The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009707	Burkholderia mallei strain 2002734306 chromosome I, complete sequence	3550623	348102	399204	3550623	protease,transposase	Streptococcus_phage(21.43%)	46	NA	NA
WP_004187628.1|348102_349323_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_004194773.1|349404_349773_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_004185759.1|349813_350173_-	cytochrome c	NA	NA	NA	NA	NA
WP_004186676.1|350406_351249_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_004186167.1|351461_352637_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004186095.1|352720_353938_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_004186409.1|354339_355293_+	transaldolase	NA	A0A0E3F5V4	Synechococcus_phage	29.6	4.3e-11
WP_004522474.1|355658_356093_+	VOC family protein	NA	NA	NA	NA	NA
WP_024900823.1|356218_357787_-	sodium:solute symporter	NA	NA	NA	NA	NA
WP_004194775.1|357783_358023_-	DUF3311 domain-containing protein	NA	NA	NA	NA	NA
WP_004185796.1|359394_359871_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_004194778.1|359870_360473_-	chorismate lyase	NA	NA	NA	NA	NA
WP_004185742.1|360472_362371_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.5	3.0e-120
WP_004185957.1|362506_363961_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004186239.1|364111_364795_+	VOC family protein	NA	NA	NA	NA	NA
WP_004186089.1|364895_365804_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004194779.1|365864_367046_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_123809469.1|367114_368234_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	5.2e-48
WP_071810810.1|368368_368587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|368784_369294_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|369594_371709_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
WP_045598180.1|372881_374330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004186341.1|374874_375720_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	29.9	3.4e-23
WP_004185897.1|375888_376635_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004534266.1|377350_378703_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004522619.1|378675_379011_-	DUF2917 domain-containing protein	NA	NA	NA	NA	NA
WP_004185818.1|379307_380747_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_162473466.1|381062_381350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200476.1|381333_382608_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004185918.1|382739_383345_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004186428.1|383868_384891_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_004185585.1|384906_385434_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_004185910.1|385518_386274_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_045598012.1|386507_387713_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_038802950.1|387801_388922_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004191998.1|389180_390644_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004185841.1|390804_391383_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.7	1.1e-44
WP_004197496.1|391579_392962_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	27.5	6.1e-30
WP_004200482.1|392956_393187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555967.1|393419_394448_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004196455.1|394428_394635_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_004185994.1|394808_395600_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004185840.1|395808_396471_+	adenylate kinase	NA	NA	NA	NA	NA
WP_004191998.1|396586_398050_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004196460.1|398153_398357_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004194131.1|398889_399204_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
>prophage 2
NZ_CP009707	Burkholderia mallei strain 2002734306 chromosome I, complete sequence	3550623	726544	786238	3550623	tRNA,protease,portal,transposase	Burkholderia_phage(13.33%)	47	NA	NA
WP_004189409.1|726544_727402_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004189288.1|727511_728147_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004200737.1|728267_729251_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004201745.1|729282_729786_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.7e-12
WP_004190020.1|730014_731205_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|731264_731636_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004200734.1|731846_734456_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|734677_735733_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188904.1|736182_737199_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189208.1|737319_738189_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|738226_738631_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004187628.1|739021_740242_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_009918009.1|740704_740959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123809469.1|741228_742348_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	5.2e-48
WP_004200731.1|742400_742883_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004188977.1|742879_743164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200730.1|743236_744328_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	92.3	2.0e-193
WP_004200729.1|744726_745137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189258.1|745273_746149_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_004190014.1|746159_747272_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_004201742.1|747300_748395_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004189434.1|748537_749506_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189874.1|749608_750178_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004189689.1|750770_751319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189592.1|751582_753031_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_004200727.1|753049_754663_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004200726.1|754822_755764_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004190110.1|755760_756855_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004197761.1|757256_757673_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004197759.1|757850_758405_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_004524604.1|758620_758968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524603.1|759453_760014_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_004524586.1|761434_762838_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_004198812.1|763175_763595_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004198813.1|763751_765428_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_004198815.1|765436_765706_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	53.6	2.1e-16
WP_038799830.1|765785_766253_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004198824.1|766269_766404_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_076805040.1|766696_768451_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004196275.1|768613_769717_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.0	1.7e-46
WP_004196276.1|769905_772374_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.4	9.3e-114
WP_004185300.1|772899_773163_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024900530.1|774066_774381_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_045598034.1|774650_780170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526088.1|780747_784014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526091.1|784608_784935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187628.1|785017_786238_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
>prophage 3
NZ_CP009707	Burkholderia mallei strain 2002734306 chromosome I, complete sequence	3550623	1500255	1507714	3550623	terminase,plate,protease,portal,transposase	Burkholderia_phage(33.33%)	8	NA	NA
WP_004199890.1|1500255_1500777_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_004199888.1|1500998_1501496_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	100.0	2.6e-55
WP_004199886.1|1501492_1502548_+|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	99.4	5.7e-206
WP_004202809.1|1502591_1502948_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_004199884.1|1502950_1503247_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	98.0	2.8e-49
WP_123809469.1|1504054_1505174_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	5.2e-48
WP_004204912.1|1505313_1505796_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004202808.1|1505875_1507714_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 4
NZ_CP009707	Burkholderia mallei strain 2002734306 chromosome I, complete sequence	3550623	1875324	1884561	3550623		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|1875324_1877277_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004194374.1|1877543_1878674_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194350.1|1878707_1880714_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_004194137.1|1880889_1881705_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004194274.1|1881769_1882453_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194373.1|1882449_1882977_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_024900817.1|1883013_1884561_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 5
NZ_CP009707	Burkholderia mallei strain 2002734306 chromosome I, complete sequence	3550623	2208380	2217228	3550623		Bacillus_phage(16.67%)	8	NA	NA
WP_004189214.1|2208380_2209781_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
WP_004200795.1|2209749_2210736_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.5	8.8e-15
WP_004190173.1|2210794_2211787_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|2211858_2212176_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004532363.1|2212499_2213402_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_045598116.1|2213627_2214941_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004188957.1|2215119_2216043_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_004190087.1|2216385_2217228_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
>prophage 6
NZ_CP009707	Burkholderia mallei strain 2002734306 chromosome I, complete sequence	3550623	2452166	2519667	3550623	tRNA,protease,coat,transposase	Leptospira_phage(16.67%)	57	NA	NA
WP_011203868.1|2452166_2454344_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.7	1.2e-51
WP_004192130.1|2454826_2455474_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004193796.1|2455855_2456944_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_004191507.1|2457076_2457616_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_004192666.1|2457719_2458289_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.6	1.3e-71
WP_024900677.1|2458391_2460671_+	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_004205947.1|2460673_2461396_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_004193337.1|2461529_2462204_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_004191886.1|2462236_2463646_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_004543968.1|2463814_2466115_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004191842.1|2466818_2467529_-	molecular chaperone	NA	NA	NA	NA	NA
WP_045598130.1|2467536_2468055_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004193822.1|2468428_2469439_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004192784.1|2469611_2470427_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004522539.1|2470609_2471365_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_041283509.1|2471782_2473246_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	6.8e-80
WP_004191560.1|2473391_2476376_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_004199404.1|2476488_2476668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193185.1|2476702_2477692_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_004193146.1|2477691_2479671_+	fused uroporphyrinogen-III synthase HemD/membrane protein HemX	NA	NA	NA	NA	NA
WP_004193604.1|2479675_2480866_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_004192161.1|2481046_2482354_-	MFS transporter	NA	NA	NA	NA	NA
WP_004192728.1|2482392_2483151_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004193515.1|2483239_2484679_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004192356.1|2484839_2485367_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.8	9.0e-51
WP_045598133.1|2485425_2486295_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	43.1	2.0e-07
WP_011807749.1|2486273_2486663_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024900822.1|2487294_2488473_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004198600.1|2488593_2490294_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.8	5.8e-91
WP_004193987.1|2490354_2490693_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_004191758.1|2491149_2492238_-	porin	NA	NA	NA	NA	NA
WP_004553879.1|2493132_2493912_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	3.9e-26
WP_004193161.1|2493934_2494648_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004522525.1|2494644_2495334_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004198602.1|2495544_2496321_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004192043.1|2497748_2498294_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_024900821.1|2498535_2499234_+	response regulator	NA	W8CYM9	Bacillus_phage	36.2	6.4e-28
WP_004193003.1|2499217_2500531_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004198606.1|2500604_2500871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192556.1|2501367_2503125_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004192968.1|2503178_2504519_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.2e-32
WP_123809469.1|2504983_2506104_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	5.2e-48
WP_045598140.1|2506003_2506534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200093.1|2506822_2507020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192381.1|2507154_2508573_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_004191763.1|2508565_2509168_+	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	62.8	2.6e-25
WP_004191641.1|2509340_2509952_-	membrane protein	NA	NA	NA	NA	NA
WP_045598142.1|2510691_2512065_-	MFS transporter	NA	NA	NA	NA	NA
WP_004266384.1|2512188_2512701_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_004192184.1|2513275_2513656_-	DUF5594 family protein	NA	NA	NA	NA	NA
WP_004193391.1|2513813_2514083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192840.1|2514689_2515070_-	lipoprotein	NA	NA	NA	NA	NA
WP_004522511.1|2515242_2515782_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004193210.1|2515879_2517016_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_004200110.1|2517280_2517505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045598144.1|2517961_2518438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144408684.1|2518547_2519667_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	2.6e-47
>prophage 7
NZ_CP009707	Burkholderia mallei strain 2002734306 chromosome I, complete sequence	3550623	3469101	3546634	3550623	tRNA,coat,transposase	Klosneuvirus(20.0%)	59	NA	NA
WP_004191922.1|3469101_3471969_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	2.8e-146
WP_004192544.1|3472055_3472937_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.9	1.9e-69
WP_004526815.1|3472997_3473615_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_004191850.1|3473703_3476097_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_004192128.1|3476107_3477472_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004193573.1|3477468_3478173_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192096.1|3478500_3478887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193727.1|3479162_3479393_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_004192573.1|3479557_3480595_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004193713.1|3480607_3481627_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_004191536.1|3481619_3482501_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004192875.1|3482745_3483795_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004192697.1|3483895_3485041_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024900516.1|3485053_3485854_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	3.9e-13
WP_004191266.1|3485867_3487868_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_004196072.1|3487878_3489864_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_004192432.1|3489860_3490781_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_004196071.1|3490780_3491584_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_004193939.1|3491700_3492405_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_045596944.1|3492401_3494687_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FFL6	Cedratvirus	26.2	2.4e-07
WP_004191272.1|3494679_3495615_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004193685.1|3495619_3496069_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004196068.1|3495969_3496314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024900518.1|3496310_3497459_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004193399.1|3497674_3498010_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_004193543.1|3498109_3498661_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004196065.1|3498952_3499630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123809469.1|3502335_3503456_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	5.2e-48
WP_011807697.1|3503486_3504203_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_004192193.1|3504349_3505315_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024900630.1|3505835_3508460_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	5.5e-80
WP_004204969.1|3509136_3510357_+	CoA transferase	NA	NA	NA	NA	NA
WP_004534928.1|3510680_3510890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193654.1|3511169_3512879_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.5	8.8e-188
WP_004192426.1|3513210_3513693_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	3.7e-19
WP_004193860.1|3513711_3514098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196725.1|3516399_3516579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192265.1|3516575_3517436_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_004191662.1|3517479_3518895_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_004193177.1|3519128_3520712_+	acid phosphatase	NA	NA	NA	NA	NA
WP_024900629.1|3520909_3522103_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_024900628.1|3522721_3523909_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004192651.1|3524081_3525701_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004192810.1|3527690_3528323_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004552891.1|3528323_3530405_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.8	1.7e-12
WP_004196717.1|3530815_3531781_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526784.1|3534253_3535093_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004526783.1|3535110_3535635_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|3535711_3536272_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_024900625.1|3536324_3536870_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004542449.1|3536856_3537042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531175.1|3537127_3537349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196705.1|3537686_3538580_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004538381.1|3538996_3540283_+	MFS transporter	NA	NA	NA	NA	NA
WP_004192394.1|3540327_3541320_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004193855.1|3541787_3542069_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004191144.1|3542321_3542591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024900624.1|3543485_3544799_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_038802950.1|3545513_3546634_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 1
NZ_CP009708	Burkholderia mallei strain 2002734306 chromosome II, complete sequence	1858539	324302	398419	1858539	plate,transposase	Moumouvirus(20.0%)	53	NA	NA
WP_004187303.1|324302_325388_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004187986.1|325387_327277_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004187068.1|327307_327889_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004187921.1|327875_328841_-	ImpE/SciE family protein	NA	NA	NA	NA	NA
WP_004188539.1|328837_329584_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_024900492.1|333048_333624_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004188012.1|333658_335158_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004188308.1|335274_335760_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004187276.1|335866_336370_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004188743.1|336391_337738_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004188530.1|337826_339092_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004188288.1|343215_343446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038799466.1|344031_345378_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187006.1|345620_346547_-	catecholic dioxygenase	NA	NA	NA	NA	NA
WP_004187502.1|346601_347573_-	quinone oxidoreductase	NA	A0A2P1ELD9	Moumouvirus	25.2	6.6e-07
WP_024900490.1|347601_349470_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SHV8	Klosneuvirus	22.9	4.2e-18
WP_004187705.1|349515_351000_-	Pyoverdin chromophore biosynthetic protein pvcC	NA	NA	NA	NA	NA
WP_004188574.1|351025_351925_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_004554725.1|351921_352980_-	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_157047211.1|352978_353356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024900489.1|353581_356542_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_004196252.1|356753_358670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014919714.1|359111_359477_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004202300.1|359616_359901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188660.1|359920_360661_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004188170.1|361205_362138_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196258.1|362290_363538_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004554722.1|363701_364601_+	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004196262.1|365206_365647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188358.1|365795_366092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201242.1|366148_367189_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004188790.1|367482_368319_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004187366.1|368660_369563_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187422.1|369742_370933_+	amidohydrolase	NA	NA	NA	NA	NA
WP_024900487.1|372320_372950_+	porin	NA	NA	NA	NA	NA
WP_004203996.1|373143_374541_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.4	4.1e-50
WP_038802950.1|375632_376753_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_162473622.1|376818_377622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188578.1|379008_379758_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188783.1|380001_380907_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_004187664.1|381222_382302_+	porin	NA	NA	NA	NA	NA
WP_004187771.1|382343_383822_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_004188039.1|383899_385027_-	OpgC domain-containing protein	NA	NA	NA	NA	NA
WP_004188619.1|385426_386320_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_004187760.1|386316_386613_-	acylphosphatase	NA	NA	NA	NA	NA
WP_004202312.1|386773_387781_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004188344.1|388035_389490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188250.1|389715_390900_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004187484.1|391293_392235_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_004187762.1|392247_393408_+	adenosyl-hopene transferase HpnH	NA	NA	NA	NA	NA
WP_004187860.1|393752_394106_+	DOPA 4,5-dioxygenase family protein	NA	NA	NA	NA	NA
WP_004200694.1|394654_396013_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_004191998.1|396955_398419_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
>prophage 2
NZ_CP009708	Burkholderia mallei strain 2002734306 chromosome II, complete sequence	1858539	738482	803222	1858539	plate,transposase	Leptospira_phage(18.18%)	51	NA	NA
WP_123809469.1|738482_739603_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	5.2e-48
WP_004190252.1|739819_740560_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004537687.1|740632_741307_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_004536572.1|741766_742072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190962.1|742287_743229_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190523.1|744799_745714_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190791.1|745895_746600_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004205458.1|747286_747604_-	chorismate lyase	NA	NA	NA	NA	NA
WP_073699052.1|747540_747786_-	chorismate lyase	NA	NA	NA	NA	NA
WP_038796415.1|747913_749149_-	flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004190842.1|749422_749608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203280.1|749626_751525_+	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_024900788.1|751567_753004_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004190377.1|753058_753460_-	TssQ family T6SS-associated lipoprotein	NA	NA	NA	NA	NA
WP_004190712.1|754099_754618_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004190585.1|754614_756018_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190689.1|756033_757350_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004190681.1|757352_760982_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190273.1|761888_762116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190797.1|762114_764712_+	protein kinase	NA	A7IVH4	Paramecium_bursaria_Chlorella_virus	25.1	1.0e-14
WP_004190988.1|764764_765844_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004190671.1|765906_766485_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190849.1|766477_767986_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|768045_768537_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004196148.1|768555_769116_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004190509.1|769120_770992_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024900789.1|770988_772479_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004203276.1|772457_775112_+	type VI secretion system ATPase TssH	NA	A0A1S6UBG5	Serratia_phage	30.9	2.7e-79
WP_004203275.1|775108_777313_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004196151.1|777387_778041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162473620.1|777970_779047_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_011204340.1|780853_781834_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004190776.1|782350_783775_+	cytosine permease	NA	NA	NA	NA	NA
WP_004190245.1|783771_784710_+	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	25.3	1.4e-14
WP_004190461.1|784672_785350_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_004190588.1|785664_785808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190614.1|785796_787212_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	30.2	2.1e-41
WP_011204342.1|787410_787743_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004190911.1|788187_788499_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011204344.1|788777_789542_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	38.7	4.7e-08
WP_004190805.1|789672_790308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190603.1|790576_791113_+	cytochrome b	NA	NA	NA	NA	NA
WP_004190837.1|791273_791669_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004190808.1|791756_793994_+	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_004553588.1|794317_795412_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004190433.1|795415_796450_+	lipase secretion chaperone	NA	NA	NA	NA	NA
WP_004200631.1|796551_798081_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.9	2.2e-12
WP_004190757.1|798189_799290_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	51.0	6.3e-22
WP_004190781.1|799364_800411_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004196172.1|800511_801771_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	22.6	2.1e-05
WP_038802950.1|802101_803222_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 3
NZ_CP009708	Burkholderia mallei strain 2002734306 chromosome II, complete sequence	1858539	1576572	1661821	1858539	protease,transposase,integrase	Leptospira_phage(38.46%)	55	1625607:1625666	1660595:1661147
WP_123809469.1|1576572_1577692_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	5.2e-48
WP_024900511.1|1577895_1582707_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004551771.1|1583231_1583750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184606.1|1584079_1584598_-	membrane protein	NA	NA	NA	NA	NA
WP_004184536.1|1585443_1587165_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_004201091.1|1587361_1588678_-	TolC family protein	NA	NA	NA	NA	NA
WP_004184640.1|1589490_1589676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184575.1|1589812_1591936_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	24.9	2.5e-27
WP_004184588.1|1591932_1592955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528592.1|1592967_1594263_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004202541.1|1594276_1595773_+	OmpW family protein	NA	NA	NA	NA	NA
WP_004524222.1|1596173_1597100_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_004537006.1|1597186_1597444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080747472.1|1597854_1599462_+	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_004184552.1|1599440_1600157_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004184355.1|1600235_1601534_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076841794.1|1601709_1602153_+	metal transporter	NA	NA	NA	NA	NA
WP_004528582.1|1602256_1603327_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004536930.1|1603462_1604053_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.4	5.8e-22
WP_160447106.1|1604073_1604382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184214.1|1604829_1605354_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004197859.1|1605383_1605614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197860.1|1606021_1607782_+	fatty acyl-AMP ligase	NA	A0A2K9KZV5	Tupanvirus	21.9	4.6e-06
WP_004184602.1|1607778_1609539_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004184547.1|1609535_1611329_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004184201.1|1611339_1611630_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_024900541.1|1612089_1612893_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_038802950.1|1624990_1626110_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
1625607:1625666	attL	ATGGTCAATCGATTTCGTGATGGATGCGCTTTCCAACGGCCGGCGCGTGAAGTGCCTGAC	NA	NA	NA	NA
WP_004197866.1|1626499_1626772_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004184766.1|1626920_1628315_-	heavy metal sensor histidine kinase IrlS	NA	W8CYF6	Bacillus_phage	28.9	1.2e-20
WP_004197868.1|1628311_1629001_-	heavy metal response regulator transcription factor IrlR	NA	W8CYM9	Bacillus_phage	36.8	1.7e-36
WP_024900560.1|1629007_1632241_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	24.1	5.2e-72
WP_004197872.1|1632286_1633756_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004197873.1|1633766_1635152_-	TolC family protein	NA	NA	NA	NA	NA
WP_004197875.1|1635387_1635672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004524134.1|1636069_1636210_-	bacteriophage protein	NA	NA	NA	NA	NA
WP_038709382.1|1636880_1637366_-	membrane protein	NA	NA	NA	NA	NA
WP_004197880.1|1637695_1638181_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_024900559.1|1638448_1639939_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_004197883.1|1640238_1640847_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004199606.1|1640978_1642979_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	46.2	1.1e-104
WP_004537230.1|1643032_1643545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011204480.1|1644359_1646126_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004199157.1|1646256_1646928_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004184876.1|1647078_1648176_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004199160.1|1648172_1651274_+	MMPL family transporter	NA	S5VTK5	Leptospira_phage	22.0	3.6e-46
WP_045598381.1|1651408_1652947_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004202576.1|1652961_1653258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199609.1|1653303_1653921_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	44.6	6.9e-34
WP_004197695.1|1653917_1655615_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004197696.1|1655611_1656292_+	1,6-didemethyltoxoflavin N1-methyltransferase	NA	NA	NA	NA	NA
WP_024900397.1|1656365_1658057_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	24.7	1.5e-06
WP_004197698.1|1658153_1658600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199610.1|1658970_1660128_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_038802950.1|1660700_1661821_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
1660595:1661147	attR	GTCAGGCACTTCACGCGCCGGCCGTTGGAAAGCGCATCCATCACGAAATCGATTGACCATGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCCTGGAAAGCGGCAGGAGCGTCCGCGGTTGCCCGATGTTTCGCCGCAAACTCTGACGGCGCAAGGTAGTTCAGTGCGCTGTGCGGCCTTTGCTCGTTGTAGTCCTGACGCCATGCCGCGATGACTGCCCGAGCGTGCGCGAGCGTCGTGAACCAGTGCTCGTTAAGGCATTCGTCGCGGAACTTGCCGTTGAACGATTCGATGTACGCATTCTGCGTGGGCTTGCCCGCCTGAATCAACTTCAGCGTGACGCCGTTCGCATACGCCCACTGGTCAAGCGCGCGGCTCGTAAATTCGGGTCCCTGGTCTGTTCGCACCGCCTTGGGATAGCCACGGAAGCGAGCTGCACGGTCCAATGCCCGAGCGACATACAAACCTGAGATGCCATGGTCGACGACGATGTCGACAGCCTCTTTCGTGAAATCGTCGACGACGGT	NA	NA	NA	NA
