The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009031	Xanthomonas citri pv. citri strain AW13 chromosome, complete genome	5321148	1204499	1265724	5321148	transposase,integrase	Escherichia_phage(50.0%)	47	1241045:1241104	1274786:1274850
WP_015471710.1|1204499_1205891_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015471711.1|1206250_1206712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015471712.1|1207113_1207338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031423910.1|1207726_1208206_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_015471714.1|1208507_1208978_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_015471715.1|1209666_1209867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039583006.1|1210413_1211073_+	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_015471718.1|1211108_1213688_+	AHH domain-containing protein	NA	NA	NA	NA	NA
WP_102097774.1|1213851_1214055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015471721.1|1215280_1216792_+	site-specific DNA-methyltransferase	NA	A0A220NUF4	Escherichia_phage	39.2	7.8e-63
WP_015471722.1|1216794_1219440_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_041471192.1|1219451_1220516_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_031423901.1|1220864_1221668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016850722.1|1221947_1222433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471495.1|1222750_1223761_+|transposase	IS21-like element ISXci1 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.9	2.4e-76
WP_015471496.1|1223760_1224543_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.3	5.1e-74
WP_039582703.1|1225829_1226222_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	42.5	3.2e-13
WP_015471729.1|1227628_1227955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471730.1|1228214_1229804_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_015471731.1|1229847_1230216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015463531.1|1231211_1231871_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_003490667.1|1231981_1232374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003490669.1|1232464_1232857_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011052136.1|1233486_1235619_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011052133.1|1237178_1237655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003490678.1|1237680_1238358_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_003490680.1|1238350_1239685_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_087943921.1|1239899_1241044_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
1241045:1241104	attL	GGACACCTCCGAATCAGCCATTTTCCATGGCCTTGAGATGTCTAGGAAATCCTGGGCGTA	NA	NA	NA	NA
WP_075150055.1|1241057_1241423_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_108722298.1|1242057_1246590_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011052129.1|1246804_1247413_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003491180.1|1247426_1248290_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_040107659.1|1248296_1249553_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_015471735.1|1249909_1250350_+	pilin	NA	NA	NA	NA	NA
WP_015463526.1|1250459_1250915_+	pilin	NA	NA	NA	NA	NA
WP_041471193.1|1250978_1252715_+	type IV-A pilus assembly ATPase PilB	NA	NA	NA	NA	NA
WP_005915819.1|1253208_1253328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005930970.1|1253849_1255244_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_003488599.1|1255568_1257182_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_005915812.1|1257413_1258583_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005921370.1|1258607_1259483_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_011052123.1|1259569_1260085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011052122.1|1260039_1261155_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_015463521.1|1261382_1261673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011052119.1|1262997_1263888_-	hypothetical protein	NA	A0A1X9IAR5	Xanthomonas_phage	26.6	3.3e-05
WP_080936670.1|1264021_1264450_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_015471740.1|1264713_1265724_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.5	3.0e-71
1274786:1274850	attR	TACGCCCAGGATTTCCTAGACATCTCAAGGCCATGGAAAATGGCTGATTCGGAGGTGTCCATGAG	NA	NA	NA	NA
>prophage 2
NZ_CP009031	Xanthomonas citri pv. citri strain AW13 chromosome, complete genome	5321148	1269310	1309546	5321148	capsid,transposase,tail,holin,portal,integrase,plate,head,terminase	Stenotrophomonas_phage(62.86%)	51	1265361:1265387	1285468:1285494
1265361:1265387	attL	TCTGCTGACCCGGGGGCGTCTCGAAGC	NA	NA	NA	NA
WP_011050684.1|1269310_1270891_-|terminase	phage terminase large subunit	terminase	A0A2R2ZGE7	Ralstonia_phage	55.1	6.2e-172
WP_015462922.1|1270890_1271136_-	hypothetical protein	NA	M1IPP2	Pelagibacter_phage	39.0	3.5e-05
WP_011050686.1|1271132_1271405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144061724.1|1271412_1271892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015462923.1|1271876_1273901_-	hypothetical protein	NA	A0A166Y926	Gordonia_phage	37.9	3.8e-12
WP_171843832.1|1273911_1274847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087943921.1|1274845_1275989_+|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_040237382.1|1277106_1278297_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	56.3	1.3e-124
WP_041471194.1|1278296_1278518_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	57.7	5.7e-15
WP_167325135.1|1278720_1278993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471749.1|1278989_1279214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471750.1|1279210_1279483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157882625.1|1279481_1279649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040237431.1|1279650_1280076_-	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	45.2	3.6e-18
WP_015471753.1|1280153_1280426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167325136.1|1280425_1280713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471755.1|1280709_1280928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471756.1|1281251_1283948_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.6	0.0e+00
WP_080766933.1|1284166_1284367_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_008572766.1|1284454_1284775_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	58.7	2.0e-24
WP_008572763.1|1284777_1285035_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	44.6	6.6e-07
WP_015471761.1|1286140_1287130_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	4.7e-93
1285468:1285494	attR	GCTTCGAGACGCCCCCGGGTCAGCAGA	NA	NA	NA	NA
WP_015471762.1|1287126_1287528_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	63.6	2.1e-39
WP_015471763.1|1287540_1290411_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	46.6	1.6e-186
WP_005922203.1|1290440_1290554_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_008572745.1|1290562_1290865_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	2.2e-25
WP_015471764.1|1290910_1291420_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	78.7	8.9e-72
WP_015471765.1|1291449_1292616_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	E5FFG9	Burkholderia_phage	63.9	2.9e-134
WP_015471766.1|1292627_1292987_-	GPW/gp25 family protein	NA	V9IQW0	Stenotrophomonas_phage	64.4	5.6e-36
WP_015471768.1|1293689_1294364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040237406.1|1294365_1294659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471770.1|1294736_1296536_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	39.2	4.3e-84
WP_015471771.1|1296548_1297094_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	56.5	4.9e-52
WP_015471772.1|1297086_1297977_-|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	8.0e-84
WP_015471773.1|1298076_1298454_-	response regulator	NA	NA	NA	NA	NA
WP_108723646.1|1298530_1299820_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_015471775.1|1299836_1300220_-	response regulator	NA	NA	NA	NA	NA
WP_015471776.1|1300343_1300793_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	55.4	2.4e-36
WP_015471777.1|1300780_1301200_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	1.5e-40
WP_015471778.1|1301196_1301685_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.9	1.3e-27
WP_015471779.1|1301684_1302323_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	5.1e-48
WP_015471780.1|1302322_1302598_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	2.3e-21
WP_005929454.1|1302590_1302947_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
WP_005917735.1|1302951_1303161_-|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_011038096.1|1303160_1303628_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.0	2.7e-30
WP_011038095.1|1303726_1304446_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	62.8	7.7e-69
WP_011038094.1|1304449_1305466_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.1	8.4e-138
WP_015471781.1|1305514_1306357_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.7	1.9e-66
WP_045716312.1|1306499_1308263_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	77.4	1.1e-270
WP_015471783.1|1308262_1309276_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.4	4.0e-140
WP_015471784.1|1309300_1309546_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	53.8	3.7e-15
>prophage 3
NZ_CP009031	Xanthomonas citri pv. citri strain AW13 chromosome, complete genome	5321148	1771384	1853372	5321148	transposase,integrase	Escherichia_phage(27.27%)	59	1771325:1771384	1809279:1810205
1771325:1771384	attL	TACGCCCAGGATTTCCTAGACATCTCAAGGCCATGGAAAATGGCTGATTCGGAGGTGTCC	NA	NA	NA	NA
WP_087943921.1|1771384_1772528_+|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_015471900.1|1773315_1773588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040237032.1|1773825_1774149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011051352.1|1774145_1774682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471901.1|1774877_1775204_+	hypothetical protein	NA	S0F2N2	Stenotrophomonas_phage	43.0	9.3e-14
WP_015471902.1|1775270_1775582_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	88.3	1.4e-46
WP_015471903.1|1775601_1776936_-	filamentous phage phiLf protein	NA	Q4LAU4	Stenotrophomonas_phage	57.0	4.3e-134
WP_015471904.1|1776937_1777258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471906.1|1778596_1778725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471907.1|1778751_1779003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471908.1|1779006_1779285_-	hypothetical protein	NA	S0F2M9	Stenotrophomonas_phage	70.3	5.4e-31
WP_041471200.1|1779263_1780292_-	replication initiation factor domain-containing protein	NA	S0F3F7	Stenotrophomonas_phage	71.4	1.9e-145
WP_015471910.1|1780337_1780511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471911.1|1780507_1780732_-	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	89.9	4.7e-25
WP_157733693.1|1780958_1781270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003490402.1|1781301_1782105_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.7	4.0e-10
WP_011051350.1|1782146_1783673_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_015463185.1|1783669_1785034_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_040237021.1|1785326_1785995_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003490411.1|1785991_1786594_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_015463183.1|1786590_1787349_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_040237019.1|1787336_1787855_-	dehydrogenase	NA	NA	NA	NA	NA
WP_015463181.1|1788721_1789312_-	class I SAM-dependent methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	36.0	2.8e-08
WP_040107619.1|1789597_1790077_-	BLUF domain-containing protein	NA	NA	NA	NA	NA
WP_040107618.1|1790398_1790815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041471201.1|1791058_1792888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003489210.1|1792901_1793501_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_003489213.1|1793589_1793946_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_005931423.1|1793942_1794365_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_003489216.1|1794630_1795449_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_015471919.1|1795742_1797554_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_003489220.1|1797586_1798573_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_040237014.1|1798982_1802639_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_003489223.1|1803087_1803735_-	response regulator	NA	NA	NA	NA	NA
WP_011051338.1|1803973_1804720_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011051337.1|1804819_1805185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003489230.1|1805244_1805676_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011051335.1|1805686_1806949_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011051334.1|1806932_1808225_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_015471922.1|1808534_1809278_+|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	35.6	1.0e-07
WP_087947478.1|1810274_1811361_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.7e-43
1809279:1810205	attR	TACGCCCAGGATTTCCTAGACATCTCAAGGCCATGGAAAATGGCTGATTCGGAGGTGTCCATGAGCAGTAAGCGGTATACGGATGAGTTCAAGATCGAGGCGGTCCGGCAAGTGACCGATCGTGGGTTCAAGGTGGCAGAGGTCGCCGAGCGACTGGGTGTCACCACGCACAGCCTGTACGCTTGGCTGCGCAAGTTCGGCAAGCCCGGCGTAGTACAGCGCGCTGAGGCGGACCAGAGCGCCGAAGTCCGGCGGCTGAAGATCGAGTTGCGCCGGGTGACGGAGGAGCGCGACATCCTAAAAAAGGCCGCCGCGTACTTTGCCAAGGGGTAAAGGCAAAGTACCTCTTCATGCAAGTCCACCGCGAAGAATTCAGGGTGTGCGCGATGTGCCGGGTTTTGCGGGTGAACCGGGCTGGATACTACGCGTGGCTAAAGTCGCCCGACAGTGAACGCGCCAAGGAAGACGAACGCCTGCTGGGGCTGATCAAGCACCACTGGTTGGCCAGCGGCAGTGTCTATGGGCATCGCAAGATTGCCAAGGATCTACGCGATCTGGGTGAGCGTTGCAGTCGCCATCGGGTGCATCGATTGATGCGCACCGAGGGACTGCGTGCCCAGGTGGGCTATGGCCGCAAGCCGCGCTTCCATGGCGGAACGCCGTGCAAGGCGGCAGCCAACCTGCTGGATCGACAGTTCGACGTGACCGAGCCGGACACGGCCTGGGCGAGCGACTTCACCTTCATCCGTACGCATGAAGGCTGGATGTACCTGGCTGTGGTGATCGATCTGTTTTCCAGGCAGGTCGTCGGCTGGGCGATGCGCGATCGAGCCGATACCGAGTTGGTCGTGCAGGCCTTGCTGTCGGCGGTGTGGCGGCGCAAACCCAGCGCTGGTTGCCTGGTTCATTCGGACCAGGGGTCTGTCT	NA	NA	NA	NA
WP_058958684.1|1817398_1822099_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.4	5.2e-81
WP_015471930.1|1824781_1825705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040150316.1|1825704_1827825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078516375.1|1828420_1828750_+	DUF4879 domain-containing protein	NA	I6NTM5	Burkholderia_phage	60.7	1.9e-22
WP_045716313.1|1829360_1830371_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.9	2.0e-75
WP_015471935.1|1830370_1831153_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	53.4	1.2e-70
WP_015471936.1|1831557_1832067_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_015471937.1|1832283_1833045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471938.1|1833046_1834906_-	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_015471939.1|1834908_1838943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015471940.1|1839149_1843511_-	ATP phosphoribosyltransferase regulatory subunit	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	26.8	2.5e-53
WP_015471496.1|1845596_1846379_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.3	5.1e-74
WP_015471495.1|1846378_1847389_-|transposase	IS21-like element ISXci1 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.9	2.4e-76
WP_015471943.1|1848737_1849784_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	55.7	2.7e-107
WP_015471944.1|1849850_1850048_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	54.8	5.4e-17
WP_015471946.1|1850894_1851077_-	Type IV secretory pathway, VirB10 component	NA	NA	NA	NA	NA
WP_015471496.1|1851579_1852362_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.3	5.1e-74
WP_015471495.1|1852361_1853372_-|transposase	IS21-like element ISXci1 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.9	2.4e-76
>prophage 4
NZ_CP009031	Xanthomonas citri pv. citri strain AW13 chromosome, complete genome	5321148	4829698	4837736	5321148		Enterobacteria_phage(42.86%)	7	NA	NA
WP_005913455.1|4829698_4831045_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	7.5e-33
WP_011052370.1|4831092_4832496_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	6.5e-48
WP_011052371.1|4832773_4833940_-	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	57.8	8.0e-116
WP_005929612.1|4834279_4835179_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.6e-26
WP_011052372.1|4835175_4835733_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	4.6e-45
WP_005929617.1|4835729_4836617_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.8	3.5e-95
WP_011052374.1|4836680_4837736_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.7	1.6e-83
>prophage 5
NZ_CP009031	Xanthomonas citri pv. citri strain AW13 chromosome, complete genome	5321148	5040693	5104072	5321148	capsid,transposase,tail,holin,portal,tRNA,integrase,plate,head,terminase	Stenotrophomonas_phage(55.0%)	70	5051365:5051382	5089964:5089981
WP_015471495.1|5040693_5041704_-|transposase	IS21-like element ISXci1 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.9	2.4e-76
WP_087943921.1|5042354_5043498_+|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
WP_164675129.1|5044199_5044361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040149985.1|5044394_5044712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015472820.1|5045148_5045628_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	36.9	8.0e-14
WP_015472821.1|5045627_5046914_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	42.4	3.7e-82
WP_015472824.1|5047837_5048494_+	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
5051365:5051382	attL	AGCGCAGCAGCGGCCGCA	NA	NA	NA	NA
WP_015472826.1|5052336_5052519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045714067.1|5052454_5053195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015472828.1|5053229_5053940_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	75.7	1.5e-104
WP_080633694.1|5053857_5054103_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	2.4e-14
WP_015472829.1|5054128_5055151_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.8	1.4e-140
WP_015472830.1|5055150_5056914_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	77.8	2.9e-271
WP_015472831.1|5057056_5057899_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.7	2.4e-66
WP_015472832.1|5057945_5058959_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.7	1.2e-136
WP_015472833.1|5058962_5059682_+|terminase	phage-related terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.6	5.3e-70
WP_015472834.1|5059780_5060248_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	1.8e-31
WP_005917735.1|5060247_5060457_+|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_005917737.1|5060461_5060818_+	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	5.9e-22
WP_015471780.1|5060810_5061086_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	2.3e-21
WP_015472835.1|5061085_5061724_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	63.3	6.4e-51
WP_015472836.1|5061723_5062212_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	53.1	6.9e-29
WP_015472837.1|5062208_5062628_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	64.4	2.2e-39
WP_015472838.1|5062615_5063074_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	55.6	7.6e-38
WP_015472839.1|5063102_5064320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015472840.1|5064572_5065463_+|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	54.1	9.5e-85
WP_015472841.1|5065455_5066001_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	56.6	1.4e-51
WP_015472842.1|5066013_5067813_+	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	38.1	1.7e-80
WP_040152954.1|5067885_5068179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015472844.1|5068181_5068856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015472845.1|5068998_5069562_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	47.0	9.7e-27
WP_015472846.1|5069558_5069918_+	GPW/gp25 family protein	NA	V9IQW0	Stenotrophomonas_phage	64.4	1.2e-35
WP_015472847.1|5069929_5071096_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	E5FFG9	Burkholderia_phage	63.3	2.1e-132
WP_015472848.1|5071125_5071635_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.3	1.4e-72
WP_011038109.1|5071680_5071983_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	3.7e-25
WP_005922203.1|5071991_5072105_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_015472852.1|5075024_5075426_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	59.1	1.9e-37
WP_015472853.1|5075422_5076409_+	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	56.3	7.7e-96
WP_015472855.1|5077016_5077448_-	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	33.1	4.1e-09
WP_076605106.1|5077521_5077782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015472857.1|5077784_5078105_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.8	7.4e-24
WP_015472858.1|5078115_5078394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015472859.1|5078390_5078603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015472860.1|5078612_5081357_+	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	68.5	0.0e+00
WP_015471496.1|5081440_5082223_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	55.3	5.1e-74
WP_015471495.1|5082222_5083233_-|transposase	IS21-like element ISXci1 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.9	2.4e-76
WP_015472861.1|5083672_5083891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015472862.1|5083887_5084175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015472863.1|5084174_5084447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015472864.1|5084525_5084951_+	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	47.4	3.3e-19
WP_014091203.1|5084943_5085126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015472865.1|5085118_5085391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008572787.1|5085387_5085612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026006879.1|5085608_5085881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016849275.1|5086083_5086308_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	64.3	3.4e-15
WP_015472867.1|5086307_5087495_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	52.1	7.1e-112
WP_011052523.1|5088132_5088453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015472868.1|5088645_5090523_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.4e-37
5089964:5089981	attR	AGCGCAGCAGCGGCCGCA	NA	NA	NA	NA
WP_003484398.1|5090631_5091072_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_172407044.1|5091070_5092087_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_003484403.1|5092254_5092776_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011052524.1|5093021_5094155_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	40.9	4.7e-28
WP_003484425.1|5094293_5094770_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_015472870.1|5094766_5096272_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_076605107.1|5096556_5097615_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_015472872.1|5097615_5098440_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015472873.1|5098623_5099901_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011052530.1|5100066_5101788_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011052531.1|5101838_5103149_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_005921922.1|5103148_5104072_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
