The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010065	Burkholderia mallei strain 2002721276 chromosome 1, complete sequence	3542936	353065	420299	3542936	transposase,portal,tRNA,protease	Leptospira_phage(15.0%)	59	NA	NA
WP_038802950.1|353065_354185_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198375.1|354589_355726_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_004198376.1|355722_356064_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004198377.1|356791_358441_+	GMC family oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	30.9	2.0e-56
WP_004198379.1|358525_359323_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	28.8	3.3e-12
WP_004198380.1|359368_360178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198382.1|360188_360581_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004198383.1|360636_362142_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004197126.1|362358_363618_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004197127.1|363622_364501_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197128.1|364497_365547_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197129.1|365543_366266_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	3.8e-07
WP_004538585.1|366638_367370_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.3	1.6e-05
WP_004199873.1|367492_368452_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004197133.1|368851_369952_-	porin	NA	NA	NA	NA	NA
WP_004197137.1|370489_373519_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	38.7	2.2e-181
WP_004197139.1|373559_375575_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.5	3.3e-85
WP_004197141.1|375829_376012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197145.1|376047_377208_-	porin	NA	NA	NA	NA	NA
WP_004197150.1|377502_378180_-	response regulator	NA	NA	NA	NA	NA
WP_004197153.1|378190_379570_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004201276.1|379647_380496_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004199877.1|380523_381321_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	3.5e-30
WP_004199878.1|381404_382418_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004199879.1|382575_383097_-	DUF2938 domain-containing protein	NA	NA	NA	NA	NA
WP_004199880.1|383089_383965_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004199881.1|384046_384475_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004201278.1|384794_385577_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_004199882.1|385695_385968_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_038802950.1|386592_387713_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197759.1|388090_388645_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_004197761.1|388846_389263_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004190110.1|389664_390759_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004200726.1|390755_391697_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004200727.1|391856_393470_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004189592.1|393488_394937_-	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_045607219.1|395200_395749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189874.1|396335_396905_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004189434.1|397007_397976_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201742.1|398118_399213_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190014.1|399241_400354_+	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_004189258.1|400364_401240_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_004200729.1|401376_401787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200730.1|402185_403277_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	92.3	2.0e-193
WP_004188977.1|403349_403634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200731.1|403630_404113_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|404164_405285_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004187628.1|406601_407822_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_004200732.1|408212_408617_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004189208.1|408654_409524_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004188904.1|409644_410661_-	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189230.1|411110_412166_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004200734.1|412387_414997_-	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004190199.1|415207_415579_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004190020.1|415638_416829_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004201745.1|417057_417561_+	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.7e-12
WP_004200737.1|417592_418576_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004189288.1|418696_419332_+	LysE family translocator	NA	NA	NA	NA	NA
WP_004189409.1|419441_420299_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 2
NZ_CP010065	Burkholderia mallei strain 2002721276 chromosome 1, complete sequence	3542936	533861	604462	3542936	terminase,protease,portal,transposase,tRNA	Burkholderia_phage(15.38%)	53	NA	NA
WP_004199890.1|533861_534383_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_004199888.1|534604_535102_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	100.0	2.6e-55
WP_004199886.1|535098_536154_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	99.4	5.7e-206
WP_004202809.1|536197_536554_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_004199884.1|536556_536853_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	98.0	2.8e-49
WP_038802950.1|537660_538780_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004524586.1|538862_540266_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_004198812.1|540603_541023_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004198813.1|541179_542856_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_004198815.1|542864_543134_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	53.6	2.1e-16
WP_038717892.1|543213_543681_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004198824.1|543697_543832_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_076805040.1|544124_545879_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004196275.1|546041_547145_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.0	1.7e-46
WP_004196276.1|547333_549802_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.4	9.3e-114
WP_038802950.1|550327_551447_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004189051.1|551492_551807_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_045607223.1|552076_557554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190201.1|558131_561398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526091.1|561992_562319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189582.1|562600_562942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189157.1|563001_563379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024900447.1|563665_564040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189347.1|564280_564526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189885.1|564522_564876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190190.1|565144_566143_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_004196288.1|566153_570233_+	TOMM system kinase/cyclase fusion protein	NA	A0A2R8FF19	Brazilian_cedratvirus	27.2	3.6e-14
WP_004196290.1|570229_570592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189426.1|570593_570956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188975.1|571047_573339_+	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_004189420.1|573408_574185_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_004190102.1|574667_577031_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004189631.1|577217_578486_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_004190084.1|578562_579759_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004189311.1|579793_581386_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	27.5	2.1e-42
WP_004189783.1|581382_582033_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004189578.1|581999_582392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189296.1|582410_583652_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004189079.1|583679_584414_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004526108.1|585158_586547_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011807778.1|586601_588578_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004196300.1|588574_591094_-	glycoside hydrolase family 2 protein	NA	NA	NA	NA	NA
WP_004196302.1|591090_592179_-	DUF1839 family protein	NA	NA	NA	NA	NA
WP_004189723.1|592175_593150_-	amino acid--[acyl-carrier-protein] ligase	NA	NA	NA	NA	NA
WP_004189634.1|593146_594370_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_004189564.1|594366_594618_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_004189328.1|594862_595657_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189279.1|596580_597390_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201440.1|597422_598805_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_004188934.1|598876_600166_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_004201442.1|600346_601591_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004189146.1|601619_602642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191998.1|603000_604462_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
>prophage 3
NZ_CP010065	Burkholderia mallei strain 2002721276 chromosome 1, complete sequence	3542936	1948116	2022913	3542936	transposase,tRNA	Leptospira_phage(25.0%)	57	NA	NA
WP_004191232.1|1948116_1950024_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.5	1.7e-123
WP_071810680.1|1950073_1950598_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	28.7	4.1e-11
WP_004191477.1|1950790_1950988_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004192938.1|1951018_1951378_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004191909.1|1951526_1952540_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	7.8e-27
WP_004193113.1|1952627_1955060_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004197408.1|1955132_1955537_+	integration host factor subunit alpha	NA	A0A1P8CWT5	Bacillus_phage	41.1	2.8e-12
WP_004526841.1|1955595_1956000_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004193951.1|1956121_1958242_-	lipoprotein	NA	NA	NA	NA	NA
WP_004192528.1|1958866_1960069_-	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
WP_096325434.1|1960424_1961545_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004205956.1|1962160_1963366_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_038802950.1|1964185_1965305_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193694.1|1965706_1965997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191628.1|1966046_1966304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192834.1|1966452_1966731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192638.1|1966969_1967692_-	YdcF family protein	NA	NA	NA	NA	NA
WP_004199444.1|1967892_1968210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521676.1|1968368_1968626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199443.1|1968831_1969233_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004193481.1|1969651_1970554_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	4.5e-10
WP_004191876.1|1972363_1974028_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004193908.1|1974332_1974794_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004193517.1|1974790_1976266_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004197388.1|1976357_1979285_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	5.2e-23
WP_004199441.1|1979390_1979759_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_011203915.1|1979785_1980721_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004193982.1|1980991_1982551_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004192058.1|1982573_1983809_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004191557.1|1983876_1985373_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192835.1|1985472_1985970_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191941.1|1986169_1986310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193111.1|1986262_1988089_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_004191889.1|1988427_1991292_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_004192735.1|1991419_1992694_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_004191219.1|1992793_1994224_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-42
WP_004550551.1|1994330_1995428_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004191720.1|1995622_1996033_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004193599.1|1996269_1996731_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011203914.1|1996974_1998654_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004192734.1|1998804_2000070_-	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004191362.1|2000119_2001673_-	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004521662.1|2001572_2001887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2002178_2003299_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197788.1|2003386_2004562_+	carbamoyltransferase	NA	E3SL71	Synechococcus_phage	35.9	1.8e-46
WP_004192661.1|2004686_2007059_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_162473478.1|2007227_2007476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191146.1|2008504_2008651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193126.1|2008650_2009316_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004552809.1|2009613_2009997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073699454.1|2010555_2010738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197781.1|2011454_2014493_-	membrane protein	NA	NA	NA	NA	NA
WP_044302806.1|2014636_2014834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193791.1|2015664_2016636_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004193303.1|2016626_2019128_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004191349.1|2019185_2019956_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004187628.1|2021692_2022913_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
>prophage 4
NZ_CP010065	Burkholderia mallei strain 2002721276 chromosome 1, complete sequence	3542936	2113258	2190776	3542936	transposase,coat,tRNA	Klosneuvirus(20.0%)	60	NA	NA
WP_004191922.1|2113258_2116126_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	2.8e-146
WP_004192544.1|2116212_2117094_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.9	1.9e-69
WP_004526815.1|2117154_2117772_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_004191850.1|2117860_2120254_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_004192128.1|2120264_2121629_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004193573.1|2121625_2122330_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192096.1|2122657_2123044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193727.1|2123319_2123550_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_004192573.1|2123714_2124752_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004193713.1|2124764_2125784_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_004191536.1|2125776_2126658_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004192875.1|2126902_2127952_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004192697.1|2128052_2129198_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004193469.1|2129210_2130011_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	1.3e-13
WP_004191266.1|2130024_2132025_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_004196072.1|2132035_2134021_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_004192432.1|2134017_2134938_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_004193903.1|2134937_2135741_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_004193939.1|2135857_2136562_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_011203894.1|2136558_2138844_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FFL6	Cedratvirus	26.2	2.4e-07
WP_004191272.1|2138836_2139772_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004193685.1|2139776_2140226_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004196068.1|2140126_2140471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192588.1|2140467_2141616_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004193399.1|2141831_2142167_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_004193543.1|2142266_2142818_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004196065.1|2143109_2143787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2146492_2147613_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_011807697.1|2147643_2148360_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_004192193.1|2148506_2149472_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191158.1|2149975_2152600_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	5.5e-80
WP_080938992.1|2152917_2153148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204969.1|2153249_2154470_+	CoA transferase	NA	NA	NA	NA	NA
WP_004534928.1|2154793_2155003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193654.1|2155280_2156990_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.5	8.8e-188
WP_004192426.1|2157321_2157804_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	3.7e-19
WP_004193860.1|2157822_2158209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196725.1|2160510_2160690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192265.1|2160686_2161547_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_004191662.1|2161590_2163006_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_004193177.1|2163239_2164823_+	acid phosphatase	NA	NA	NA	NA	NA
WP_004192836.1|2165020_2166214_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_004191546.1|2166832_2168020_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004192651.1|2168192_2169812_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004192810.1|2171801_2172434_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004552891.1|2172434_2174516_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.8	1.7e-12
WP_004196717.1|2174926_2175892_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191504.1|2178364_2179204_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004526783.1|2179221_2179746_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|2179822_2180383_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004192149.1|2180435_2180981_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004542449.1|2180967_2181153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531175.1|2181238_2181460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196705.1|2181797_2182691_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196700.1|2183197_2184394_+	MFS transporter	NA	NA	NA	NA	NA
WP_004192394.1|2184438_2185431_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004193855.1|2185898_2186180_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004191144.1|2186432_2186702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193170.1|2187596_2188910_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_038802950.1|2189656_2190776_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 5
NZ_CP010065	Burkholderia mallei strain 2002721276 chromosome 1, complete sequence	3542936	2390816	2454782	3542936	transposase,tRNA,protease	Streptococcus_phage(27.78%)	57	NA	NA
WP_004191998.1|2390816_2392280_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189921.1|2392389_2393361_-	thymidylate synthase	NA	A0A1V0DY05	Yersinia_phage	36.1	2.9e-47
WP_004189039.1|2393417_2394803_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_080939002.1|2394764_2395031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2395041_2396162_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004189413.1|2396541_2396778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189886.1|2397090_2397276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011807762.1|2397272_2398208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004195961.1|2398448_2400263_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189313.1|2400470_2400974_+	dihydrofolate reductase	NA	A0A0A0PL85	Bacillus_phage	40.4	9.6e-26
WP_004191998.1|2401102_2402566_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004188997.1|2402702_2404073_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_004195962.1|2404218_2404827_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_004195963.1|2404843_2405428_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_004189767.1|2405675_2406281_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	4.2e-28
WP_004189931.1|2406399_2407665_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004189924.1|2407661_2408606_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_004189573.1|2408674_2408992_+	lipoprotein	NA	NA	NA	NA	NA
WP_004195964.1|2409158_2410097_-	CobD/CbiB family protein	NA	NA	NA	NA	NA
WP_004189888.1|2410197_2410851_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_004190182.1|2411810_2412401_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004189360.1|2412714_2413104_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_004189914.1|2413241_2414036_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004195969.1|2414037_2414727_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004189402.1|2414771_2415026_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004189308.1|2416466_2416934_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_004189906.1|2416968_2418126_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_004188962.1|2418234_2418723_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004189387.1|2418870_2420157_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004189890.1|2422172_2423108_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_004189750.1|2423123_2423873_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011807766.1|2424099_2424894_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004189862.1|2424967_2425621_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004190044.1|2425610_2426645_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	6.8e-34
WP_004190087.1|2426953_2427796_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
WP_004188957.1|2428138_2429062_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_004195984.1|2429240_2430536_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004532363.1|2430761_2431664_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_004189725.1|2431987_2432305_-	competence protein ComE	NA	NA	NA	NA	NA
WP_004190173.1|2432376_2433369_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004200795.1|2433427_2434414_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.5	8.8e-15
WP_004189214.1|2434382_2435783_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
WP_004188993.1|2435903_2437073_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004195986.1|2437125_2437419_-	LapA family protein	NA	NA	NA	NA	NA
WP_004191998.1|2437654_2439118_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189865.1|2439236_2439560_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	38.9	4.7e-10
WP_004189285.1|2439582_2441295_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004189396.1|2441439_2442126_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_096325444.1|2442146_2444369_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004190098.1|2444572_2445655_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_004189993.1|2445689_2446772_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.2	8.5e-88
WP_004189806.1|2446945_2447542_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_004189243.1|2447640_2450241_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.8	9.5e-101
WP_004189892.1|2450751_2451426_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004532296.1|2451594_2452293_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_004190123.1|2452318_2453044_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_038802950.1|2453662_2454782_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 6
NZ_CP010065	Burkholderia mallei strain 2002721276 chromosome 1, complete sequence	3542936	2489645	2509152	3542936	transposase,integrase	Leptospira_phage(42.86%)	15	2491344:2491403	2493880:2495078
WP_004186184.1|2489645_2490866_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	6.6e-238
2491344:2491403	attL	GGTGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACT	NA	NA	NA	NA
WP_038802950.1|2491392_2492513_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004189968.1|2492543_2493215_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	46.1	1.3e-46
WP_038802950.1|2493928_2495049_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004189780.1|2495263_2495842_-	pseudouridine synthase	NA	NA	NA	NA	NA
2493880:2495078	attR	GGTGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCCTGGAAAGCGGCAGGAGCGTCCGCGGTTGCCCGATGTTTCGCCGCAAACTCTGACGGCGCAAGGTAGTTCAGTGCGCTGTGCGGCCTTTGCTCGTTGTAGTCCTGACGCCATGCCGCGATGACTGCCCGAGCGTGCGCGAGCGTCGTGAACCAGTGCTCGTTAAGGCATTCGTCGCGGAACTTGCCGTTGAACGATTCGATGTACGCATTCTGCGTGGGCTTGCCCGCCTGAATCAACTTCAGCGTGACGCCGTTCGCATACGCCCACTGGTCAAGCGCGCGGCTCGTAAATTCGGGTCCCTGGTCTGTTCGCACCGCCTTGGGATAGCCACGGAAGCGAGCTGCACGGTCCAATGCCCGAGCGACATACAAACCTGAGATGCCATGGTCGACGACGATGTCGACAGCCTCTTTCGTGAAATCGTCGACGACGGTCAGGCACTTCACGCGCCGGCCGTTGGAAAGCGCATCCATCACGAAATCGATTGACCATACCTCGTTGGGTGCGCCCGGCAATGCCAGTTGCTCGCGCTCAATCATGACGCCGTGGCGCTTGCGACGGCGCCGCACAGCCAGCCCTGCCTCACGGTACAGGCGATAGATGCGCTTGTGATTGGCGTGCGTGCCTTCGCGTTCCACCAGGGCGTGCAGTCGGCGGTAGCCGAATCGACGACGTTCGTGCGCCAACTTCACCAGACGCGCCGCGAGCACCTCATTCTCGTGGTCCGGCTTCGCGTCGTAATGCAGCACGCTGCGAGAAAGCCCGACAAGCCGGCAGGCGCGGCGCTCGGAGATGTTGACCTTCTCCCGAATCGCCAACACTGCTTCGCGTTTGGCTTGCGGGCTCAGGGCTTTCCCTTGACGACAACCTTCAACGCTTCCATATCGAGCATTGCTTCGGCCAGCAGTTTCTTCAGTCGGGCATTCTCCACCTCGAGGCCCTTGAGCCGGCGGGCTTCCGAGACTTCCATGCCGCCGAACTTCGCGCGCCAGGTGTAGAACGACGCGTCACTGAACCCATGCTTCCTGCACAGTTCCTTGACCGGCATACCGGCCTCGGCTTCCTTCAGAAACCCGATGATTTGCTGTTCCGTAAAGCGCTTCTTCATGTTCGTCTTCTTCTCCGAAAACGAACTTT	NA	NA	NA	NA
WP_004189552.1|2496109_2497369_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189626.1|2497341_2497524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189292.1|2497536_2499147_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004191998.1|2499303_2500767_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189917.1|2503605_2504316_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162473585.1|2504874_2505081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190145.1|2505268_2505775_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004189867.1|2506253_2507648_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_004197806.1|2507662_2507836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2508031_2509152_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 7
NZ_CP010065	Burkholderia mallei strain 2002721276 chromosome 1, complete sequence	3542936	2713391	2780972	3542936	transposase,coat,tRNA,protease	Leptospira_phage(16.67%)	57	NA	NA
WP_011203868.1|2713391_2715569_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.7	1.2e-51
WP_004192130.1|2716051_2716699_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004193796.1|2717080_2718169_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_004191507.1|2718301_2718841_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_004192666.1|2718944_2719514_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.6	1.3e-71
WP_004191939.1|2719616_2721896_+	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_004205947.1|2721898_2722621_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_004193337.1|2722754_2723429_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_004191886.1|2723461_2724871_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_004199402.1|2725039_2727340_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004191842.1|2728043_2728754_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004526328.1|2728761_2729280_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004193822.1|2729653_2730664_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004192784.1|2730836_2731652_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004192680.1|2731834_2732590_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_045607285.1|2732972_2734436_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	1.5e-79
WP_004191560.1|2734581_2737566_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_004199404.1|2737678_2737858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193185.1|2737892_2738882_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_004193146.1|2738881_2740861_+	fused uroporphyrinogen-III synthase HemD/membrane protein HemX	NA	NA	NA	NA	NA
WP_004193604.1|2740865_2742056_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_004192161.1|2742236_2743544_-	MFS transporter	NA	NA	NA	NA	NA
WP_004192728.1|2743582_2744341_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004193515.1|2744429_2745869_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004192356.1|2746029_2746557_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.8	9.0e-51
WP_045607287.1|2746615_2747557_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	43.1	2.2e-07
WP_011807749.1|2747535_2747925_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004192390.1|2748556_2749735_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004198600.1|2749855_2751556_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.8	5.8e-91
WP_004193987.1|2751616_2751955_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_004191758.1|2752423_2753512_-	porin	NA	NA	NA	NA	NA
WP_004553879.1|2754406_2755186_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	3.9e-26
WP_004193161.1|2755208_2755922_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004191164.1|2755918_2756608_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004198602.1|2756818_2757595_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004192043.1|2759022_2759568_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004191521.1|2759809_2760508_+	response regulator	NA	W8CYM9	Bacillus_phage	36.7	2.9e-28
WP_004193003.1|2760491_2761805_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004198606.1|2761878_2762145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192556.1|2762641_2764399_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004192968.1|2764452_2765793_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.2e-32
WP_038802950.1|2766257_2767378_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193468.1|2767487_2767964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200110.1|2768420_2768645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193210.1|2768941_2770078_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_004522511.1|2770175_2770715_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004192840.1|2770887_2771268_+	lipoprotein	NA	NA	NA	NA	NA
WP_004193391.1|2771874_2772144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192184.1|2772301_2772682_+	DUF5594 family protein	NA	NA	NA	NA	NA
WP_004266384.1|2773256_2773769_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_004192472.1|2773892_2775266_+	MFS transporter	NA	NA	NA	NA	NA
WP_004191641.1|2776005_2776617_+	membrane protein	NA	NA	NA	NA	NA
WP_004191763.1|2776789_2777392_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	62.8	2.6e-25
WP_004192381.1|2777384_2778803_-	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_004200093.1|2778937_2779135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193447.1|2779422_2779953_+	lipoprotein	NA	NA	NA	NA	NA
WP_038802950.1|2779852_2780972_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 8
NZ_CP010065	Burkholderia mallei strain 2002721276 chromosome 1, complete sequence	3542936	2841660	2897207	3542936	transposase,tRNA,protease	Leptospira_phage(18.75%)	49	NA	NA
WP_038802950.1|2841660_2842781_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200457.1|2843063_2843552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191998.1|2843853_2845317_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004186453.1|2845439_2846420_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_004186190.1|2846422_2846878_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_004185928.1|2847016_2847853_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004186391.1|2848146_2848380_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004185395.1|2848397_2848565_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_004186553.1|2848621_2850334_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_004185611.1|2850525_2851410_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_004185886.1|2851406_2852543_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_004186237.1|2852711_2853908_-	aminotransferase	NA	NA	NA	NA	NA
WP_004186398.1|2854104_2855457_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004186079.1|2855468_2856731_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_004185746.1|2856727_2857390_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.0	1.6e-25
WP_004535897.1|2857514_2858507_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_004185348.1|2858618_2861456_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.0	1.6e-80
WP_004186086.1|2861455_2861956_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_004186216.1|2862017_2863229_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.9	3.0e-41
WP_004186718.1|2863292_2863739_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	64.4	7.9e-48
WP_004185819.1|2863827_2864610_-	membrane protein	NA	NA	NA	NA	NA
WP_004185697.1|2864774_2865521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2865781_2866901_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_071810810.1|2867068_2867287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|2867484_2867994_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|2868294_2870409_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_038796688.1|2871581_2873060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186341.1|2873604_2874450_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	29.9	3.4e-23
WP_004185897.1|2874618_2875365_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197492.1|2876080_2877442_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004185818.1|2877981_2879421_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_162473466.1|2879864_2880152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200476.1|2880135_2881410_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004185918.1|2881541_2882147_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004186428.1|2882670_2883693_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_004185585.1|2883708_2884236_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004185910.1|2884320_2885076_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186611.1|2885309_2886515_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_096325460.1|2886624_2887745_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004185841.1|2888807_2889386_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.7	1.1e-44
WP_038803007.1|2889582_2890965_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	27.5	1.4e-29
WP_004200482.1|2890959_2891190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555967.1|2891422_2892451_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004196455.1|2892431_2892638_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_004185994.1|2892811_2893603_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004185840.1|2893811_2894474_+	adenylate kinase	NA	NA	NA	NA	NA
WP_004191998.1|2894589_2896053_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004196460.1|2896156_2896360_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|2896892_2897207_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
>prophage 9
NZ_CP010065	Burkholderia mallei strain 2002721276 chromosome 1, complete sequence	3542936	2947353	2956590	3542936		unidentified_phage(16.67%)	7	NA	NA
WP_004194112.1|2947353_2948901_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_004194373.1|2948937_2949465_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004194274.1|2949461_2950145_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194137.1|2950209_2951025_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004194350.1|2951200_2953207_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_004194374.1|2953240_2954371_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194034.1|2954637_2956590_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
>prophage 10
NZ_CP010065	Burkholderia mallei strain 2002721276 chromosome 1, complete sequence	3542936	3358015	3410472	3542936	plate,transposase	Streptococcus_phage(33.33%)	45	NA	NA
WP_004191998.1|3358015_3359479_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_017881675.1|3359602_3359827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189651.1|3360385_3362059_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_073699540.1|3362842_3363166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189659.1|3363343_3363604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189302.1|3363705_3365220_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_038802950.1|3365714_3366834_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004196846.1|3367060_3367258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196848.1|3367280_3368687_+	amino acid permease	NA	NA	NA	NA	NA
WP_004196851.1|3369000_3369366_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_004196853.1|3369362_3370163_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_004196857.1|3370181_3370760_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_004196859.1|3370882_3371317_-	YraN family protein	NA	NA	NA	NA	NA
WP_004196861.1|3371363_3372251_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_004191998.1|3372345_3373809_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198058.1|3374018_3375281_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_004198059.1|3375878_3376484_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004198060.1|3376445_3377021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198061.1|3376980_3378264_-	MFS transporter	NA	NA	NA	NA	NA
WP_004198062.1|3378422_3379067_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004198063.1|3379404_3380028_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_004198065.1|3380112_3381009_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004198067.1|3381136_3382273_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004539229.1|3382249_3382555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185303.1|3382629_3383748_-	acyltransferase	NA	NA	NA	NA	NA
WP_004199982.1|3384150_3384654_-	lipoprotein	NA	NA	NA	NA	NA
WP_004204896.1|3385258_3387424_+	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.1	1.9e-46
WP_071893038.1|3388005_3388404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185238.1|3388479_3388716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204906.1|3388818_3389049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012729786.1|3389282_3389639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199991.1|3389664_3390933_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004199993.1|3390947_3393209_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	4.2e-36
WP_004199995.1|3393205_3394654_+	TolC family protein	NA	NA	NA	NA	NA
WP_004199997.1|3394864_3395821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199998.1|3395946_3396798_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_004200000.1|3396948_3397062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200001.1|3397069_3400963_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_045607300.1|3400959_3401934_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004185296.1|3401938_3402871_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004200005.1|3403069_3404191_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004200009.1|3404280_3406974_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.5	9.5e-88
WP_004200010.1|3407007_3408108_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004200011.1|3408071_3409910_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004204912.1|3409989_3410472_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 1
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	0	90893	2237503	plate,transposase	Organic_Lake_phycodnavirus(20.0%)	68	NA	NA
WP_004196232.1|912_1305_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004187753.1|1378_2155_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004187634.1|2250_3144_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187822.1|3483_5400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200686.1|6119_6500_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004187892.1|6540_7200_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_073699070.1|7196_7388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196236.1|7381_8464_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004188576.1|8460_10938_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004188373.1|10969_13297_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004196241.1|13368_14472_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_004187303.1|14468_15554_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004187986.1|15553_17443_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004187068.1|17473_18055_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004187921.1|18041_19007_-	ImpE/SciE family protein	NA	NA	NA	NA	NA
WP_004188539.1|19003_19750_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_004187450.1|23214_23796_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004188012.1|23830_25330_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004188308.1|25446_25932_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004187276.1|26038_26542_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004188743.1|26563_27910_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004188530.1|27998_29264_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004188288.1|33387_33618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196246.1|34203_35550_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187006.1|35792_36719_-	catecholic dioxygenase	NA	NA	NA	NA	NA
WP_004187502.1|36773_37745_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004187879.1|37773_39642_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	25.9	3.0e-24
WP_004187705.1|39687_41172_-	Pyoverdin chromophore biosynthetic protein pvcC	NA	NA	NA	NA	NA
WP_004188574.1|41197_42097_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_004188150.1|42093_43152_-	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_157047211.1|43150_43528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188385.1|43753_46714_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_004196252.1|46925_48842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187552.1|49283_49649_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004202300.1|49788_50073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188660.1|50092_50833_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004188170.1|51377_52310_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196258.1|52462_53710_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004554722.1|53873_54773_+	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_162483372.1|54862_55387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196262.1|55374_55815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188358.1|55963_56260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201242.1|56316_57357_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004188790.1|57650_58487_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004187366.1|58828_59731_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187422.1|59910_61101_+	amidohydrolase	NA	NA	NA	NA	NA
WP_004188653.1|62488_63118_+	porin	NA	NA	NA	NA	NA
WP_004203996.1|63311_64709_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.7	2.3e-45
WP_038802950.1|65841_66961_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198864.1|67006_67753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188578.1|69139_69889_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188783.1|70132_71038_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_004187664.1|71353_72433_+	porin	NA	NA	NA	NA	NA
WP_004187771.1|72474_73953_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_004188039.1|74030_75158_-	OpgC domain-containing protein	NA	NA	NA	NA	NA
WP_004188619.1|75557_76451_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_004187760.1|76447_76744_-	acylphosphatase	NA	NA	NA	NA	NA
WP_004202312.1|76904_77912_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004188344.1|78166_79621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188250.1|79846_81031_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004187484.1|81424_82366_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_004187762.1|82378_83539_+	adenosyl-hopene transferase HpnH	NA	NA	NA	NA	NA
WP_004187860.1|83883_84237_+	DOPA 4,5-dioxygenase family protein	NA	NA	NA	NA	NA
WP_045607391.1|84785_86135_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_004191998.1|87077_88541_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004188758.1|88663_89272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188650.1|89392_89998_-	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_004188544.1|90035_90893_-	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	41.9	4.7e-49
>prophage 2
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	95544	99035	2237503		Tupanvirus(50.0%)	2	NA	NA
WP_004188582.1|95544_96591_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	48.2	2.9e-85
WP_004187523.1|96719_99035_-	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	29.4	8.1e-27
>prophage 3
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	106814	108569	2237503		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004188265.1|106814_108569_-	carbamoyltransferase	NA	A0A1B1ITZ5	uncultured_Mediterranean_phage	34.3	8.8e-50
>prophage 4
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	112514	118650	2237503		Bacillus_phage(50.0%)	3	NA	NA
WP_004206055.1|112514_115481_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.6	1.5e-38
WP_011807542.1|115578_117213_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_004187588.1|117348_118650_-	phosphatidylserine decarboxylase	NA	A0A2K9L6Z6	Tupanvirus	26.9	2.0e-11
>prophage 5
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	128656	130057	2237503		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004187554.1|128656_130057_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	1.3e-32
>prophage 6
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	146755	148597	2237503		Roseobacter_phage(100.0%)	1	NA	NA
WP_004529492.1|146755_148597_+	ribonucleotide reductase-like protein	NA	A0A191VYJ2	Roseobacter_phage	32.5	9.5e-63
>prophage 7
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	157918	159724	2237503		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004188381.1|157918_159724_-	fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	20.8	1.1e-10
>prophage 8
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	169828	172750	2237503		Escherichia_phage(100.0%)	1	NA	NA
WP_004187995.1|169828_172750_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	27.0	1.5e-06
>prophage 9
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	195506	202738	2237503	transposase	Burkholderia_phage(33.33%)	6	NA	NA
WP_004190171.1|195506_196727_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.3	1.0e-238
WP_004191998.1|196886_198350_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190769.1|198456_199053_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004198280.1|199041_199329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045607398.1|199345_200086_-	TenA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190283.1|200119_202738_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	33.7	1.2e-18
>prophage 10
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	208901	215232	2237503		Planktothrix_phage(50.0%)	3	NA	NA
WP_004190866.1|208901_209603_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.3	3.3e-32
WP_004190708.1|209602_211078_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004202325.1|211110_215232_-	cytochrome P450	NA	A0A2L2DJN2	Acanthamoeba_polyphaga_mimivirus	21.5	8.4e-19
>prophage 11
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	229015	232170	2237503		Klosneuvirus(50.0%)	3	NA	NA
WP_004190374.1|229015_230362_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.5	2.3e-21
WP_045607401.1|230358_231429_-	peptidase C45	NA	NA	NA	NA	NA
WP_004190973.1|231441_232170_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	40.9	3.9e-36
>prophage 12
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	238495	240383	2237503		Mycobacterium_phage(50.0%)	2	NA	NA
WP_004190398.1|238495_239401_+	alpha/beta hydrolase	NA	A0A1B1SFC9	Mycobacterium_phage	30.4	6.8e-06
WP_004190237.1|239447_240383_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	2.8e-18
>prophage 13
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	244416	247892	2237503		Lactobacillus_phage(33.33%)	5	NA	NA
WP_004201269.1|244416_244974_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	31.2	1.0e-15
WP_004194486.1|245337_245943_+	RNA polymerase factor sigma-70	NA	NA	NA	NA	NA
WP_004194479.1|245923_246121_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_004194454.1|246451_246808_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	46.1	6.8e-18
WP_004194446.1|247229_247892_+	ParA family protein	NA	K7R2R7	Vibrio_phage	29.8	7.2e-21
>prophage 14
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	257196	259440	2237503		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_045607404.1|257196_258396_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	28.9	1.6e-34
WP_004194543.1|258408_259440_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.5	2.8e-16
>prophage 15
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	292715	293426	2237503		Vibrio_phage(100.0%)	1	NA	NA
WP_004202069.1|292715_293426_-	GTP cyclohydrolase I FolE	NA	A0A2I7S8W4	Vibrio_phage	44.9	2.9e-44
>prophage 16
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	310211	320817	2237503		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_004194485.1|310211_316124_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	37.4	1.7e-182
WP_004194496.1|316698_317004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194514.1|317157_317418_-	hypothetical protein	NA	A0A0N7C055	Escherichia_phage	58.5	4.2e-09
WP_044302752.1|317559_317832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194499.1|318060_318333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004532451.1|318615_318915_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004188627.1|319464_320817_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.5	2.5e-44
>prophage 17
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	332720	333840	2237503	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_096325434.1|332720_333840_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 18
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	347190	351040	2237503		Klebsiella_phage(50.0%)	4	NA	NA
WP_004188444.1|347190_347640_-	hypothetical protein	NA	S6C8U2	Klebsiella_phage	39.2	4.2e-17
WP_004187389.1|347799_349263_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004201681.1|349315_349828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201682.1|350065_351040_-	alpha/beta fold hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	32.0	3.6e-05
>prophage 19
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	355515	364030	2237503	transposase	Leptospira_phage(33.33%)	10	NA	NA
WP_038802950.1|355515_356636_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197522.1|356934_357579_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004197524.1|357707_358940_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_162486305.1|359087_359375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188591.1|359470_360745_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	23.2	5.8e-11
WP_004187981.1|360758_361541_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_004197528.1|361581_361719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187606.1|361840_362020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203340.1|362312_362711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188257.1|362707_364030_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	37.4	1.6e-67
>prophage 20
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	380347	384626	2237503		Tupanvirus(50.0%)	4	NA	NA
WP_004198321.1|380347_381373_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.8	1.5e-33
WP_004198322.1|381449_381953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187158.1|382010_382520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044302747.1|383021_384626_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	2.8e-10
>prophage 21
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	388081	391297	2237503		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004188377.1|388081_391297_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.3e-19
>prophage 22
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	397118	397823	2237503		Planktothrix_phage(100.0%)	1	NA	NA
WP_004188371.1|397118_397823_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	8.1e-39
>prophage 23
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	402220	403918	2237503		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004201704.1|402220_403918_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	4.7e-16
>prophage 24
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	408582	409461	2237503		Synechococcus_phage(100.0%)	1	NA	NA
WP_004188687.1|408582_409461_-	LOG family protein	NA	F4YCQ1	Synechococcus_phage	37.7	1.7e-09
>prophage 25
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	415916	425246	2237503	transposase	Clostridium_botulinum_C_phage(25.0%)	8	NA	NA
WP_004552083.1|415916_417296_-	MBL fold metallo-hydrolase	NA	Q331V3	Clostridium_botulinum_C_phage	32.4	2.2e-19
WP_009969281.1|417339_417579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188828.1|418009_418900_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_004191998.1|419022_420486_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004546798.1|420714_420957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190875.1|421134_422697_+	amino acid permease	NA	NA	NA	NA	NA
WP_144410504.1|422896_424017_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	4.7e-49
WP_043283055.1|424082_425246_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	4.2e-226
>prophage 26
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	458571	460152	2237503		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004200601.1|458571_460152_+	Na+/H+ antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	33.1	2.9e-12
>prophage 27
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	466323	468000	2237503		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004552066.1|466323_468000_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.3	1.2e-11
>prophage 28
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	471315	477691	2237503		Bacillus_thuringiensis_phage(50.0%)	4	NA	NA
WP_004190238.1|471315_473910_+	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	29.6	1.2e-10
WP_004190908.1|473916_474945_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_004553610.1|475335_476058_+	haloacid dehalogenase type II	NA	NA	NA	NA	NA
WP_004205413.1|476407_477691_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.8	3.1e-36
>prophage 29
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	484501	488083	2237503		Bacillus_phage(50.0%)	2	NA	NA
WP_004190501.1|484501_486511_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.1	2.0e-29
WP_004205409.1|487201_488083_+	Dyp-type peroxidase	NA	A0A0M5KAH8	Mollivirus	31.4	1.1e-13
>prophage 30
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	495207	496997	2237503		Diadromus_pulchellus_ascovirus(50.0%)	3	NA	NA
WP_004190784.1|495207_495978_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	29.6	1.6e-11
WP_004190573.1|496066_496201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552055.1|496199_496997_+	glucose 1-dehydrogenase	NA	A0A0G2Y924	Acanthamoeba_polyphaga_mimivirus	30.8	9.3e-07
>prophage 31
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	512227	513268	2237503		Rhizobium_phage(100.0%)	1	NA	NA
WP_004190371.1|512227_513268_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	28.6	2.5e-12
>prophage 32
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	520740	521860	2237503	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_144410505.1|520740_521860_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 33
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	539616	540318	2237503		Planktothrix_phage(100.0%)	1	NA	NA
WP_004190506.1|539616_540318_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	2.9e-20
>prophage 34
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	550280	551251	2237503	portal,integrase	Burkholderia_phage(100.0%)	2	544694:544709	555623:555638
544694:544709	attL	GGGCGCCGGCGTGCCG	NA	NA	NA	NA
WP_004195697.1|550280_550967_-|integrase	tyrosine-type recombinase/integrase	integrase	E5E3N4	Burkholderia_phage	81.6	3.3e-93
WP_009950031.1|550963_551251_-|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	6.4e-43
555623:555638	attR	GGGCGCCGGCGTGCCG	NA	NA	NA	NA
>prophage 35
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	556144	559676	2237503		Synechococcus_phage(50.0%)	2	NA	NA
WP_004530319.1|556144_556894_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190446.1|556895_559676_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	2.9e-71
>prophage 36
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	571751	581382	2237503	transposase,tRNA	Streptococcus_phage(20.0%)	8	NA	NA
WP_045607416.1|571751_573215_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	7.5e-79
WP_011204325.1|573618_574659_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	1.7e-93
WP_004190760.1|574798_576022_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004190342.1|576101_576314_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004190948.1|576480_576927_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	8.8e-23
WP_004190679.1|577021_578896_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.2	4.9e-67
WP_004540553.1|578942_579281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190933.1|579339_581382_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
>prophage 37
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	587383	588886	2237503		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004190458.1|587383_588886_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.4	2.9e-41
>prophage 38
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	593774	595894	2237503		Planktothrix_phage(100.0%)	2	NA	NA
WP_004190939.1|593774_594764_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	1.8e-15
WP_004190412.1|594760_595894_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	3.0e-19
>prophage 39
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	614836	615760	2237503		Burkholderia_virus(100.0%)	1	NA	NA
WP_004190485.1|614836_615760_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	33.7	2.0e-16
>prophage 40
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	619145	620267	2237503		unidentified_phage(100.0%)	1	NA	NA
WP_004190793.1|619145_620267_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	40.4	2.4e-32
>prophage 41
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	636371	738527	2237503	plate,holin,transposase	Leptospira_phage(25.0%)	76	NA	NA
WP_004190585.1|636371_637775_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190689.1|637790_639107_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004190681.1|639109_642739_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190273.1|643635_643863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190797.1|643861_646459_+	protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.6	5.0e-09
WP_004190988.1|646511_647591_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004190671.1|647653_648232_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190849.1|648224_649733_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|649792_650284_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004196148.1|650302_650863_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004190509.1|650867_652739_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190820.1|652735_654214_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_045607418.1|654192_656847_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	2.3e-78
WP_004203275.1|656843_659048_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004196151.1|659122_659776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196154.1|659705_660764_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_038802950.1|660791_661912_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004190846.1|662451_663957_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004196178.1|664100_664628_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_004190879.1|664707_665139_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|665152_667015_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|667011_668001_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004196185.1|670864_673111_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004190563.1|673276_675565_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004200633.1|675568_677785_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004202229.1|677784_678855_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004190800.1|678857_679574_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004190606.1|679616_680006_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004196199.1|680190_681336_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004206248.1|681354_681963_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190463.1|682045_683704_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004190265.1|683700_687204_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190863.1|687262_687622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190471.1|687644_688070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190745.1|688390_688666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186983.1|689216_690116_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004201077.1|690157_690448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186962.1|690337_691657_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004184379.1|691653_693240_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004184586.1|694662_694845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080549374.1|694810_696451_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004186853.1|696931_698185_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004198244.1|698778_700443_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.4	5.4e-57
WP_004546670.1|700575_702141_-	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_004186794.1|702329_703346_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004186783.1|703785_704985_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	26.8	1.9e-11
WP_004198247.1|705162_706188_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_162473486.1|706201_706486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186965.1|706621_707896_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	6.9e-105
WP_004186989.1|707968_708940_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004186987.1|709090_709624_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004186960.1|709684_711748_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186901.1|711750_713676_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004186905.1|713680_714853_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004186884.1|714849_715635_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_011204351.1|715686_716928_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004186910.1|716948_718094_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004186918.1|718203_719067_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004186811.1|719247_720903_+	APC family permease	NA	NA	NA	NA	NA
WP_004186920.1|720989_721865_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_021252052.1|722008_722881_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186939.1|723043_724597_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_004186847.1|724593_725487_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004198249.1|725483_725606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200640.1|725714_726857_+	porin	NA	NA	NA	NA	NA
WP_004200641.1|726911_728138_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004198575.1|728255_729959_-	peptidase	NA	NA	NA	NA	NA
WP_004186852.1|730430_731375_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_011204354.1|731642_732593_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004186835.1|732675_733605_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_024900416.1|733719_734685_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_004200643.1|734687_735185_+	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004186844.1|735220_736180_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004186985.1|736526_736877_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_080517904.1|737068_737320_-	oxidoreductase	NA	NA	NA	NA	NA
WP_038802950.1|737407_738527_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 42
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	743707	752153	2237503	tRNA	Pseudomonas_phage(33.33%)	8	NA	NA
WP_004186862.1|743707_744790_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_004521984.1|744856_746155_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_004200645.1|746446_746758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198580.1|746754_747009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186938.1|747027_748842_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	49.6	3.0e-170
WP_004186966.1|748978_749530_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_004186915.1|749526_750150_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_004186903.1|750485_752153_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	5.8e-43
>prophage 43
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	766321	771789	2237503		Acinetobacter_phage(60.0%)	6	NA	NA
WP_004186801.1|766321_767101_-	uracil-DNA glycosylase	NA	A0A060Q589	Fruit_bat_alphaherpesvirus	51.1	6.4e-53
WP_004186832.1|767142_767784_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_004186826.1|767794_768580_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	46.7	9.3e-52
WP_004186823.1|768642_769674_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.0	1.6e-80
WP_004186792.1|769691_770282_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	60.0	1.4e-68
WP_004186866.1|770295_771789_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	30.5	3.5e-39
>prophage 44
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	788496	843170	2237503	transposase	Leptospira_phage(44.44%)	49	NA	NA
WP_096325434.1|788496_789616_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004184834.1|789857_791318_+	ser/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_004198117.1|794361_794508_+	DUF3563 family protein	NA	NA	NA	NA	NA
WP_011204222.1|794632_796096_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004198119.1|796304_796583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198120.1|796595_797441_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_004198121.1|797589_798561_-	NADP-dependent aryl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004204588.1|798748_799537_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_004191998.1|799741_801205_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004198124.1|801348_802548_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_004199587.1|802835_804926_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_004266710.1|805149_805701_+	membrane protein	NA	NA	NA	NA	NA
WP_004198127.1|805760_806090_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_004198128.1|806149_806992_+	iron transporter OFeT family	NA	NA	NA	NA	NA
WP_004198129.1|806988_808389_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_004199588.1|808448_808859_+	heme-binding protein	NA	NA	NA	NA	NA
WP_038802950.1|809004_810124_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_038802950.1|810952_812073_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004184594.1|812785_813700_-	glutaminase	NA	NA	NA	NA	NA
WP_038802971.1|813744_814107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184573.1|814229_814940_+	response regulator	NA	W8CYM9	Bacillus_phage	32.7	8.2e-31
WP_004535157.1|815327_816443_+	sensor protein	NA	NA	NA	NA	NA
WP_004198787.1|819912_820977_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004184551.1|821028_821253_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_004198788.1|821473_822064_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_038802383.1|822164_824486_+	amylo-alpha-1,6-glucosidase	NA	NA	NA	NA	NA
WP_004199309.1|824581_824845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204109.1|825080_825323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024900419.1|825322_825862_-	terpene cyclase	NA	NA	NA	NA	NA
WP_011204436.1|826432_826909_+	VOC family protein	NA	A0A2K9L4N3	Tupanvirus	39.4	9.4e-23
WP_004199340.1|827207_827867_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_004201955.1|827907_828618_+	DUF899 domain-containing protein	NA	NA	NA	NA	NA
WP_123784521.1|828772_828964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204107.1|829728_830058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194633.1|830497_831877_-	two-component sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	32.4	1.9e-07
WP_004194706.1|831873_832536_-	response regulator	NA	NA	NA	NA	NA
WP_004194709.1|832696_833557_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004194594.1|833942_834212_+	YodC family protein	NA	NA	NA	NA	NA
WP_004194710.1|834428_834767_-	superinfection immunity protein	NA	NA	NA	NA	NA
WP_004194624.1|834856_835324_-	rhodanese	NA	NA	NA	NA	NA
WP_004194618.1|835430_836387_+	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_004194689.1|836655_836880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194586.1|836964_837429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194713.1|837492_838944_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004194611.1|839053_839422_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_004198721.1|839942_840527_+	NnrU family protein	NA	NA	NA	NA	NA
WP_004204101.1|840803_841070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194616.1|841330_841636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|842049_843170_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 45
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	848034	854422	2237503		Lake_Baikal_phage(33.33%)	8	NA	NA
WP_004187926.1|848034_848238_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	67.2	2.7e-19
WP_004198135.1|848259_848442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188047.1|848438_848654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202506.1|849015_849441_-	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_004188692.1|849729_849990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188126.1|850206_851139_+	2-hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	32.1	1.9e-19
WP_004188566.1|851177_851663_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_009934486.1|852250_854422_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	25.2	4.9e-18
>prophage 46
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	862551	867845	2237503	holin,transposase	Catovirus(50.0%)	4	NA	NA
WP_004188051.1|862551_864249_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	29.0	1.2e-48
WP_004187839.1|864268_865738_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004188524.1|865780_866368_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_038802950.1|866725_867845_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 47
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	877685	885047	2237503		Klosneuvirus(33.33%)	6	NA	NA
WP_038802932.1|877685_879782_-	S9 family peptidase	NA	A0A1V0SHT0	Klosneuvirus	35.5	2.2e-31
WP_004196360.1|880151_880619_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004184599.1|880733_881723_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_004184504.1|881719_882004_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004184450.1|882124_883057_+	hypothetical protein	NA	A0A2K9L690	Tupanvirus	33.6	1.8e-38
WP_004184548.1|883064_885047_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.0	3.0e-91
>prophage 48
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	899399	900860	2237503		Tetraselmis_virus(100.0%)	1	NA	NA
WP_080110146.1|899399_900860_-	NYN domain-containing protein	NA	A0A2P0VNQ4	Tetraselmis_virus	32.1	3.2e-05
>prophage 49
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	912267	915171	2237503	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_004184520.1|912267_915171_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	22.3	6.3e-45
>prophage 50
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	920945	927377	2237503		Vibrio_phage(50.0%)	4	NA	NA
WP_004206794.1|920945_922976_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	2.3e-25
WP_011807488.1|923327_924272_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045607470.1|924268_925315_+	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_011831993.1|925355_927377_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	4.0e-22
>prophage 51
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	938080	942526	2237503		Bacillus_phage(66.67%)	3	NA	NA
WP_004184205.1|938080_939550_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.0	1.3e-17
WP_004184583.1|940241_940910_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	50.8	5.5e-29
WP_004184633.1|941407_942526_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	48.5	3.0e-80
>prophage 52
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	946320	1029821	2237503	protease,transposase,integrase	Leptospira_phage(45.45%)	50	993652:993711	1028654:1029890
WP_144410506.1|946320_947440_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004551771.1|952979_953498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184606.1|953827_954346_-	membrane protein	NA	NA	NA	NA	NA
WP_004184536.1|955224_956946_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_004201091.1|957142_958459_-	TolC family protein	NA	NA	NA	NA	NA
WP_004184640.1|959271_959457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184575.1|959593_961717_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	24.9	2.5e-27
WP_004184588.1|961713_962736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528592.1|962748_964044_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004202541.1|964057_965554_+	OmpW family protein	NA	NA	NA	NA	NA
WP_038802950.1|965940_967060_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004184552.1|968226_968943_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004184355.1|969021_970320_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076841794.1|970489_970933_+	metal transporter	NA	NA	NA	NA	NA
WP_004528582.1|971036_972107_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004536930.1|972242_972833_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.4	5.8e-22
WP_038730458.1|972853_973138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184214.1|973610_974135_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004197859.1|974164_974395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197860.1|974802_976563_+	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_004184602.1|976559_978320_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004184547.1|978316_980110_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004184201.1|980120_980411_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_004184597.1|980845_981649_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
993652:993711	attL	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCC	NA	NA	NA	NA
WP_038802950.1|993698_994819_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004197866.1|995228_995501_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004184766.1|995613_997008_-	heavy metal sensor histidine kinase IrlS	NA	W8CYF6	Bacillus_phage	28.9	1.2e-20
WP_004197868.1|997004_997694_-	heavy metal response regulator transcription factor IrlR	NA	W8CYM9	Bacillus_phage	36.8	1.7e-36
WP_004197870.1|997700_1000934_-	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_004197872.1|1000979_1002449_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004197873.1|1002459_1003845_-	TolC family protein	NA	NA	NA	NA	NA
WP_004197875.1|1004080_1004365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524134.1|1004762_1004903_-	bacteriophage protein	NA	NA	NA	NA	NA
WP_038709382.1|1005561_1006047_-	membrane protein	NA	NA	NA	NA	NA
WP_004197880.1|1006376_1006862_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_004184790.1|1007129_1008485_+	amino acid permease	NA	NA	NA	NA	NA
WP_004197883.1|1008784_1009393_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004199606.1|1009538_1011539_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	46.2	1.1e-104
WP_011204480.1|1012911_1014678_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004199157.1|1014808_1015480_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004184876.1|1015630_1016728_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004199160.1|1016724_1019826_+	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.0	3.6e-46
WP_004266238.1|1019960_1021499_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004184915.1|1021513_1021810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199609.1|1021855_1022473_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	44.6	6.9e-34
WP_004197695.1|1022469_1024167_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_024900397.1|1024916_1026608_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004197698.1|1026704_1027151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199610.1|1027521_1028679_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|1028700_1029821_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
1028654:1029890	attR	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCCTGGAAAGCGGCAGGAGCGTCCGCGGTTGCCCGATGTTTCGCCGCAAACTCTGACGGCGCAAGGTAGTTCAGTGCGCTGTGCGGCCTTTGCTCGTTGTAGTCCTGACGCCATGCCGCGATGACTGCCCGAGCGTGCGCGAGCGTCGTGAACCAGTGCTCGTTAAGGCATTCGTCGCGGAACTTGCCGTTGAACGATTCGATGTACGCATTCTGCGTGGGCTTGCCCGCCTGAATCAACTTCAGCGTGACGCCGTTCGCATACGCCCACTGGTCAAGCGCGCGGCTCGTAAATTCGGGTCCCTGGTCTGTTCGCACCGCCTTGGGATAGCCACGGAAGCGAGCTGCACGGTCCAATGCCCGAGCGACATACAAACCTGAGATGCCATGGTCGACGACGATGTCGACAGCCTCTTTCGTGAAATCGTCGACGACGGTCAGGCACTTCACGCGCCGGCCGTTGGAAAGCGCATCCATCACGAAATCGATTGACCATACCTCGTTGGGTGCGCCCGGCAATGCCAGTTGCTCGCGCTCAATCATGACGCCGTGGCGCTTGCGACGGCGCCGCACAGCCAGCCCTGCCTCACGGTACAGGCGATAGATGCGCTTGTGATTGGCGTGCGTGCCTTCGCGTTCCACCAGGGCGTGCAGTCGGCGGTAGCCGAATCGACGACGTTCGTGCGCCAACTTCACCAGACGCGCCGCGAGCACCTCATTCTCGTGGTCCGGCTTCGCGTCGTAATGCAGCACGCTGCGAGAAAGCCCGACAAGCCGGCAGGCGCGGCGCTCGGAGATGTTGACCTTCTCCCGAATCGCCAACACTGCTTCGCGTTTGGCTTGCGGGCTCAGGGCTTTCCCTTGACGACAACCTTCAACGCTTCCATATCGAGCATTGCTTCGGCCAGCAGTTTCTTCAGTCGGGCATTCTCCACCTCGAGGCCCTTGAGCCGGCGGGCTTCCGAGACTTCCATGCCGCCGAACTTCGCGCGCCAGGTGTAGAACGACGCGTCACTGAACCCATGCTTCCTGCACAGTTCCTTGACCGGCATACCGGCCTCGGCTTCCTTCAGAAACCCGATGATTTGCTGTTCCGTAAAGCGCTTCTTCATGTTCGTCTTCTTCTCCGAAAACGAACTTTACTAGACTCCGGCTGGCCCTGTTTGTAGGGGGCAGGTCAG	NA	NA	NA	NA
>prophage 53
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1043324	1044107	2237503		Escherichia_phage(100.0%)	1	NA	NA
WP_004266268.1|1043324_1044107_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	25.4	2.2e-08
>prophage 54
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1051174	1052368	2237503		Planktothrix_phage(100.0%)	1	NA	NA
WP_004197719.1|1051174_1052368_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.8	2.1e-23
>prophage 55
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1055403	1056405	2237503		Stx2-converting_phage(100.0%)	1	NA	NA
WP_004197725.1|1055403_1056405_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.7	9.8e-38
>prophage 56
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1071550	1072183	2237503		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004202557.1|1071550_1072183_-	GTP cyclohydrolase I	NA	A0A0P0HSD2	Acinetobacter_phage	36.4	1.4e-18
>prophage 57
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1098609	1106975	2237503	transposase	Tupanvirus(33.33%)	6	NA	NA
WP_011204497.1|1098609_1101858_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.2	2.9e-67
WP_004184788.1|1101904_1102111_-	MbtH family protein	NA	NA	NA	NA	NA
WP_004184673.1|1102129_1103419_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_080516841.1|1103423_1104173_-	peptide synthase	NA	NA	NA	NA	NA
WP_004191998.1|1104150_1105614_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_038802950.1|1105855_1106975_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 58
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1117971	1118493	2237503		Rhizobium_phage(100.0%)	1	NA	NA
WP_004199294.1|1117971_1118493_-	sigma-70 family RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	27.1	5.1e-06
>prophage 59
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1131403	1132840	2237503		Mycobacterium_phage(100.0%)	1	NA	NA
WP_004198348.1|1131403_1132840_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	36.7	4.2e-50
>prophage 60
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1191052	1192273	2237503	transposase	Burkholderia_phage(100.0%)	1	NA	NA
WP_004186184.1|1191052_1192273_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	6.6e-238
>prophage 61
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1202149	1206973	2237503	transposase	Tupanvirus(33.33%)	5	NA	NA
WP_004524090.1|1202149_1203685_-	catalase	NA	A0A2K9L572	Tupanvirus	50.6	8.3e-105
WP_009957574.1|1203981_1204287_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011807472.1|1204289_1204616_-	response regulator	NA	NA	NA	NA	NA
WP_038802950.1|1204703_1205823_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004184777.1|1205953_1206973_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	34.6	8.7e-18
>prophage 62
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1213614	1214382	2237503		Planktothrix_phage(100.0%)	1	NA	NA
WP_004266254.1|1213614_1214382_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.7	4.7e-24
>prophage 63
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1226477	1229264	2237503		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_004198675.1|1226477_1229264_+	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.9	1.3e-39
>prophage 64
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1252251	1254237	2237503		Ralstonia_phage(100.0%)	1	NA	NA
WP_004202650.1|1252251_1254237_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	30.5	1.1e-64
>prophage 65
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1262017	1268583	2237503		Planktothrix_phage(50.0%)	7	NA	NA
WP_011204534.1|1262017_1262899_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	1.0e-06
WP_004184889.1|1262874_1263663_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.9e-20
WP_004524043.1|1264504_1264840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202658.1|1264949_1265822_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004198430.1|1265820_1266336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004551611.1|1266552_1267440_-	PenI family class A extended-spectrum beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	54.6	1.5e-77
WP_004198435.1|1267614_1268583_-	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	43.4	2.5e-14
>prophage 66
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1283974	1289288	2237503		uncultured_Caudovirales_phage(100.0%)	4	NA	NA
WP_004195377.1|1283974_1285567_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.5	1.7e-15
WP_004195382.1|1285654_1287169_+	MFS transporter	NA	NA	NA	NA	NA
WP_004195384.1|1287203_1288214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201140.1|1288544_1289288_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	42.6	1.7e-23
>prophage 67
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1293020	1294542	2237503	transposase	Leptospira_phage(50.0%)	2	NA	NA
WP_038802950.1|1293020_1294140_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_009939946.1|1294377_1294542_-	hypothetical protein	NA	Q8W6R2	Burkholderia_virus	81.8	9.4e-07
>prophage 68
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1316036	1316834	2237503		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_004195447.1|1316036_1316834_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.8	1.1e-07
>prophage 69
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1324536	1332247	2237503		Tupanvirus(33.33%)	9	NA	NA
WP_004195466.1|1324536_1325163_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L4C1	Tupanvirus	34.6	2.2e-24
WP_004195469.1|1325295_1325880_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_004195471.1|1325941_1327147_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_004184903.1|1327896_1328613_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	42.6	2.0e-13
WP_004184923.1|1328648_1329368_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004199705.1|1329441_1329885_+	DUF4902 domain-containing protein	NA	NA	NA	NA	NA
WP_004195479.1|1330109_1330721_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004199706.1|1330809_1331631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004195483.1|1331593_1332247_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.1	6.6e-43
>prophage 70
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1345292	1346642	2237503		Klosneuvirus(100.0%)	1	NA	NA
WP_004195503.1|1345292_1346642_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.6	2.1e-19
>prophage 71
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1360663	1361783	2237503	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_038802950.1|1360663_1361783_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 72
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1370460	1372068	2237503		Pike_perch_iridovirus(100.0%)	1	NA	NA
WP_004201021.1|1370460_1372068_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	53.4	5.1e-20
>prophage 73
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1412077	1415677	2237503		Ostreococcus_tauri_virus(50.0%)	3	NA	NA
WP_004198529.1|1412077_1413547_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	34.1	6.4e-46
WP_004198528.1|1413721_1414447_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004198527.1|1414468_1415677_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.7	1.8e-41
>prophage 74
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1419280	1420135	2237503		Bacillus_virus(100.0%)	1	NA	NA
WP_045607433.1|1419280_1420135_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	46.6	9.5e-58
>prophage 75
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1428555	1432260	2237503		Rhizobium_phage(50.0%)	3	NA	NA
WP_004206324.1|1428555_1429581_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	27.1	2.4e-07
WP_004200982.1|1429727_1431089_+	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_080939016.1|1431117_1432260_+	hemagglutinin	NA	B0FIT1	Escherichia_phage	37.0	1.9e-08
>prophage 76
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1443743	1449823	2237503		Agrobacterium_phage(50.0%)	2	NA	NA
WP_045607437.1|1443743_1446773_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.5	4.5e-78
WP_004184913.1|1446799_1449823_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.2e-22
>prophage 77
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1464019	1466365	2237503	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_004528803.1|1464019_1464652_+	GTP cyclohydrolase I	NA	A0A0P0HSD2	Acinetobacter_phage	30.6	9.9e-20
WP_038802950.1|1465245_1466365_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 78
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1525830	1527897	2237503		Bacillus_virus(100.0%)	1	NA	NA
WP_004200895.1|1525830_1527897_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	31.7	1.2e-21
>prophage 79
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1542457	1546501	2237503	transposase	Leptospira_phage(50.0%)	4	NA	NA
WP_038802950.1|1542457_1543577_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_009939800.1|1544702_1544939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184933.1|1545350_1545689_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_004200881.1|1545724_1546501_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	2.4e-12
>prophage 80
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1552253	1553810	2237503		Cedratvirus(100.0%)	1	NA	NA
WP_004200874.1|1552253_1553810_-	sugar ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	28.6	4.3e-08
>prophage 81
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1583528	1584326	2237503		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_004266698.1|1583528_1584326_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	2.7e-06
>prophage 82
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1598038	1599685	2237503		uncultured_virus(100.0%)	1	NA	NA
WP_004184942.1|1598038_1599685_+	lipoprotein	NA	A0A218MNG5	uncultured_virus	43.0	2.6e-64
>prophage 83
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1607133	1608253	2237503	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_038802950.1|1607133_1608253_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 84
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1611799	1612920	2237503	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_096325434.1|1611799_1612920_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 85
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1619094	1619646	2237503		Tupanvirus(100.0%)	1	NA	NA
WP_004194622.1|1619094_1619646_-	HD domain-containing protein	NA	A0A2K9L141	Tupanvirus	34.1	2.3e-20
>prophage 86
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1624191	1625289	2237503		Bacillus_virus(100.0%)	1	NA	NA
WP_004194602.1|1624191_1625289_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.5	5.5e-26
>prophage 87
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1634064	1635184	2237503	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_038802950.1|1634064_1635184_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 88
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1644100	1645564	2237503	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_004191998.1|1644100_1645564_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
>prophage 89
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1655559	1656627	2237503		Planktothrix_phage(100.0%)	1	NA	NA
WP_004198096.1|1655559_1656627_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	3.6e-30
>prophage 90
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1669107	1671159	2237503		Bacillus_phage(100.0%)	2	NA	NA
WP_004194667.1|1669107_1669830_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.9	1.9e-30
WP_004194712.1|1669830_1671159_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.6	9.7e-17
>prophage 91
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1682214	1684185	2237503		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_004194643.1|1682214_1684185_-	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	27.4	7.6e-26
>prophage 92
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1694534	1697316	2237503	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_004194631.1|1694534_1694753_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	50.8	2.1e-06
WP_038802950.1|1696196_1697316_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 93
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1723867	1725082	2237503		Planktothrix_phage(100.0%)	1	NA	NA
WP_004188599.1|1723867_1725082_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.8	3.2e-27
>prophage 94
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1759570	1761430	2237503		Hepacivirus(100.0%)	1	NA	NA
WP_004187695.1|1759570_1761430_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	26.8	2.5e-34
>prophage 95
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1771177	1776558	2237503		Leptospira_phage(50.0%)	3	NA	NA
WP_004188522.1|1771177_1774363_-	multidrug efflux RND transporter permease subunit CeoB	NA	S5VTK5	Leptospira_phage	24.9	7.0e-05
WP_004203095.1|1774424_1775654_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004187624.1|1775703_1776558_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.8	6.9e-16
>prophage 96
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1787837	1789532	2237503		Streptococcus_phage(100.0%)	1	NA	NA
WP_004187386.1|1787837_1789532_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.4	2.7e-16
>prophage 97
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1797741	1799286	2237503		Salmonella_phage(100.0%)	1	NA	NA
WP_004187329.1|1797741_1799286_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.1	1.4e-38
>prophage 98
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1803923	1806947	2237503	transposase	Burkholderia_virus(50.0%)	2	NA	NA
WP_004188323.1|1803923_1805261_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	41.9	2.6e-70
WP_004191998.1|1805483_1806947_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
>prophage 99
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1810481	1811602	2237503	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_038802950.1|1810481_1811602_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 100
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1821289	1821853	2237503		Ralstonia_phage(100.0%)	1	NA	NA
WP_004188424.1|1821289_1821853_-	type 3 secretion system effector BapC	NA	A0A0K2QQJ4	Ralstonia_phage	39.9	2.0e-16
>prophage 101
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1856099	1857419	2237503		Burkholderia_virus(100.0%)	1	NA	NA
WP_004188597.1|1856099_1857419_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.5	3.1e-47
>prophage 102
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1862526	1864101	2237503		Klosneuvirus(100.0%)	1	NA	NA
WP_004187990.1|1862526_1864101_-	S8/S53 family peptidase	NA	A0A1V0SLL0	Klosneuvirus	43.0	4.4e-85
>prophage 103
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1869995	1871603	2237503		Tupanvirus(100.0%)	1	NA	NA
WP_004187764.1|1869995_1871603_+	acyl-CoA ligase (AMP-forming), exosortase A system-associated	NA	A0A2K9KZV5	Tupanvirus	22.1	1.9e-19
>prophage 104
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1876854	1877637	2237503		Bacillus_virus(100.0%)	1	NA	NA
WP_004188097.1|1876854_1877637_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	40.9	1.5e-33
>prophage 105
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1906922	1908722	2237503		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004199794.1|1906922_1908722_-	type III secretion system outer membrane ring subunit SctC	NA	G4WZN6	Enterobacteria_phage	26.5	9.4e-07
>prophage 106
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1948595	1970846	2237503	transposase	Tupanvirus(40.0%)	6	NA	NA
WP_004198187.1|1948595_1958600_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.7	2.9e-142
WP_038802950.1|1958661_1959782_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004187737.1|1959847_1964410_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.3	1.2e-90
WP_004188274.1|1964604_1967388_-	diaminobutyrate--2-oxoglutarate transaminase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.3	5.5e-22
WP_004187286.1|1967602_1967851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188498.1|1969127_1970846_-	ubiquinone-dependent pyruvate dehydrogenase	NA	E4WLQ6	Ostreococcus_tauri_virus	23.7	7.8e-27
>prophage 107
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1986057	1987056	2237503		Wolbachia_phage(100.0%)	1	NA	NA
WP_004188806.1|1986057_1987056_-	patatin	NA	A0A1B2LRS3	Wolbachia_phage	27.1	3.9e-10
>prophage 108
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	1998185	2000111	2237503		Tupanvirus(100.0%)	1	NA	NA
WP_004187519.1|1998185_2000111_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	30.0	1.8e-16
>prophage 109
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2010717	2012628	2237503		Planktothrix_phage(100.0%)	1	NA	NA
WP_004187742.1|2010717_2012628_-	amino acid ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	2.9e-30
>prophage 110
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2025145	2027691	2237503		Pseudomonas_phage(50.0%)	3	NA	NA
WP_004201204.1|2025145_2026273_+	acyltransferase	NA	Q9MC93	Pseudomonas_phage	27.2	2.2e-09
WP_004188442.1|2026439_2026778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525207.1|2026803_2027691_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.6	7.0e-64
>prophage 111
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2036143	2042863	2237503		Gordonia_phage(25.0%)	6	NA	NA
WP_004187228.1|2036143_2037202_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	30.3	2.4e-18
WP_004188191.1|2037237_2038281_+	GDP-mannose 4,6-dehydratase	NA	M1HGM9	Acanthocystis_turfacea_Chlorella_virus	54.9	1.1e-103
WP_045607459.1|2038267_2039284_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004525197.1|2039213_2039594_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_080516868.1|2039881_2041099_-	O-succinylhomoserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	28.0	5.2e-17
WP_004188505.1|2041327_2042863_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.3	2.9e-89
>prophage 112
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2047497	2048346	2237503		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_004188032.1|2047497_2048346_-	site-specific DNA-methyltransferase	NA	R4THJ7	Phaeocystis_globosa_virus	33.8	3.0e-32
>prophage 113
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2068284	2069404	2237503	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_038802950.1|2068284_2069404_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 114
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2087148	2090524	2237503	transposase	Moraxella_phage(50.0%)	3	NA	NA
WP_004188259.1|2087148_2088813_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	22.5	1.9e-17
WP_004204352.1|2088836_2089109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2089404_2090524_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 115
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2122311	2126597	2237503	transposase	Euproctis_pseudoconspersa_nucleopolyhedrovirus(50.0%)	4	NA	NA
WP_004200658.1|2122311_2123409_+	chitin-binding protein	NA	C3TWS8	Euproctis_pseudoconspersa_nucleopolyhedrovirus	33.3	8.0e-25
WP_004187548.1|2123668_2124232_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_004196027.1|2124435_2125578_+	alkyl hydroperoxide reductase subunit F	NA	NA	NA	NA	NA
WP_038802950.1|2125477_2126597_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 116
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2129736	2133745	2237503		Staphylococcus_phage(50.0%)	2	NA	NA
WP_004188376.1|2129736_2131719_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.8	1.8e-83
WP_004187112.1|2133136_2133745_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.0	2.0e-22
>prophage 117
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2139560	2141024	2237503	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_004191998.1|2139560_2141024_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
>prophage 118
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2148502	2150020	2237503		Planktothrix_phage(100.0%)	1	NA	NA
WP_004196037.1|2148502_2150020_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.5	1.4e-11
>prophage 119
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2155550	2156594	2237503		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004188036.1|2155550_2156594_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	46.7	2.6e-25
>prophage 120
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2165614	2166433	2237503		Pithovirus(100.0%)	1	NA	NA
WP_004188492.1|2165614_2166433_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.8	1.5e-07
>prophage 121
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2188685	2191871	2237503		uncultured_virus(100.0%)	1	NA	NA
WP_004202275.1|2188685_2191871_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.2	2.0e-108
>prophage 122
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2196373	2197069	2237503		Bacillus_virus(100.0%)	1	NA	NA
WP_045607464.1|2196373_2197069_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.2	7.8e-18
>prophage 123
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2201186	2202800	2237503		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004187697.1|2201186_2202800_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.1	4.5e-16
>prophage 124
NZ_CP010066	Burkholderia mallei strain 2002721276 chromosome 2, complete sequence	2237503	2216523	2218152	2237503		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004196212.1|2216523_2218152_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	7.7e-08
