The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP005975	Pseudomonas simiae strain PICF7 chromosome, complete genome	6136735	397043	401998	6136735		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_010212421.1|397043_397610_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	73.3	8.1e-74
WP_002554837.1|397998_398208_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	2.2e-16
WP_042570670.1|398414_399419_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.3e-34
WP_021492420.1|399525_400362_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	33.3	8.2e-06
WP_016976880.1|400571_401249_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.5	6.8e-43
WP_021492421.1|401248_401998_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.2	1.1e-62
>prophage 2
NZ_CP005975	Pseudomonas simiae strain PICF7 chromosome, complete genome	6136735	475203	534707	6136735	holin,plate,tail,tRNA	uncultured_Caudovirales_phage(26.92%)	61	NA	NA
WP_044286716.1|475203_476703_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	1.3e-83
WP_100215725.1|476786_477882_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	2.0e-07
WP_010212639.1|478121_479123_-	PleD family two-component system response regulator	NA	A0A127AWB9	Bacillus_phage	35.8	1.1e-17
WP_010212641.1|479174_480185_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_010212643.1|480181_482446_-	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.4	9.7e-09
WP_010212644.1|482442_483144_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_045791258.1|483140_484400_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_010212647.1|484396_484909_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_010212648.1|484908_486531_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_010212650.1|486679_487390_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_010212651.1|487558_488470_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074900461.1|488573_490061_+	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010212653.1|490133_491285_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010212654.1|491486_492521_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.5	5.2e-26
WP_010212656.1|492522_493452_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021492451.1|493441_494251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010212660.1|494428_495853_+	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010212662.1|495916_497779_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_045791259.1|498124_499750_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_010212665.1|499850_500036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021492454.1|500291_500888_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010212668.1|500890_502060_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_010212669.1|502107_503214_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_010212670.1|503341_505243_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.4	7.2e-74
WP_005785474.1|505531_506872_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_021492456.1|506969_507440_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042571732.1|507565_508276_+	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_010212675.1|508341_508803_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	51.3	4.5e-38
WP_010212676.1|508806_509502_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_010212678.1|510502_511429_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003172176.1|511432_511795_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_010212680.1|511870_512521_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_042571731.1|512659_513379_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_010212685.1|513558_513999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010212688.1|514275_515388_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_021492459.1|515450_515918_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003189042.1|515926_516985_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.4	2.4e-111
WP_010212691.1|517069_517570_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	85.5	8.8e-72
WP_029529227.1|517651_518122_-	lysozyme	NA	B5TK84	Pseudomonas_phage	58.1	6.0e-38
WP_010212696.1|518109_518667_-	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	75.4	5.0e-76
WP_010212698.1|518673_519681_-	hypothetical protein	NA	A0A2H4JH05	uncultured_Caudovirales_phage	53.9	5.8e-99
WP_010212700.1|519690_519903_-|tail	tail protein	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	62.9	1.2e-17
WP_010212701.1|519895_520279_-|tail	phage tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	53.5	1.8e-32
WP_045791260.1|520278_521739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010212706.1|521866_522439_-|tail	phage tail assembly protein	tail	B0ZSH0	Halomonas_phage	36.9	2.3e-28
WP_010212707.1|522491_522998_-|tail	phage tail protein	tail	Q6R4W3	Vibrio_virus	34.5	6.5e-22
WP_042571729.1|522997_524164_-|tail	tail protein	tail	B0ZSG8	Halomonas_phage	57.5	5.5e-125
WP_021492465.1|524425_524662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021492466.1|524671_525424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021492467.1|525492_526032_-	hypothetical protein	NA	B0ZSG1	Halomonas_phage	56.2	1.5e-48
WP_021492468.1|526028_526667_-|tail	phage tail protein I	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	51.9	2.8e-38
WP_021492469.1|526663_527659_-|plate	baseplate J protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	63.5	1.0e-111
WP_021492470.1|527655_527988_-|plate	phage baseplate protein	plate	A0A2H4JI46	uncultured_Caudovirales_phage	68.2	3.9e-36
WP_010212718.1|527997_528609_-|plate	phage baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	53.9	6.6e-45
WP_021492471.1|528612_529128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021492472.1|529149_529494_-|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	82.8	1.5e-46
WP_021492473.1|529744_529942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010212723.1|530091_530826_-	helix-turn-helix transcriptional regulator	NA	B5TK58	Pseudomonas_phage	88.1	1.7e-119
WP_010212724.1|531093_531582_+	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	44.5	3.8e-27
WP_010212726.1|531574_531946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045791261.1|532115_534707_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.5	8.7e-30
>prophage 3
NZ_CP005975	Pseudomonas simiae strain PICF7 chromosome, complete genome	6136735	2274984	2296338	6136735	holin,protease	Klosneuvirus(33.33%)	17	NA	NA
WP_044288002.1|2274984_2276301_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
WP_042571442.1|2276300_2277743_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_010207131.1|2277923_2279627_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.3	1.7e-50
WP_010207130.1|2279788_2281261_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010207128.1|2281371_2281965_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_010207127.1|2282299_2284291_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	28.2	6.9e-19
WP_010207126.1|2284479_2285658_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	37.1	5.9e-26
WP_010207125.1|2285654_2286500_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_010207122.1|2286568_2287516_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_045791547.1|2287931_2289308_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_005792167.1|2289811_2290915_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_010207120.1|2291021_2291285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010207118.1|2291645_2292806_-	gamma-butyrobetaine dioxygenase	NA	NA	NA	NA	NA
WP_010207115.1|2292833_2293310_-	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_044287998.1|2293324_2294290_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_010207113.1|2294432_2295320_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_010207112.1|2295393_2296338_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 4
NZ_CP005975	Pseudomonas simiae strain PICF7 chromosome, complete genome	6136735	4105421	4181212	6136735	integrase,plate,portal,tail,holin,capsid,protease,terminase,coat,head	Pseudomonas_phage(48.72%)	76	4105359:4105378	4140925:4140944
4105359:4105378	attL	TTAGGAGTATGGATCAGAAA	NA	NA	NA	NA
WP_045791876.1|4105421_4106618_-|integrase	site-specific integrase	integrase	J7HXC4	Pseudomonas_phage	54.0	1.1e-115
WP_045791877.1|4106942_4107437_-	hypothetical protein	NA	I2GUG5	Acinetobacter_phage	30.8	2.7e-09
WP_045791878.1|4107613_4108291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045791879.1|4108633_4109233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045791880.1|4109945_4110329_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JA92	uncultured_Caudovirales_phage	62.2	3.1e-24
WP_052698813.1|4111078_4111585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080938513.1|4111973_4112549_-	S24 family peptidase	NA	A0A2H4J6Q0	uncultured_Caudovirales_phage	78.8	1.7e-82
WP_045791883.1|4112862_4113072_+	regulatory protein	NA	A0A0U4K5A6	Pseudomonas_phage	67.8	9.1e-15
WP_080938484.1|4113421_4114129_+	helix-turn-helix domain-containing protein	NA	A0A1B0YZZ0	Pseudomonas_phage	63.3	8.2e-31
WP_045791884.1|4114121_4115489_+	replicative DNA helicase	NA	A0A127KNK8	Pseudomonas_phage	57.0	1.0e-138
WP_045791885.1|4115488_4115698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045791886.1|4115694_4117017_+|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	54.9	1.5e-126
WP_045791887.1|4117165_4117555_+	antitermination protein Q	NA	A0A1W6JTD2	Pseudomonas_phage	61.7	5.6e-42
WP_045791888.1|4117731_4117953_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_144410410.1|4118069_4118372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045791890.1|4118564_4118894_+|holin	phage holin, lambda family	holin	A0A2H4J1U5	uncultured_Caudovirales_phage	90.7	1.9e-51
WP_045791891.1|4118956_4119349_+	HNH endonuclease	NA	A0A0U2C119	Paracoccus_phage	52.4	3.1e-16
WP_021492503.1|4119484_4119958_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	47.7	3.1e-34
WP_045791892.1|4119967_4121701_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	50.3	4.2e-161
WP_045791893.1|4121851_4123078_+|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	67.2	8.0e-151
WP_021492499.1|4123082_4123706_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0GUZ0	Halomonas_phage	59.0	5.3e-58
WP_045791894.1|4123721_4124969_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	53.8	4.0e-113
WP_045791895.1|4125007_4125391_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1J0GUX7	Halomonas_phage	42.7	6.2e-17
WP_045791896.1|4125387_4125765_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_045791897.1|4125757_4126258_+	hypothetical protein	NA	U5P416	Shigella_phage	27.0	2.0e-07
WP_021492494.1|4126315_4126882_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	40.4	3.5e-32
WP_045792419.1|4126911_4127121_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_021492491.1|4128586_4128934_+|tail	phage tail protein	tail	B5TK68	Pseudomonas_phage	53.0	1.3e-29
WP_021492490.1|4128933_4129236_+|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	58.4	1.1e-21
WP_045791898.1|4129366_4131400_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	49.6	3.4e-106
WP_045791899.1|4131403_4132639_+	hypothetical protein	NA	B5TK71	Pseudomonas_phage	40.5	2.7e-74
WP_045791900.1|4132645_4133752_+|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	58.9	1.5e-108
WP_045791901.1|4133748_4134258_+|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	62.4	1.1e-50
WP_045791902.1|4134260_4134662_+	phage GP46	NA	B5TK74	Pseudomonas_phage	55.0	1.4e-32
WP_021492484.1|4134651_4135692_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	55.7	8.4e-101
WP_021492483.1|4135682_4136288_+	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	65.6	1.0e-69
WP_052698822.1|4137932_4138232_+	hypothetical protein	NA	B5TK82	Pseudomonas_phage	51.2	2.5e-13
WP_045791903.1|4138282_4138816_+	glycoside hydrolase family 19 protein	NA	A0A059VA40	Pseudomonas_phage	76.3	7.2e-72
WP_021492479.1|4138812_4139343_+	lysozyme	NA	A0A2H4IZW4	uncultured_Caudovirales_phage	73.3	4.2e-56
WP_045791904.1|4139329_4140016_-	hypothetical protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	93.3	5.9e-127
WP_045791905.1|4140043_4140403_-	hypothetical protein	NA	A0A2H4IZV2	uncultured_Caudovirales_phage	63.1	7.5e-33
WP_021492476.1|4140500_4140707_-	hypothetical protein	NA	A0A2D1GNR5	Pseudomonas_phage	60.7	3.5e-11
WP_010209410.1|4141061_4141916_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.9	2.4e-29
4140925:4140944	attR	TTAGGAGTATGGATCAGAAA	NA	NA	NA	NA
WP_010209411.1|4143075_4144386_+	trigger factor	NA	NA	NA	NA	NA
WP_021492827.1|4144477_4145113_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.1	9.8e-60
WP_010209414.1|4145225_4146509_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.7	2.1e-138
WP_010209415.1|4146683_4149080_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.6	7.1e-220
WP_003174819.1|4149228_4149501_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	1.8e-18
WP_042572097.1|4149730_4151605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074900423.1|4151704_4152229_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_045791906.1|4152175_4153381_-	MFS transporter	NA	NA	NA	NA	NA
WP_045791907.1|4153500_4154400_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010209420.1|4154489_4155263_+	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_042572099.1|4155264_4157925_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_010209424.1|4158071_4158542_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021492823.1|4158583_4159600_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_042572100.1|4159933_4160962_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021492821.1|4160958_4162089_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_021492820.1|4162302_4164342_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_042572102.1|4164399_4165284_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_021492818.1|4165273_4165831_-	cytochrome b	NA	NA	NA	NA	NA
WP_042572103.1|4165945_4166773_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_044287389.1|4166801_4167911_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_010209434.1|4168024_4168885_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045791908.1|4168854_4169751_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010209437.1|4170006_4171332_+	MFS transporter	NA	NA	NA	NA	NA
WP_010209440.1|4171441_4172149_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_045791909.1|4172265_4173558_-	protein kinase	NA	NA	NA	NA	NA
WP_045791910.1|4173597_4174692_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_021492813.1|4174880_4175405_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_045791911.1|4175398_4175941_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_010209446.1|4175959_4176502_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_045791912.1|4176504_4176993_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_021492811.1|4177018_4177807_+	molecular chaperone	NA	NA	NA	NA	NA
WP_045791913.1|4177922_4180241_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_106119374.1|4180291_4181212_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP005975	Pseudomonas simiae strain PICF7 chromosome, complete genome	6136735	4312717	4322692	6136735	protease,tRNA	uncultured_Caudovirales_phage(71.43%)	12	NA	NA
WP_010209612.1|4312717_4313998_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.6	1.6e-96
WP_010209614.1|4313998_4315393_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_045791935.1|4315498_4316494_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_045791936.1|4316582_4317584_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	85.7	3.0e-164
WP_045791937.1|4317580_4317916_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	74.8	9.8e-43
WP_010209618.1|4317912_4318191_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	57.6	9.9e-25
WP_042572148.1|4318190_4318541_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	66.9	4.4e-38
WP_021492753.1|4318542_4318935_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	84.5	1.8e-56
WP_045791938.1|4319092_4320274_+	CoA transferase	NA	NA	NA	NA	NA
WP_010209629.1|4320379_4320874_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_010209630.1|4321002_4321605_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_010209631.1|4321867_4322692_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	71.6	3.4e-105
