The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010017	Burkholderia thailandensis 34 chromosome 1, complete sequence	3896053	82397	93077	3896053	transposase,portal	Burkholderia_virus(58.33%)	13	NA	NA
WP_102860124.1|82397_83597_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	9.2e-43
WP_045599085.1|83868_84960_+	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	97.5	1.2e-209
WP_102889828.1|85077_85834_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_009897078.1|86084_86207_+	CopG family transcriptional regulator	NA	A4JWV6	Burkholderia_virus	100.0	5.9e-14
WP_009897076.1|86309_86843_+	bacteriophage gp29 protein	NA	A4JWV5	Burkholderia_virus	99.4	2.4e-96
WP_045599088.1|86839_87577_+	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	98.4	4.2e-131
WP_082255833.1|87585_88707_+	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	99.5	6.3e-219
WP_006027262.1|89297_89594_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	99.0	5.6e-50
WP_004202809.1|89596_89953_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_045599090.1|89996_90974_-|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	98.8	2.7e-189
WP_045599091.1|91024_91420_-	helix-turn-helix transcriptional regulator	NA	S6B268	Ralstonia_phage	55.1	1.5e-26
WP_045599092.1|91951_92251_+	hypothetical protein	NA	W6CMZ9	Ralstonia_phage	40.4	4.2e-13
WP_102889801.1|92259_93077_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.6	8.6e-08
>prophage 2
NZ_CP010017	Burkholderia thailandensis 34 chromosome 1, complete sequence	3896053	449012	514547	3896053	transposase,coat,plate,tRNA	uncultured_Caudovirales_phage(33.33%)	48	NA	NA
WP_045598778.1|449012_451637_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	7.1e-80
WP_045598774.1|452080_453301_+	CoA transferase	NA	NA	NA	NA	NA
WP_009905865.1|453386_454193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038709125.1|454723_454933_-	ornithine acetyltransferase	NA	NA	NA	NA	NA
WP_009891706.1|455213_456923_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.9	2.8e-186
WP_009891707.1|457208_457685_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	2.0e-20
WP_009891709.1|457703_458090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598772.1|458376_460476_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_009905872.1|460401_460581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891712.1|460577_461438_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_045598769.1|461483_462887_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_045598767.1|463120_464704_+	acid phosphatase	NA	NA	NA	NA	NA
WP_045598765.1|464928_466122_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_045598763.1|466139_466982_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_009891722.1|467719_468352_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_045598762.1|468352_470425_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.8	1.6e-29
WP_045598760.1|470835_471801_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_045598757.1|471816_474228_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_009905896.1|474272_475112_-	molecular chaperone	NA	NA	NA	NA	NA
WP_038708375.1|475129_475654_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009905900.1|475736_476297_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_045598752.1|476349_476895_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009891734.1|477703_478597_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045598748.1|479012_480302_+	MFS transporter	NA	NA	NA	NA	NA
WP_025405114.1|480346_481273_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_009891740.1|481758_482040_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009927991.1|482302_482575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082255944.1|483451_484144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598747.1|484173_487197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598745.1|487199_488216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598742.1|488219_491042_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.6	1.2e-29
WP_009909765.1|491054_491360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045599247.1|491377_491710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038708366.1|492170_492662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082255818.1|493420_493915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405119.1|493892_497228_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_045598740.1|497336_499739_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_082255817.1|499735_500335_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_045598989.1|500331_500889_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_009905935.1|501025_501859_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_045598738.1|501861_504660_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.1	2.0e-27
WP_009891791.1|505185_505452_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_045598735.1|505475_506903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009905942.1|506931_508782_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009910381.1|510273_510492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127447005.1|510566_511253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405125.1|512096_513575_+	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_102889787.1|513735_514547_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP010017	Burkholderia thailandensis 34 chromosome 1, complete sequence	3896053	874697	930258	3896053	terminase,head,transposase,plate,tail,capsid,portal,integrase	uncultured_Caudovirales_phage(28.95%)	64	885742:885759	921588:921605
WP_045599388.1|874697_875369_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	83.8	6.6e-115
WP_045600761.1|875448_875913_+	hypothetical protein	NA	C7BGE3	Burkholderia_phage	61.7	3.3e-49
WP_045599391.1|875912_876194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599392.1|876253_876679_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	50.6	1.7e-15
WP_082255805.1|876675_877185_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	37.3	8.8e-19
WP_082255804.1|877526_878129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599395.1|878135_878858_+	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	39.5	4.1e-30
WP_045599396.1|878893_879682_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	96.9	9.4e-153
WP_045599398.1|879825_880371_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	91.7	7.6e-77
WP_045599399.1|880370_880868_-	lysozyme	NA	A4JX20	Burkholderia_virus	81.2	3.1e-69
WP_004533694.1|880860_881055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045599400.1|881130_882183_-	phage late control D protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.8	1.6e-78
WP_004538529.1|882192_882399_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	59.7	5.3e-15
WP_045599401.1|882373_883255_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	38.5	2.4e-32
WP_045599402.1|883263_885678_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	34.7	1.8e-69
885742:885759	attL	ACCGCTTGCGGACTGACC	NA	NA	NA	NA
WP_045599403.1|885765_886068_-|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.1e-05
WP_045599404.1|886139_886643_-|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	49.1	7.3e-42
WP_045599406.1|886653_887823_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	74.6	6.2e-161
WP_045599408.1|887897_888332_-|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	74.6	2.4e-41
WP_045599411.1|888347_889748_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	60.2	1.8e-159
WP_045599413.1|889744_890314_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	48.1	8.0e-37
WP_045599415.1|890303_891197_-|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	41.6	2.2e-49
WP_045599417.1|891193_891538_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	1.9e-25
WP_045599418.1|891534_891741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045600764.1|891805_892486_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	33.8	6.9e-19
WP_045599419.1|892488_893022_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	40.3	1.6e-23
WP_045599420.1|893011_893542_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	29.6	2.4e-11
WP_045599421.1|893543_893834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045599422.1|893837_894833_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	2.1e-109
WP_045599423.1|894897_895242_-|head	head decoration protein	head	NA	NA	NA	NA
WP_045599425.1|895268_896369_-	peptidase S14	NA	A0A2H4JDI2	uncultured_Caudovirales_phage	34.8	5.3e-45
WP_045599426.1|896365_897859_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	50.8	4.1e-133
WP_009964508.1|897855_898062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082255803.1|898072_900061_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.1	8.6e-179
WP_009964504.1|900023_900593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082255802.1|900798_901065_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_045599429.1|901624_902398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045599430.1|902615_905108_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	42.2	2.9e-99
WP_045600765.1|905228_905699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045599432.1|906072_906531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082255931.1|907237_907570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045599434.1|907583_908111_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.8	4.4e-29
WP_082255930.1|908486_909050_+	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	41.1	6.7e-12
WP_045600767.1|909601_909820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599438.1|909871_910207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599439.1|910203_910809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599440.1|910805_911255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599442.1|911254_912592_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_045599443.1|912693_913065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102889801.1|913190_914007_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.6	8.6e-08
WP_045599445.1|914004_914439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052712467.1|914451_914925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599447.1|914921_915161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599449.1|915230_917420_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_045599450.1|917409_918642_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	32.7	2.2e-15
WP_045600769.1|918736_919852_-|integrase	site-specific integrase	integrase	A0A248XD46	Klebsiella_phage	32.7	6.0e-44
WP_045599452.1|920306_921521_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	40.9	2.6e-85
WP_045598699.1|921977_923543_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	9.8e-69
921588:921605	attR	ACCGCTTGCGGACTGACC	NA	NA	NA	NA
WP_045598698.1|923574_923925_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	1.1e-17
WP_045598892.1|923900_924374_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_045599454.1|925132_927985_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.7	1.0e-71
WP_045599455.1|928129_928471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045600770.1|928467_928725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102889853.1|929123_930258_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.9	2.2e-14
>prophage 4
NZ_CP010017	Burkholderia thailandensis 34 chromosome 1, complete sequence	3896053	1110595	1121476	3896053	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_045599533.1|1110595_1112896_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	3.9e-167
WP_009892611.1|1112892_1113207_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
WP_004196460.1|1113737_1113941_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_045599534.1|1114052_1115648_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_045599535.1|1115812_1117072_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	6.8e-12
WP_009892615.1|1117336_1117915_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_080511442.1|1118175_1118391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019256450.1|1118586_1119096_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.0e-14
WP_009903323.1|1119361_1121476_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.0	2.3e-57
>prophage 5
NZ_CP010017	Burkholderia thailandensis 34 chromosome 1, complete sequence	3896053	1652123	1658838	3896053	transposase	Burkholderia_virus(50.0%)	7	NA	NA
WP_045598699.1|1652123_1653689_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	9.8e-69
WP_045598698.1|1653720_1654071_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	1.1e-17
WP_045598892.1|1654046_1654520_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010113596.1|1654848_1655397_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	80.7	8.4e-76
WP_045599756.1|1655393_1656155_+	nuclease	NA	A4JWV4	Burkholderia_virus	54.6	7.1e-57
WP_045599758.1|1656160_1657270_+	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	58.9	8.9e-125
WP_052712469.1|1657842_1658838_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	29.4	2.8e-29
>prophage 6
NZ_CP010017	Burkholderia thailandensis 34 chromosome 1, complete sequence	3896053	1704949	1756817	3896053	transposase,plate,tRNA	Leptospira_phage(28.57%)	43	NA	NA
WP_009906304.1|1704949_1706248_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_045599769.1|1706316_1707399_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_009906305.1|1707424_1708282_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004186955.1|1708361_1708670_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_009906309.1|1708683_1709280_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_045599770.1|1709535_1710324_+	dioxygenase	NA	NA	NA	NA	NA
WP_009888654.1|1710480_1712082_-	APC family permease	NA	NA	NA	NA	NA
WP_004196837.1|1712516_1712720_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	73.1	6.3e-21
WP_009906314.1|1712811_1714074_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_009888637.1|1714290_1714896_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_045599771.1|1715219_1716503_-	MFS transporter	NA	NA	NA	NA	NA
WP_045599772.1|1716661_1717297_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045599773.1|1717617_1718223_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_045599774.1|1718283_1719180_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_045600830.1|1719311_1720448_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_009906322.1|1721137_1721644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045599776.1|1722246_1724397_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	25.7	2.2e-47
WP_009906327.1|1725440_1725689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009888621.1|1725790_1726012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009888619.1|1726663_1727932_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_045599777.1|1727946_1730160_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.3	5.7e-38
WP_045599778.1|1730156_1731605_+	TolC family protein	NA	NA	NA	NA	NA
WP_045599779.1|1731801_1732767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025369750.1|1732892_1733744_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_045599780.1|1734029_1737950_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009888606.1|1737946_1738936_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_045599781.1|1738940_1739909_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009906864.1|1740098_1741229_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_045599782.1|1741314_1743978_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.0	1.8e-91
WP_019255984.1|1744011_1745112_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_045599783.1|1745075_1746914_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009888597.1|1746994_1747477_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_009906860.1|1747534_1748038_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_009888594.1|1748110_1749601_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009888592.1|1749617_1750136_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_045599785.1|1750172_1750862_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_025404121.1|1751235_1751850_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_009906858.1|1751958_1753305_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009888580.1|1753301_1754087_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_127447041.1|1754120_1754378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598699.1|1754420_1755986_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	9.8e-69
WP_045598698.1|1756017_1756368_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	1.1e-17
WP_045598892.1|1756343_1756817_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP010017	Burkholderia thailandensis 34 chromosome 1, complete sequence	3896053	1780202	1819051	3896053	transposase,protease,integrase	Leptospira_phage(42.86%)	38	1807435:1807480	1818443:1818488
WP_045598726.1|1780202_1781825_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.7	2.1e-66
WP_045598729.1|1781834_1782095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045599797.1|1782894_1783884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045600835.1|1784280_1785090_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_045599798.1|1785192_1785495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599799.1|1785496_1785850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599800.1|1785843_1786212_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_045599801.1|1786450_1788226_+	hypothetical protein	NA	A0A1L7N0M1	Ralstonia_phage	32.1	1.8e-55
WP_045599802.1|1788386_1789451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599803.1|1789885_1790752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158351394.1|1790847_1791873_+	DUF2806 domain-containing protein	NA	NA	NA	NA	NA
WP_127447040.1|1792026_1792761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127447039.1|1792997_1793963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599807.1|1793972_1795004_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_045598724.1|1795317_1795785_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_045598725.1|1795784_1796138_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	1.3e-16
WP_045598726.1|1796237_1797860_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.7	2.1e-66
WP_045598729.1|1797869_1798130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045599808.1|1799533_1799953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102889787.1|1799919_1800731_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_127447038.1|1801691_1801982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082255761.1|1802029_1803625_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_045599810.1|1804032_1805196_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_127447037.1|1805179_1806040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045599811.1|1806036_1807239_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	49.5	1.0e-105
1807435:1807480	attL	TGGTGCCGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAAT	NA	NA	NA	NA
WP_127447036.1|1807864_1808704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127447035.1|1808950_1809508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052712471.1|1810034_1810436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045599812.1|1810684_1811152_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_045599813.1|1811151_1812309_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_127447034.1|1812311_1812584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144411827.1|1813736_1813991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045599815.1|1813989_1814187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127447033.1|1814375_1814648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045599817.1|1814681_1815653_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_052712472.1|1816153_1816813_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_045599819.1|1817292_1818345_-|integrase	tyrosine-type recombinase/integrase	integrase	W6MYA3	Pseudomonas_phage	38.2	2.4e-50
WP_045600839.1|1818538_1819051_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.5	1.5e-21
1818443:1818488	attR	TGGTGCCGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAAT	NA	NA	NA	NA
>prophage 8
NZ_CP010017	Burkholderia thailandensis 34 chromosome 1, complete sequence	3896053	2030957	2068250	3896053	transposase	Leptospira_phage(30.0%)	31	NA	NA
WP_102889787.1|2030957_2031769_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_045599880.1|2031895_2032519_+	LysE family translocator	NA	NA	NA	NA	NA
WP_009906604.1|2032783_2034445_-	acid phosphatase	NA	NA	NA	NA	NA
WP_009906606.1|2034998_2035673_-	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_009906607.1|2035681_2036119_-	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_009906608.1|2036178_2036856_-	CsgG/HfaB family protein	NA	NA	NA	NA	NA
WP_155275006.1|2036870_2037455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906613.1|2037731_2038547_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_009906614.1|2038682_2039159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011402617.1|2039619_2041425_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	55.6	7.0e-10
WP_082255753.1|2041781_2044127_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_009906618.1|2044162_2045293_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_011402619.1|2045282_2045993_+	WbqC family protein	NA	NA	NA	NA	NA
WP_009906620.1|2045989_2046622_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_009906621.1|2046621_2047281_+	acetyltransferase	NA	NA	NA	NA	NA
WP_045599881.1|2047291_2048251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019255924.1|2048399_2049143_-	streptogramin acetyl transferase	NA	M1I2A5	Paramecium_bursaria_Chlorella_virus	33.3	2.2e-10
WP_009910161.1|2049675_2050320_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	31.9	2.3e-08
WP_127447030.1|2050851_2052516_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	51.9	3.6e-61
WP_162486614.1|2052573_2053347_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_045599882.1|2053934_2054240_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_045599883.1|2054560_2057341_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.2	8.0e-90
WP_045598892.1|2057469_2057943_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045598698.1|2057918_2058269_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	1.1e-17
WP_045598699.1|2058300_2059866_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	9.8e-69
WP_045599884.1|2059926_2062113_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.9	3.0e-23
WP_045599886.1|2062131_2063790_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_045599887.1|2063799_2064063_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_144411828.1|2064193_2065009_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.8	3.3e-07
WP_045598729.1|2066357_2066618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045598726.1|2066627_2068250_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.7	2.1e-66
>prophage 9
NZ_CP010017	Burkholderia thailandensis 34 chromosome 1, complete sequence	3896053	2077371	2087491	3896053	transposase,integrase	Burkholderia_phage(25.0%)	10	2080117:2080168	2092450:2092501
WP_025405302.1|2077371_2078592_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	92.6	4.4e-226
WP_045599893.1|2079028_2079226_+	hypothetical protein	NA	K4NZY3	Burkholderia_phage	93.8	7.5e-27
2080117:2080168	attL	CTTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAGGGCAG	NA	NA	NA	NA
WP_045599894.1|2080362_2081871_-	hypothetical protein	NA	P79669	Escherichia_phage	21.0	1.9e-13
WP_082255747.1|2082018_2082351_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	51.1	6.5e-15
WP_045599895.1|2082343_2082676_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	51.9	1.7e-18
WP_045600852.1|2082717_2083305_-|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	48.9	3.1e-44
WP_045599896.1|2083652_2084432_-	hypothetical protein	NA	A0A1W5LU59	Ralstonia_phage	42.2	8.4e-37
WP_045599897.1|2084956_2085190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599900.1|2085203_2086568_-	type II secretory pathway protein	NA	NA	NA	NA	NA
WP_045599095.1|2086564_2087491_-	AAA family ATPase	NA	Q6UAZ2	Ralstonia_phage	36.7	4.2e-27
2092450:2092501	attR	CTTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAGGGCAG	NA	NA	NA	NA
>prophage 10
NZ_CP010017	Burkholderia thailandensis 34 chromosome 1, complete sequence	3896053	2488124	2530975	3896053	transposase,holin,integrase,tRNA	Escherichia_phage(22.22%)	43	2488605:2488624	2536290:2536309
WP_009893359.1|2488124_2489120_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	71.0	2.6e-107
2488605:2488624	attL	CGCGATCTTCGTCGCGCCGA	NA	NA	NA	NA
WP_004199336.1|2489116_2489521_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_045600063.1|2489602_2490538_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_009902404.1|2490551_2491742_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_009893351.1|2491760_2491955_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_009893349.1|2492043_2492268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009902405.1|2492451_2493360_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_009893347.1|2493356_2494769_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_009902407.1|2494765_2495785_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_045600065.1|2495956_2497516_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.7	6.9e-14
WP_025404568.1|2497971_2499018_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_025404567.1|2499405_2499897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009902428.1|2500301_2501378_+	porin	NA	NA	NA	NA	NA
WP_009902430.1|2501537_2502500_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009893335.1|2502685_2503645_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_009902431.1|2503941_2504835_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_045600067.1|2504925_2505414_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_025404565.1|2505525_2506440_+	DMT family transporter	NA	NA	NA	NA	NA
WP_045600068.1|2506666_2506999_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_009902438.1|2506995_2507502_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_009902439.1|2507551_2508484_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	32.7	9.1e-38
WP_045600069.1|2508569_2509511_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_009893323.1|2509515_2509953_-	VOC family protein	NA	NA	NA	NA	NA
WP_045600071.1|2510102_2510741_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_045600073.1|2511121_2513239_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_025404562.1|2513285_2513597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009902447.1|2514038_2514497_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_019256199.1|2514621_2515350_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_009893313.1|2515346_2515649_+	AzlD family protein	NA	NA	NA	NA	NA
WP_025404561.1|2515645_2516479_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_045600076.1|2516767_2517661_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_082255903.1|2517870_2519220_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_025404559.1|2519216_2520035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004545945.1|2520236_2520431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082255902.1|2520452_2521175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102889803.1|2521117_2522253_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.9	2.2e-14
WP_045600080.1|2522397_2524473_+	molybdopterin oxidoreductase family protein	NA	A0A077SK27	Escherichia_phage	26.7	8.2e-55
WP_009888736.1|2524612_2526286_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.6	9.9e-35
WP_045599821.1|2526510_2527107_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	39.7	8.4e-29
WP_045599822.1|2527146_2528709_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.3	9.3e-144
WP_025404693.1|2528738_2529086_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
WP_082255759.1|2529085_2529448_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_045600741.1|2529646_2530975_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2536290:2536309	attR	TCGGCGCGACGAAGATCGCG	NA	NA	NA	NA
>prophage 11
NZ_CP010017	Burkholderia thailandensis 34 chromosome 1, complete sequence	3896053	2750949	2760180	3896053		Hokovirus(16.67%)	7	NA	NA
WP_009904051.1|2750949_2752902_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	6.6e-147
WP_009889258.1|2753165_2754296_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.0	1.8e-24
WP_025404755.1|2754327_2756337_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.7	8.2e-52
WP_009904054.1|2756512_2757328_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	3.3e-36
WP_045600868.1|2757392_2758076_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_045600187.1|2758072_2758600_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_009904055.1|2758635_2760180_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	2.5e-24
>prophage 12
NZ_CP010017	Burkholderia thailandensis 34 chromosome 1, complete sequence	3896053	3125921	3134631	3896053		Bacillus_phage(16.67%)	8	NA	NA
WP_009904402.1|3125921_3127322_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.7	1.4e-79
WP_052712481.1|3127290_3128277_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.4	1.4e-15
WP_009904403.1|3128334_3129327_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_009889858.1|3129398_3129716_+	competence protein ComE	NA	NA	NA	NA	NA
WP_009904404.1|3130050_3130953_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	4.3e-53
WP_045600363.1|3131047_3132289_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_009889864.1|3132467_3133391_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
WP_009904406.1|3133719_3134631_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.8	9.2e-19
>prophage 13
NZ_CP010017	Burkholderia thailandensis 34 chromosome 1, complete sequence	3896053	3419732	3523069	3896053	tRNA,terminase,head,transposase,plate,tail,protease,capsid,portal,integrase	uncultured_Caudovirales_phage(22.45%)	106	3439190:3439209	3529465:3529484
WP_045600498.1|3419732_3421259_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.2	7.3e-85
WP_080554852.1|3421331_3422360_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.1	2.0e-06
WP_009909025.1|3422663_3424358_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A0K2FM92	Brevibacillus_phage	27.5	1.4e-28
WP_082255967.1|3424373_3425459_-	regulator	NA	NA	NA	NA	NA
WP_009890181.1|3425808_3427062_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011402197.1|3427054_3427804_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.4	4.9e-34
WP_009904677.1|3427808_3428597_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_045600502.1|3428650_3431188_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_009890187.1|3431224_3432052_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_009904686.1|3432294_3433956_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.0	1.4e-150
WP_009890191.1|3433952_3434807_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.0e-48
WP_009890193.1|3434911_3436195_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.1	9.3e-150
WP_009890195.1|3436286_3436718_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_045600503.1|3436879_3437224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009904690.1|3437312_3438263_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_009890200.1|3438301_3438826_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_045600504.1|3439004_3439823_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
3439190:3439209	attL	GCCGCGCCTGCTCGCGCGGC	NA	NA	NA	NA
WP_009904693.1|3440109_3441000_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_045600900.1|3441211_3442042_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_009904695.1|3442105_3442735_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_009890209.1|3442833_3443499_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_009890211.1|3443507_3444710_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_045600506.1|3444706_3445324_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_045600508.1|3445368_3446271_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_025404919.1|3446381_3447524_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_009904699.1|3447530_3448307_+	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	27.1	4.3e-09
WP_009904703.1|3448972_3450160_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_045600509.1|3450228_3450774_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_045600510.1|3450753_3452052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045600512.1|3452038_3454720_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.0	2.2e-28
WP_004547867.1|3454879_3456181_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.9	2.3e-148
WP_009890227.1|3456131_3456374_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
WP_045600901.1|3456382_3456856_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	2.3e-05
WP_025405240.1|3456864_3457194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964483.1|3457307_3458624_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_045600513.1|3458623_3459073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534172.1|3459069_3459675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045600515.1|3459671_3460007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004550209.1|3460058_3460277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123850154.1|3460405_3460861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909040.1|3460808_3461294_-	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	41.2	4.4e-12
WP_076853252.1|3461442_3461670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599434.1|3461758_3462286_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.8	4.4e-29
WP_082255966.1|3462299_3462632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045600516.1|3463338_3463797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045600903.1|3464170_3464641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045600517.1|3464762_3467255_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.5	2.5e-98
WP_017844234.1|3467472_3468246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009944039.1|3468808_3469075_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_082255861.1|3469273_3469843_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082255860.1|3469805_3471794_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	6.0e-180
WP_004533700.1|3471804_3472011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045600519.1|3472007_3473501_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.4	1.2e-135
WP_045600520.1|3473497_3474565_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.8	1.1e-50
WP_004539732.1|3474591_3474936_+|head	head decoration protein	head	NA	NA	NA	NA
WP_082255859.1|3474970_3475996_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	59.1	1.7e-109
WP_045599421.1|3475999_3476290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599420.1|3476291_3476822_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	29.6	2.4e-11
WP_045600523.1|3476811_3477345_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	38.8	1.8e-22
WP_025405226.1|3477347_3478028_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.5e-18
WP_025405225.1|3478091_3478298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045600525.1|3478294_3478639_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	50.9	3.2e-25
WP_045600526.1|3478635_3479529_+|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	41.9	2.4e-51
WP_045600528.1|3479518_3480088_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	47.6	1.8e-36
WP_045600530.1|3480084_3481485_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	61.0	2.8e-160
WP_045600532.1|3481500_3481935_+|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	74.6	2.4e-41
WP_045600533.1|3482009_3483179_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	74.3	1.1e-160
WP_045599404.1|3483189_3483693_+|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	49.1	7.3e-42
WP_045600534.1|3483764_3484067_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.1e-05
WP_045600536.1|3484154_3486569_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.2	4.7e-70
WP_045600537.1|3486577_3487459_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	38.5	1.9e-32
WP_045600906.1|3487433_3487640_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	59.7	1.2e-14
WP_045600538.1|3487649_3488702_+	phage late control D protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.5	2.7e-78
WP_004533694.1|3488777_3488972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045600540.1|3488964_3489462_+	lysozyme	NA	A4JX20	Burkholderia_virus	75.4	3.6e-65
WP_045600542.1|3489461_3490007_+	lysozyme	NA	Q8W6S5	Burkholderia_virus	95.6	9.2e-83
WP_045600543.1|3490150_3490939_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	97.3	1.6e-152
WP_024430649.1|3490979_3491690_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	41.0	2.6e-37
WP_045600908.1|3491701_3492217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045600544.1|3492188_3492662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045600910.1|3492654_3493161_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	4.3e-18
WP_025404957.1|3493160_3493586_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	48.3	2.4e-14
WP_025405797.1|3493647_3493929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009904707.1|3493928_3494393_-	hypothetical protein	NA	C7BGE3	Burkholderia_phage	61.0	8.8e-50
WP_045600545.1|3494472_3495144_+	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	81.9	4.9e-110
WP_082255857.1|3495263_3495749_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_052712484.1|3495774_3497367_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_102860126.1|3498002_3499202_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	9.2e-43
WP_080403979.1|3499877_3500900_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	35.5	1.8e-50
WP_019254661.1|3502536_3502809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009890278.1|3503073_3503877_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_025404921.1|3504188_3505100_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_009890280.1|3505301_3506084_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_009890284.1|3506457_3507258_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_009890286.1|3507281_3507773_-	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	29.8	8.2e-06
WP_009890287.1|3507853_3508429_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	40.0	2.4e-12
WP_019254658.1|3508484_3509207_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_009890291.1|3509437_3510835_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.8	2.4e-42
WP_045600549.1|3510882_3511821_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_009904725.1|3511923_3512895_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_045600551.1|3512938_3514411_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_009890299.1|3514751_3516002_+	aspartate kinase	NA	NA	NA	NA	NA
WP_127447014.1|3516700_3518440_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_102889803.1|3521181_3522317_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.9	2.2e-14
WP_045600558.1|3522350_3522707_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	70.3	6.5e-37
WP_082255759.1|3522706_3523069_-|transposase	transposase	transposase	NA	NA	NA	NA
3529465:3529484	attR	GCCGCGCGAGCAGGCGCGGC	NA	NA	NA	NA
>prophage 1
NZ_CP010018	Burkholderia thailandensis 34 chromosome 2, complete sequence	2897757	264571	374814	2897757	tail,plate,integrase,transposase,tRNA	Burkholderia_phage(37.21%)	106	323472:323491	355381:355400
WP_009899358.1|264571_265384_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_045601189.1|265383_267954_-	membrane protein	NA	NA	NA	NA	NA
WP_009895845.1|268089_269211_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_009899338.1|269582_270650_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_009895841.1|270763_271414_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_009895839.1|271491_271641_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_009895837.1|271637_273047_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_009895836.1|273240_273768_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_045601191.1|273928_276661_+	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_045601193.1|277264_278509_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_009899333.1|279339_279729_-	VOC family protein	NA	NA	NA	NA	NA
WP_045601195.1|279804_280773_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009895831.1|280883_282185_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_004528990.1|282237_282510_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_009895822.1|282511_283213_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_009895820.1|283234_285010_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_009895819.1|285013_285382_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_009895818.1|285386_285803_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_038708254.1|286002_286812_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009895814.1|287101_288085_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_045601197.1|288282_289302_+	aldolase	NA	NA	NA	NA	NA
WP_009895811.1|289458_289968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045601198.1|290046_291498_+	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_009895807.1|291545_294263_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_025987288.1|294621_296715_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_045601201.1|297143_297518_-	DUF2784 domain-containing protein	NA	NA	NA	NA	NA
WP_011400975.1|297716_298151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025987287.1|298266_299874_-	tyrosinase family protein	NA	NA	NA	NA	NA
WP_082256058.1|299925_300168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405423.1|300154_300787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162486616.1|301608_301884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045601204.1|302243_303992_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_009899295.1|304074_304914_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009895785.1|304945_306205_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009895783.1|306305_307352_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009899293.1|307426_308539_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	8.1e-25
WP_045601207.1|308647_310177_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_045601208.1|310258_311293_-	lipase secretion chaperone	NA	NA	NA	NA	NA
WP_011400969.1|311296_312391_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_019255060.1|312717_314979_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_045601210.1|315065_315461_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_009899277.1|315621_316158_-	cytochrome b	NA	NA	NA	NA	NA
WP_009895772.1|316412_317048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045602985.1|317163_317925_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_019255065.1|318193_318505_-	cupin	NA	NA	NA	NA	NA
WP_009895765.1|318949_319282_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_045601211.1|319480_320896_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	30.5	9.2e-42
WP_009899263.1|320884_321028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045601213.1|321350_322028_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_045601215.1|321990_322908_-	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	25.3	5.3e-14
WP_009899260.1|322904_324329_-	cytosine permease	NA	NA	NA	NA	NA
323472:323491	attL	CGCGGCCGTCGCGCCGCTCG	NA	NA	NA	NA
WP_102889782.1|325076_326311_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.2	3.4e-101
WP_045601221.1|326716_327934_+	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	26.5	7.2e-27
WP_045601222.1|328216_328918_-|tail	tail fiber assembly protein	tail	E5E3Q6	Burkholderia_phage	60.8	7.5e-61
WP_045601223.1|328933_330901_-|tail	tail fiber protein	tail	Q45YG3	Burkholderia_virus	58.8	8.7e-131
WP_009907013.1|330900_331482_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	86.5	1.5e-91
WP_009907014.1|331474_332626_-|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	79.9	2.3e-168
WP_009907015.1|332622_332976_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	82.9	4.2e-52
WP_045601225.1|333421_333862_-|tail	phage tail protein	tail	A0A291LAV4	Bordetella_phage	41.7	3.4e-19
WP_144411832.1|335108_335411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045601229.1|335424_336027_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	69.0	5.6e-65
WP_045601230.1|336023_337229_-	bacteriophage regulatory protein	NA	A4JWL3	Burkholderia_virus	70.6	5.0e-137
WP_009906886.1|337216_337423_-	membrane protein	NA	A4JWL2	Burkholderia_virus	78.3	1.5e-25
WP_009906887.1|337422_338325_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	72.1	3.5e-71
WP_082256159.1|338326_340420_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	49.8	2.4e-155
WP_009906947.1|341035_341194_-	hypothetical protein	NA	Q6QIA7	Burkholderia_phage	80.8	2.5e-17
WP_009906946.1|341165_341495_-|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	65.7	1.8e-25
WP_045599843.1|341652_342873_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	92.4	2.2e-225
WP_025405412.1|343161_343686_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	90.8	1.0e-86
WP_045601234.1|343687_345121_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	87.2	6.1e-243
WP_009906943.1|345124_345370_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	62.5	1.7e-20
WP_009906942.1|345366_345831_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	60.1	3.9e-42
WP_045601238.1|346001_346316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045601240.1|346648_346981_-	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	78.7	5.0e-47
WP_009906940.1|346977_347316_-	hypothetical protein	NA	A4JWP6	Burkholderia_virus	82.7	4.0e-44
WP_155275021.1|347312_347747_-	hypothetical protein	NA	A4JWP5	Burkholderia_virus	69.3	4.4e-43
WP_025405408.1|347911_348520_-	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	79.8	3.9e-90
WP_045601243.1|348522_348870_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	79.1	9.2e-44
WP_060970118.1|349345_350290_-	hypothetical protein	NA	A4JWN9	Burkholderia_virus	29.2	3.4e-24
WP_052712508.1|350286_350706_-	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	51.4	6.7e-25
WP_009906820.1|350836_351079_+	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	90.0	7.3e-32
WP_155722056.1|351153_351597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009899245.1|351593_351905_+	helix-turn-helix domain-containing protein	NA	A4JWN4	Burkholderia_virus	80.0	1.7e-33
WP_045601248.1|351918_352884_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	70.3	3.2e-102
WP_009899242.1|352898_354695_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	80.2	4.3e-278
WP_082256055.1|354691_355945_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	69.1	7.2e-155
355381:355400	attR	CGCGGCCGTCGCGCCGCTCG	NA	NA	NA	NA
WP_009899237.1|355976_356309_+	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	58.2	2.5e-22
WP_009899234.1|356405_357020_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	83.4	2.2e-93
WP_009899233.1|357110_357467_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	76.8	1.1e-44
WP_045601250.1|357800_358301_+	hypothetical protein	NA	A0A2H4N7D9	Pectobacterium_phage	55.0	1.8e-32
WP_127446954.1|358392_358791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019256110.1|358771_359062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045601251.1|359155_359341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009899229.1|359709_361752_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_009895748.1|361810_362149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045601252.1|362195_364073_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.8	2.5e-66
WP_045601253.1|364169_364616_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	49.3	5.1e-23
WP_009895742.1|364782_364995_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_045601255.1|365074_366298_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025405402.1|366428_367469_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.0	1.7e-93
WP_009895738.1|367883_368693_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_009899218.1|368843_370748_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_045601256.1|370832_371717_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_045601257.1|371713_372007_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_009899213.1|372276_373383_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_045600741.1|373485_374814_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP010018	Burkholderia thailandensis 34 chromosome 2, complete sequence	2897757	913613	990456	2897757	holin,plate,transposase	Ralstonia_phage(40.0%)	58	NA	NA
WP_009894757.1|913613_914132_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_009894755.1|914133_916014_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009898345.1|916010_917060_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009898344.1|917078_918149_+	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_045601534.1|918204_919233_+	fimbrial protein	NA	NA	NA	NA	NA
WP_045601536.1|919265_920624_+	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	49.5	3.4e-110
WP_045601537.1|920516_923969_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_004523693.1|923981_924251_-	PAAR motif protein	NA	NA	NA	NA	NA
WP_045601538.1|924325_927004_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-35
WP_045601539.1|927104_927674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045601540.1|927864_931773_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_045601541.1|931787_933089_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_045603054.1|933085_934435_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_019255186.1|934440_934983_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_009894730.1|935110_935593_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_009894729.1|935793_937293_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_045601543.1|937326_937866_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_045601545.1|938209_939886_-	OmpA family protein	NA	NA	NA	NA	NA
WP_009907089.1|939888_940578_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_045601546.1|940608_941154_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_045601547.1|941173_943870_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_162465482.1|943822_943981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045601548.1|944029_944755_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_009898306.1|944836_945391_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_082256026.1|945976_946570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080558013.1|946542_946749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045601549.1|946820_948272_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_045601550.1|948347_950495_-	hypothetical protein	NA	K4F7R4	Cronobacter_phage	46.1	7.8e-08
WP_155275045.1|951339_951696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045601551.1|952043_953585_+	membrane protein	NA	NA	NA	NA	NA
WP_038708432.1|954596_956663_+	FUSC family protein	NA	NA	NA	NA	NA
WP_009894707.1|956659_956884_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_009898285.1|956885_957785_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_045601552.1|957778_959203_+	TolC family protein	NA	NA	NA	NA	NA
WP_069255329.1|959202_960402_+	transcriptional regulator CynR	NA	NA	NA	NA	NA
WP_155275044.1|960515_960749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009898271.1|960770_961001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045601554.1|961395_961698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082256023.1|962315_963239_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045601557.1|963910_965053_+	porin	NA	NA	NA	NA	NA
WP_082256021.1|965529_965886_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_019255408.1|966708_967401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004523720.1|967873_968200_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004523721.1|968219_968639_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_045601559.1|969053_969317_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_045601560.1|969326_970985_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_082256020.1|971003_972494_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.4	1.0e-06
WP_009894667.1|973329_973593_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_045601561.1|973602_975261_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_045601562.1|977532_980313_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.3	6.2e-90
WP_045601564.1|980633_980939_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_045601565.1|981581_982613_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_045601567.1|982609_983464_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009894659.1|983450_984296_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009894657.1|984831_985284_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_045601570.1|985302_986319_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_102889796.1|986343_987155_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_045601576.1|988260_990456_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
>prophage 3
NZ_CP010018	Burkholderia thailandensis 34 chromosome 2, complete sequence	2897757	1492499	1527897	2897757	integrase,transposase	Burkholderia_virus(27.27%)	37	1494244:1494260	1520519:1520535
WP_082255786.1|1492499_1493963_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_009893969.1|1494102_1495302_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
1494244:1494260	attL	CGAGTACGAGAACATCC	NA	NA	NA	NA
WP_009901217.1|1495590_1497681_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_011401484.1|1497903_1498455_+	membrane protein	NA	NA	NA	NA	NA
WP_045601911.1|1498514_1498844_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_011401483.1|1498903_1499746_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_009901215.1|1499742_1501143_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_011401482.1|1501202_1501613_+	heme-binding protein	NA	NA	NA	NA	NA
WP_011401481.1|1501918_1502185_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_009901213.1|1502328_1502814_-	DUF1857 family protein	NA	NA	NA	NA	NA
WP_009901212.1|1502932_1503805_-	pirin family protein	NA	NA	NA	NA	NA
WP_009893955.1|1503928_1504894_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009901209.1|1505259_1505688_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_009901208.1|1505701_1506430_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_045601912.1|1506466_1507201_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_009893950.1|1507428_1507668_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_045601913.1|1507802_1508675_-	glutamate racemase	NA	NA	NA	NA	NA
WP_009893946.1|1508720_1509197_-	bacterioferritin	NA	NA	NA	NA	NA
WP_009893945.1|1509352_1510888_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_009893943.1|1510927_1511536_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.2	9.2e-23
WP_009901203.1|1511766_1512666_-	DMT family transporter	NA	NA	NA	NA	NA
WP_045601914.1|1512955_1514938_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.3	8.9e-83
WP_045143316.1|1515035_1515416_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_045601915.1|1515409_1517425_+	VC_2705 family sodium/solute symporter	NA	NA	NA	NA	NA
WP_082256127.1|1517627_1518200_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	66.5	2.7e-56
WP_045601917.1|1518507_1518723_-	hypothetical protein	NA	Q6JIH9	Burkholderia_virus	77.5	4.3e-28
WP_045601918.1|1518767_1519043_-	hypothetical protein	NA	A1YZS4	Burkholderia_virus	69.8	1.2e-30
WP_082256201.1|1519070_1519253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598699.1|1519816_1521382_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	9.8e-69
1520519:1520535	attR	CGAGTACGAGAACATCC	NA	NA	NA	NA
WP_045601925.1|1521413_1521764_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_045598892.1|1521739_1522213_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_045598824.1|1522418_1523249_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.9	1.6e-14
WP_045603127.1|1524040_1524379_+	hypothetical protein	NA	A4JX41	Burkholderia_virus	90.2	1.9e-49
WP_045601927.1|1524426_1524627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045603129.1|1524661_1525051_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	39.8	2.4e-16
WP_052712499.1|1525928_1526366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102889803.1|1526761_1527897_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.9	2.2e-14
>prophage 4
NZ_CP010018	Burkholderia thailandensis 34 chromosome 2, complete sequence	2897757	1635131	1729403	2897757	terminase,tail,plate,holin,integrase,transposase	Burkholderia_phage(87.76%)	92	1627536:1627555	1696769:1696788
1627536:1627555	attL	TCGCACTCGCGCTCGCGCGC	NA	NA	NA	NA
WP_102889787.1|1635131_1635942_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_025405836.1|1635973_1636345_+	membrane protein	NA	NA	NA	NA	NA
WP_045601994.1|1636625_1638233_-	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	32.8	3.0e-36
WP_009901055.1|1638373_1638937_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_045601996.1|1639192_1640290_-	chitin-binding protein	NA	C3TWS8	Euproctis_pseudoconspersa_nucleopolyhedrovirus	32.1	8.0e-25
WP_045601997.1|1640642_1641128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045601999.1|1641192_1641816_-	nitroreductase	NA	NA	NA	NA	NA
WP_045602000.1|1642040_1642532_-	DUF1804 family protein	NA	B5TA69	Burkholderia_phage	44.9	4.3e-31
WP_045602001.1|1644625_1644886_-	hypothetical protein	NA	B5TA66	Burkholderia_phage	69.8	7.4e-22
WP_045602002.1|1644930_1646463_-	DUF935 family protein	NA	B5TA67	Burkholderia_phage	89.3	8.5e-251
WP_045602004.1|1646452_1648069_-|terminase	phage terminase large subunit	terminase	B5TA68	Burkholderia_phage	92.4	2.4e-304
WP_038755846.1|1648075_1648573_-	DUF1804 family protein	NA	B5TA69	Burkholderia_phage	93.9	3.5e-81
WP_009927781.1|1648576_1648867_-	hypothetical protein	NA	B5TA70	Burkholderia_phage	89.6	1.3e-40
WP_038724579.1|1648863_1649085_-	hypothetical protein	NA	B5TA71	Burkholderia_phage	89.0	4.3e-31
WP_082256119.1|1649192_1649657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009927784.1|1649653_1650328_-	lytic transglycosylase domain-containing protein	NA	B5TA73	Burkholderia_phage	71.4	6.3e-89
WP_052712509.1|1650324_1650636_-	hypothetical protein	NA	B5TA74	Burkholderia_phage	72.6	7.4e-37
WP_045602008.1|1650752_1651025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045602010.1|1651021_1651504_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_127446971.1|1651545_1652244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045602012.1|1652268_1652805_-	hypothetical protein	NA	B5TA76	Burkholderia_phage	67.4	2.8e-60
WP_045602013.1|1652848_1653349_-	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	35.3	1.3e-11
WP_045602015.1|1653413_1653605_+	DNA-binding protein	NA	B5TA78	Burkholderia_phage	76.3	6.0e-21
WP_045602017.1|1653601_1654651_+	hypothetical protein	NA	B5TA79	Burkholderia_phage	77.8	2.7e-139
WP_045602019.1|1654688_1656314_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	B5TA80	Burkholderia_phage	95.0	4.6e-303
WP_045602021.1|1656323_1657316_+	AAA family ATPase	NA	B5TA81	Burkholderia_phage	93.9	2.4e-174
WP_045603147.1|1657323_1657512_+	hypothetical protein	NA	B5TA82	Burkholderia_phage	71.0	5.7e-16
WP_045602024.1|1657508_1657814_+	hypothetical protein	NA	B5TA83	Burkholderia_phage	86.1	3.5e-39
WP_045602025.1|1657800_1658388_+	hypothetical protein	NA	B5TA84	Burkholderia_phage	92.9	3.4e-83
WP_045602027.1|1658384_1659011_+	DUF3164 family protein	NA	B5TA85	Burkholderia_phage	91.8	4.6e-102
WP_045602029.1|1659021_1659414_+	hypothetical protein	NA	B5TA86	Burkholderia_phage	94.6	1.8e-67
WP_045602031.1|1659477_1659750_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	93.3	1.1e-36
WP_082256118.1|1659825_1660110_+	hypothetical protein	NA	B5TA88	Burkholderia_phage	66.1	1.6e-14
WP_045602033.1|1660273_1660597_+	hypothetical protein	NA	B5TA89	Burkholderia_phage	87.6	1.5e-48
WP_045602036.1|1660598_1661039_+	regulatory protein GemA	NA	B5TA90	Burkholderia_phage	92.5	9.4e-70
WP_006484119.1|1661035_1661434_+	hypothetical protein	NA	B5TA91	Burkholderia_phage	100.0	1.1e-69
WP_045602041.1|1661647_1662796_+	hypothetical protein	NA	B5TA92	Burkholderia_phage	87.9	1.5e-188
WP_009927839.1|1662840_1663197_+	DUF2190 family protein	NA	B5TA94	Burkholderia_phage	77.1	3.3e-41
WP_045602043.1|1663252_1664200_+	hypothetical protein	NA	B5TA95	Burkholderia_phage	92.7	4.4e-165
WP_045603149.1|1664273_1664675_+	hypothetical protein	NA	B5TA96	Burkholderia_phage	69.8	1.2e-10
WP_045602045.1|1664671_1665175_+	DUF1320 family protein	NA	B5TA97	Burkholderia_phage	92.8	1.0e-88
WP_045602047.1|1665171_1665606_+	virion morphogenesis protein	NA	B5TA98	Burkholderia_phage	75.7	5.0e-55
WP_045603151.1|1665620_1666223_+	hypothetical protein	NA	B5TA99	Burkholderia_phage	51.8	2.7e-51
WP_045602049.1|1666191_1666458_+	hypothetical protein	NA	B5TAA0	Burkholderia_phage	55.8	1.3e-13
WP_045602051.1|1666508_1667987_+|tail	tail sheath protein	tail	B5TAA1	Burkholderia_phage	79.9	7.5e-220
WP_045602053.1|1668033_1668405_+	hypothetical protein	NA	B5TAA2	Burkholderia_phage	75.6	2.4e-50
WP_045602055.1|1668437_1668662_+	hypothetical protein	NA	E5EYD6	Acinetobacter_phage	66.2	7.5e-23
WP_045602057.1|1668753_1669302_+	hypothetical protein	NA	B5TAA3	Burkholderia_phage	70.1	1.1e-64
WP_045602059.1|1669350_1672014_+|tail	tail protein	tail	B5TAA4	Burkholderia_phage	65.4	3.3e-218
WP_045602060.1|1672017_1673406_+	multidrug DMT transporter	NA	B5TAA5	Burkholderia_phage	73.4	4.0e-191
WP_045602062.1|1673408_1674575_+	hypothetical protein	NA	B5TAA6	Burkholderia_phage	79.3	1.7e-182
WP_045602064.1|1674571_1675087_+|plate	baseplate assembly protein	plate	B5TAA7	Burkholderia_phage	63.2	1.0e-54
WP_045602066.1|1675173_1675761_+|tail	tail protein	tail	B5TAA8	Burkholderia_phage	73.4	2.5e-81
WP_045602069.1|1675757_1676879_+|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	72.7	6.6e-152
WP_045602071.1|1676878_1677475_+	DUF2313 domain-containing protein	NA	B5TAB0	Burkholderia_phage	62.8	9.8e-62
WP_045602073.1|1677486_1678773_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	61.9	5.0e-127
WP_045602075.1|1678786_1679221_+|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	75.7	2.0e-43
WP_011401430.1|1679971_1681387_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_045602078.1|1681481_1682423_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_045602080.1|1682431_1683388_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_045602082.1|1683512_1686950_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_045603152.1|1687153_1689802_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_045602085.1|1689792_1690830_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_045602087.1|1690963_1692466_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_045602088.1|1692571_1693807_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_025405833.1|1693994_1694726_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_045602089.1|1695080_1696154_-	FUSC family protein	NA	NA	NA	NA	NA
WP_045603157.1|1696949_1697540_+	glutamine amidotransferase	NA	NA	NA	NA	NA
1696769:1696788	attR	GCGCGCGAGCGCGAGTGCGA	NA	NA	NA	NA
WP_009901031.1|1697680_1698748_-	2-aminoethylphosphonate aminotransferase	NA	NA	NA	NA	NA
WP_045602091.1|1698762_1699944_-	phosphonopyruvate decarboxylase	NA	NA	NA	NA	NA
WP_019256483.1|1699940_1701629_-	phosphoenolpyruvate mutase	NA	NA	NA	NA	NA
WP_009901024.1|1701625_1702393_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_045602093.1|1702431_1703433_-	HpnL family protein	NA	NA	NA	NA	NA
WP_009893782.1|1703429_1704203_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_009901017.1|1704199_1704895_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_045602095.1|1705260_1706775_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_045602097.1|1708396_1709341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901015.1|1709374_1709926_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009901014.1|1709928_1711434_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_045598712.1|1711577_1712105_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_009901012.1|1712183_1712615_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_045598709.1|1712628_1714491_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009893772.1|1714487_1715477_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_045598707.1|1715479_1718323_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.0	1.2e-61
WP_045602102.1|1718313_1720605_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_045602104.1|1720719_1723008_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_045602106.1|1723011_1725228_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_009900995.1|1725227_1726298_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_045598706.1|1726300_1727017_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_009893761.1|1727056_1727446_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_009900994.1|1727451_1728045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045598705.1|1728041_1729403_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP010016	Burkholderia thailandensis 34 plasmid unnamed, complete sequence	326388	15211	70246	326388	transposase,plate	Leptospira_phage(38.46%)	40	NA	NA
WP_045598689.1|15211_16318_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082256005.1|16759_17653_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	56.3	1.3e-38
WP_045598690.1|17887_19114_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_045598692.1|19453_19807_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.4	8.2e-16
WP_082256006.1|20214_20988_-	FkbM family methyltransferase	NA	A0A218MM68	uncultured_virus	30.3	3.1e-15
WP_127447004.1|21606_21948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598892.1|22145_22619_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045598698.1|22594_22945_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	1.1e-17
WP_045598699.1|22976_24542_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	9.8e-69
WP_045598980.1|24670_24946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598702.1|25157_25595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893756.1|25617_25977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598703.1|26035_29530_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_045598705.1|31337_32699_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009900994.1|32695_33289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893761.1|33294_33684_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_045598706.1|33723_34440_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_009900995.1|34442_35513_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_045598707.1|42434_45278_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	28.8	2.5e-78
WP_009893772.1|45280_46270_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_045598709.1|46266_48129_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009901012.1|48142_48574_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_045598712.1|48652_49180_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_009901014.1|49323_50829_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009901015.1|50831_51383_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_045598715.1|51416_52352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598716.1|52812_54039_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_102889827.1|54792_56027_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	9.1e-102
WP_082265638.1|56425_56860_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	36.4	2.1e-13
WP_045598721.1|56856_57204_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.6	5.9e-35
WP_045598724.1|57604_58072_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_045598725.1|58071_58425_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	1.3e-16
WP_045598726.1|58524_60147_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.7	2.1e-66
WP_045598729.1|60156_60417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598730.1|61806_62403_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	34.5	1.2e-22
WP_045598987.1|62429_63047_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	27.5	3.9e-05
WP_045598732.1|63043_63352_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_127447005.1|65924_66611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009910381.1|66685_66904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905942.1|68395_70246_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NZ_CP010016	Burkholderia thailandensis 34 plasmid unnamed, complete sequence	326388	191336	309400	326388	transposase,integrase,tRNA	Leptospira_phage(20.0%)	112	257345:257360	301833:301848
WP_102889803.1|191336_192471_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	26.5	1.0e-11
WP_045598827.1|193217_194750_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_127447007.1|194742_194958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191840.1|195320_195866_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_009891596.1|196120_196825_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_009891594.1|196826_197468_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_009891589.1|197864_198587_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	31.6	7.1e-06
WP_045598830.1|198634_199735_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_009891586.1|199748_200309_-	ester cyclase	NA	NA	NA	NA	NA
WP_045598831.1|200495_201401_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045598833.1|201454_201886_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_009905763.1|201917_203108_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_019255973.1|204608_204962_+	RidA family protein	NA	NA	NA	NA	NA
WP_009905759.1|205007_207251_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_009905758.1|207703_209611_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.5	2.2e-123
WP_071810680.1|209660_210185_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	28.7	4.1e-11
WP_004191477.1|210378_210576_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004192938.1|210606_210966_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_019255972.1|211114_212128_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.2	1.3e-29
WP_045598836.1|212215_214648_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_009891557.1|214720_215125_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.1e-11
WP_009905754.1|215183_215588_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045598840.1|215722_217876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905747.1|218452_219220_-	FkbM family methyltransferase	NA	A0A291AUV0	Sinorhizobium_phage	26.2	3.9e-10
WP_045598844.1|219911_221111_-	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
WP_045598846.1|221121_221610_-	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_025405302.1|221700_222921_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	92.6	4.4e-226
WP_009905744.1|223235_224441_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_045598850.1|225745_225931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082255990.1|226103_226871_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_045598851.1|227152_227476_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_102889859.1|227828_228500_-	OmpA family protein	NA	NA	NA	NA	NA
WP_082255991.1|228666_231072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158351381.1|231570_232629_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_082256008.1|233187_233766_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	53.4	1.6e-40
WP_082255993.1|233842_234235_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_158351383.1|234257_234494_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	53.6	4.8e-12
WP_045598866.1|234624_234927_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_045598867.1|235096_236119_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	47.5	1.9e-84
WP_045598869.1|236298_238131_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	47.2	1.3e-141
WP_082256009.1|238722_239580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598871.1|239692_241069_-	exopolysaccharide Pel transporter PelG	NA	NA	NA	NA	NA
WP_045598873.1|241068_242712_-	DUF3492 domain-containing protein	NA	NA	NA	NA	NA
WP_045598875.1|242708_243722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598877.1|243714_245115_-	membrane protein	NA	NA	NA	NA	NA
WP_052712455.1|245150_245702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082256010.1|245739_249606_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_127447000.1|249676_252424_-	sugar ABC transporter	NA	NA	NA	NA	NA
WP_158351385.1|253184_253346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598690.1|254045_255272_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_082256011.1|255459_257013_+	S8 family peptidase	NA	A0A2K9L199	Tupanvirus	34.2	2.8e-15
WP_045598690.1|257086_258313_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
257345:257360	attL	GTCGCGCTCGTCGAGC	NA	NA	NA	NA
WP_127447001.1|258802_259057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045598883.1|259128_259455_-	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	39.4	9.0e-09
WP_045598886.1|259464_259743_-	hypothetical protein	NA	A0A2L1IV28	Escherichia_phage	47.8	1.9e-20
WP_060970101.1|259814_260060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082255996.1|260303_260519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598888.1|260515_261289_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.7	1.4e-36
WP_045598890.1|261275_262775_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.8	6.0e-31
WP_158351387.1|263396_263768_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052712457.1|264911_266138_+	replication initiation protein	NA	NA	NA	NA	NA
WP_045598892.1|267293_267767_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045598698.1|267742_268093_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	1.1e-17
WP_045598699.1|268124_269690_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	9.8e-69
WP_082255997.1|269782_270055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102889787.1|270454_271265_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_045598894.1|271313_272345_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_045598899.1|272341_273001_-	AAA family ATPase	NA	A2I303	Vibrio_virus	32.9	4.8e-17
WP_127447002.1|273868_274096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598732.1|274092_274401_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_102889860.1|274488_275293_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.4	1.3e-21
WP_052712458.1|275371_276886_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_045598690.1|278229_279456_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_082255998.1|279461_279677_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_045599009.1|280117_280591_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045598698.1|280566_280917_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	1.1e-17
WP_155722043.1|280948_281119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060970100.1|281189_281438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598909.1|281772_282276_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_045598911.1|282399_284097_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_045598915.1|284281_285967_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.0	4.8e-37
WP_045598918.1|285993_286416_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_045598921.1|286433_286709_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_045598923.1|286723_287074_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_045598924.1|287142_287550_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_082255999.1|288744_289029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045599010.1|289132_289606_-	DoxX family protein	NA	NA	NA	NA	NA
WP_102889797.1|289702_290459_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_045598928.1|290437_291232_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_045598929.1|291215_292109_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_045598930.1|292124_292445_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_052712460.1|292557_293214_-	DUF1109 domain-containing protein	NA	NA	NA	NA	NA
WP_045598931.1|293215_293785_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_045599015.1|294174_294630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045598932.1|294733_295450_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_045598933.1|295547_296210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045598935.1|296271_296853_-	alkylhydroperoxidase	NA	NA	NA	NA	NA
WP_082256013.1|296943_297516_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045599019.1|297613_298306_-	haloacid dehalogenase type II	NA	NA	NA	NA	NA
WP_045598936.1|298573_298825_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_045598937.1|298832_299735_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_045598939.1|299718_300495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045598941.1|300520_300988_+	DoxX family protein	NA	NA	NA	NA	NA
WP_082256000.1|300989_303203_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.2e-37
301833:301848	attR	GTCGCGCTCGTCGAGC	NA	NA	NA	NA
WP_045598942.1|303250_303481_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_127447003.1|303556_303916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045598944.1|303916_305008_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_045598945.1|305004_305661_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_082256001.1|305669_306461_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_045598946.1|306478_307360_-	S-methyl-5'-thioadenosine phosphorylase	NA	NA	NA	NA	NA
WP_082256002.1|307356_308067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102889801.1|308583_309400_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.4	2.3e-21
