.8e-113
WP_000102106.1|1158885_1159128_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_006493486.1|1159160_1159670_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	3.5e-84
WP_000794278.1|1159756_1160032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001528723.1|1160116_1160311_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
WP_000963476.1|1160274_1160616_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
WP_001178763.1|1160683_1160911_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
WP_000785514.1|1160910_1161138_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	5.4e-21
WP_006493488.1|1161134_1161992_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.8	4.6e-113
WP_006493489.1|1161988_1164382_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	88.8	0.0e+00
WP_001749759.1|1164401_1164629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749760.1|1164766_1164955_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	91.7	5.7e-24
WP_006493490.1|1165285_1166488_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	37.1	5.6e-64
WP_006493491.1|1166450_1167368_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_006493493.1|1167414_1168449_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	94.8	4.1e-188
WP_006493495.1|1168448_1170215_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.6	0.0e+00
WP_006493498.1|1170357_1171191_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.1	1.1e-127
WP_000730754.1|1171207_1172275_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	2.8e-192
WP_000059169.1|1172278_1172929_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	1.6e-113
WP_000673541.1|1173022_1173487_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	7.9e-83
WP_000868184.1|1173486_1173690_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1173693_1173909_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_006493502.1|1173889_1174399_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.2e-93
WP_000871620.1|1174403_1174778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001648763.1|1174774_1175203_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_001039964.1|1175298_1175730_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	4.0e-73
WP_000343939.1|1175722_1176169_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	3.8e-66
WP_000993750.1|1176237_1176816_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
WP_006493507.1|1176812_1177172_+|plate	baseplate assembly protein W	plate	E5G6N7	Salmonella_phage	92.4	6.3e-56
WP_006493508.1|1177158_1178067_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.7	7.2e-157
WP_001086802.1|1178059_1178665_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.1e-116
WP_045791118.1|1178661_1180236_+|tail	tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.9	3.3e-157
WP_006501158.1|1180205_1180823_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.1	1.6e-94
WP_001287104.1|1180826_1181234_-|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	85.2	6.7e-62
WP_077918804.1|1181240_1182320_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	91.8	1.2e-182
WP_006501163.1|1182289_1182847_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.9	9.4e-99
WP_006501164.1|1182949_1184122_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	3.7e-222
WP_001207653.1|1184131_1184647_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280962.1|1184701_1185004_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1185018_1185138_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_006501165.1|1185130_1187938_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	98.3	0.0e+00
WP_000980409.1|1187934_1188420_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_006501166.1|1188416_1189517_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.6	9.0e-194
WP_000980498.1|1189585_1189804_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_072101134.1|1190355_1191519_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1189920:1189966	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023244174.1|1191526_1193707_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_023243957.1|1193703_1195113_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_038389487.1|1195177_1206652_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1207271_1207754_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1207903_1208380_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1208369_1208660_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1208825_1209164_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001525072.1|1209312_1210974_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1211059_1211938_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1212060_1212651_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023243603.1|1212685_1213291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143207254.1|1213411_1214698_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_001537507.1|1214717_1215509_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1215674_1217036_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1217349_1217598_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1217616_1218165_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1218209_1218977_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP007483	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175, complete genome	4731596	1709425	1718596	4731596	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1709425_1710373_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1710356_1711088_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1711068_1711176_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1711235_1711967_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1712189_1713875_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1713871_1714591_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1714637_1715105_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1715161_1715692_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1715863_1716322_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1716562_1718596_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP007483	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175, complete genome	4731596	1786688	1792985	4731596		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1786688_1788092_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1788269_1789163_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1789539_1790625_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1790624_1791524_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1791571_1792450_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1792454_1792985_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 4
NZ_CP007483	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175, complete genome	4731596	1926250	1937635	4731596	integrase	Stenotrophomonas_phage(25.0%)	12	1912138:1912153	1927675:1927690
1912138:1912153	attL	TGGCTCCTCTGACTGG	NA	NA	NA	NA
WP_023244267.1|1926250_1927513_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.3	1.5e-75
WP_023243861.1|1928158_1928449_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	1.8e-08
1927675:1927690	attR	TGGCTCCTCTGACTGG	NA	NA	NA	NA
WP_000598920.1|1928820_1929618_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000500830.1|1930098_1930260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243860.1|1930386_1930806_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1930808_1932077_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1932531_1932744_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1932754_1932943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1933202_1934396_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1935044_1935356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|1935435_1936131_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1936204_1937635_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP007483	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175, complete genome	4731596	2041955	2048569	4731596	integrase	Pectobacterium_phage(16.67%)	11	2044165:2044187	2056288:2056310
WP_000856224.1|2041955_2042186_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2042323_2042698_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|2042698_2043574_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2043590_2043944_+	YebY family protein	NA	NA	NA	NA	NA
2044165:2044187	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|2044315_2045395_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|2045391_2046498_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|2046528_2046759_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|2046812_2047346_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2047602_2047770_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2047834_2048023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|2048077_2048569_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
2056288:2056310	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP007483	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175, complete genome	4731596	2658914	2738296	4731596	tail,integrase,capsid,head,terminase,holin,protease,portal,tRNA,plate	Salmonella_phage(55.17%)	103	2679561:2679577	2737815:2737831
WP_000829543.1|2658914_2659442_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|2659438_2659546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2659751_2660198_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2660177_2660972_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2661072_2662257_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2662375_2662723_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|2662708_2663020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2663088_2663340_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2663535_2663634_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2663772_2664021_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|2664334_2664976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2665205_2665388_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2665390_2665753_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2665925_2666564_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|2666759_2667305_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|2667387_2667543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|2667621_2667870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2668124_2668973_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|2669041_2669635_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|2669779_2670568_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_000234684.1|2670675_2671326_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2671519_2671846_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|2672039_2673173_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|2673254_2673845_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|2673838_2674636_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
WP_000966637.1|2674629_2675442_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|2675431_2676406_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946091.1|2676405_2678040_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2678721_2679036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|2679184_2679715_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2679561:2679577	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_021000256.1|2679797_2680841_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001525268.1|2681179_2681650_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|2681799_2682072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|2682271_2682397_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977725.1|2682774_2683119_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789471.1|2684340_2684898_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|2685709_2685973_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2686104_2686317_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2686731_2687253_+	lipoprotein	NA	NA	NA	NA	NA
WP_000497451.1|2687443_2687683_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|2688172_2688961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|2689956_2691081_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|2691528_2691741_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334550.1|2691994_2692666_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_023171144.1|2692658_2693927_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.0	7.3e-240
WP_023171145.1|2693929_2694349_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	3.8e-36
WP_077909836.1|2694685_2694898_-	hypothetical protein	NA	A0A1B0V844	Salmonella_phage	62.9	9.3e-07
WP_023171148.1|2695022_2696156_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	1.6e-36
WP_023171149.1|2696193_2696406_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	60.9	1.6e-11
WP_094445164.1|2696395_2697001_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	93.1	1.4e-100
WP_023244258.1|2696970_2698224_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	95.6	4.6e-178
WP_023171039.1|2698210_2698798_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	1.4e-113
WP_023171040.1|2698800_2699880_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	98.9	3.6e-203
WP_000605051.1|2699872_2700286_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2700290_2700824_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066631.1|2700823_2701882_-	hypothetical protein	NA	A0A192Y7L7	Salmonella_phage	99.7	6.6e-202
WP_023171041.1|2701878_2703219_-|tail	tail/DNA circulation protein	tail	A0A192Y5U9	Salmonella_phage	99.3	1.1e-249
WP_023171042.1|2703252_2705181_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	99.1	0.0e+00
WP_000588852.1|2705265_2705592_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2705588_2705945_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|2705944_2707441_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497755.1|2707430_2707595_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001241332.1|2707616_2708162_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_023171043.1|2708158_2708671_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_023171044.1|2708642_2709056_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_000886224.1|2709067_2709391_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_071530433.1|2709397_2709772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023244259.1|2709676_2710894_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.6	3.0e-198
WP_023171047.1|2710903_2711752_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	7.5e-132
WP_023171048.1|2711765_2713070_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.6	1.9e-219
WP_077909829.1|2713069_2714812_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_023171050.1|2714765_2715230_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_024147208.1|2715362_2715707_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	8.8e-47
WP_001070544.1|2715841_2716069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495545.1|2716165_2716543_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	2.2e-43
WP_023171052.1|2716585_2717125_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	49.3	1.3e-07
WP_023171053.1|2717121_2717736_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_000250465.1|2717735_2718017_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171055.1|2718003_2718390_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_023171056.1|2718540_2719464_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171057.1|2719570_2720401_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_024147207.1|2720431_2721421_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171059.1|2721428_2722289_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_023171060.1|2722305_2722695_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_023171061.1|2722691_2723585_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	8.7e-163
WP_023171062.1|2723584_2724067_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_000104924.1|2724068_2725028_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.6e-117
WP_023244168.1|2725245_2726388_-	antirepressor	NA	A0A1C9IHV9	Salmonella_phage	87.4	6.3e-182
WP_000509731.1|2726384_2726939_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2726967_2727192_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2727289_2727985_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|2728799_2729171_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_023171064.1|2729228_2730056_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.5	4.1e-151
WP_000008351.1|2730192_2730732_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_100514545.1|2730859_2731534_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	94.3	5.4e-40
WP_023171066.1|2731533_2732007_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.1e-67
WP_000089141.1|2732767_2733004_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|2732993_2734136_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444509.1|2734249_2735500_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|2735671_2736337_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|2736333_2736663_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|2736674_2737136_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2737189_2738296_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2737815:2737831	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 7
NZ_CP007483	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175, complete genome	4731596	3009820	3018902	4731596	integrase,protease	Ralstonia_phage(16.67%)	8	3008213:3008225	3027399:3027411
3008213:3008225	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|3009820_3011062_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|3011589_3011967_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|3012128_3012326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3012538_3014815_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3014845_3015166_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3015489_3015711_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|3015840_3017787_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|3017783_3018902_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
3027399:3027411	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 8
NZ_CP007483	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175, complete genome	4731596	4363635	4408413	4731596	tail,tRNA,plate	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4363635_4364634_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|4364721_4366032_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4366278_4366794_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4366893_4367103_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4367124_4367238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4367234_4368560_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4368738_4369347_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4369455_4369824_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4369994_4372415_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4372513_4373386_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4373399_4373897_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|4374077_4374995_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4375158_4376517_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4376605_4377715_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4378076_4379267_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|4379398_4380943_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|4380957_4381848_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4382013_4382424_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4382566_4384663_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4384662_4385400_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4385396_4386065_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4386098_4386341_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4386784_4388434_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4388778_4390128_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4390258_4390606_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4391181_4391469_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4391471_4392077_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4392089_4392404_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4392563_4393019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|4393015_4393213_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|4393202_4394630_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|4394629_4395154_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4395205_4395523_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4395482_4395611_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4395707_4398062_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4398061_4399015_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4399014_4399224_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4399211_4400255_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4400264_4400987_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4401314_4401677_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4401673_4402603_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4402602_4404150_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4404313_4404673_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4404663_4405779_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4405771_4406404_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4406406_4407888_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_023244443.1|4407897_4408413_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	1.3e-33
