The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009642	Burkholderia mallei strain India86-567-2 chromosome I, complete sequence	3560434	74340	83577	3560434		unidentified_phage(16.67%)	7	NA	NA
WP_004194112.1|74340_75888_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_004194373.1|75924_76452_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004194274.1|76448_77132_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194137.1|77196_78012_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004194350.1|78187_80194_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_004194374.1|80227_81358_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194034.1|81624_83577_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
>prophage 2
NZ_CP009642	Burkholderia mallei strain India86-567-2 chromosome I, complete sequence	3560434	472248	527094	3560434	plate,tRNA,protease,transposase	uncultured_Mediterranean_phage(21.43%)	48	NA	NA
WP_045588992.1|472248_473712_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.1	1.3e-78
WP_004195278.1|473836_474772_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	36.4	1.6e-37
WP_011204221.1|475136_475706_+	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	27.4	2.4e-09
WP_004200162.1|475747_476134_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004195273.1|476460_478101_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_004522869.1|477994_478258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004195272.1|478536_479358_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004195270.1|479998_480979_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_045588993.1|480975_483825_-	nitrate reductase	NA	NA	NA	NA	NA
WP_011204219.1|483821_484217_-	nitrite reductase (NAD(P)H) small subunit	NA	NA	NA	NA	NA
WP_004195264.1|484285_486730_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004195258.1|487114_487759_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_004195253.1|487915_489235_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_004195251.1|489486_490113_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_004195249.1|490223_490724_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.7	2.9e-30
WP_004195247.1|490786_491053_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	56.3	1.4e-20
WP_011204217.1|491231_492302_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_004185241.1|492390_492996_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_004200150.1|493109_493724_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_004195243.1|493887_494844_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	35.5	5.3e-41
WP_004195241.1|495021_495903_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_011807613.1|495936_496572_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004195237.1|496568_498389_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004195234.1|498477_499296_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	NA	NA	NA	NA
WP_004195232.1|499300_500407_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_004195230.1|500794_501427_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_004195227.1|501453_502347_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	4.4e-05
WP_004195225.1|502432_503401_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_004534308.1|503529_504039_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004195219.1|504271_504631_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004195216.1|504780_506289_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004195214.1|506457_507234_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	1.2e-22
WP_004195213.1|507230_507896_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_004195210.1|507914_508529_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004200146.1|508534_509074_-	HAD family hydrolase	NA	E3T535	Cafeteria_roenbergensis_virus	28.0	8.4e-12
WP_004195206.1|509073_510057_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.5	9.9e-43
WP_004195204.1|510184_512194_+	potassium efflux system protein	NA	NA	NA	NA	NA
WP_004195200.1|512933_513518_+	LysE family translocator	NA	NA	NA	NA	NA
WP_004195199.1|513530_514388_+	DUF4743 domain-containing protein	NA	NA	NA	NA	NA
WP_004195197.1|514439_515321_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	35.7	4.3e-13
WP_004195195.1|515616_516702_-	membrane protein	NA	NA	NA	NA	NA
WP_004195192.1|516920_519788_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.0	3.9e-305
WP_004195190.1|520001_521189_+	MFS transporter	NA	NA	NA	NA	NA
WP_004204730.1|521302_521893_+	single-stranded DNA-binding protein	NA	C5IHK5	Burkholderia_virus	87.7	2.7e-48
WP_038802950.1|522370_523490_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004204912.1|523629_524112_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004202808.1|524191_526030_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004204910.1|525993_527094_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NZ_CP009642	Burkholderia mallei strain India86-567-2 chromosome I, complete sequence	3560434	764619	829373	3560434	terminase,protease,integrase,transposase	Bacillus_phage(13.33%)	55	763777:763795	823108:823126
763777:763795	attL	CGCGCTCGCGATCGGCGTG	NA	NA	NA	NA
WP_004191998.1|764619_766083_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004195859.1|766137_767478_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_004195860.1|767474_768278_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_004195862.1|768343_768589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004556617.1|768857_770378_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004195866.1|770450_770630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004195868.1|770673_771702_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004185233.1|771820_772888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004195870.1|772916_774620_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_004195872.1|774892_776029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004195873.1|776063_777452_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_004195875.1|777485_778604_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_004185207.1|778639_778765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004195877.1|778755_781683_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.2	2.8e-258
WP_004195879.1|781987_782368_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_004202927.1|782461_783580_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_004195883.1|784323_784683_-	lipoprotein	NA	NA	NA	NA	NA
WP_004185221.1|784854_785907_-	oxidoreductase	NA	NA	NA	NA	NA
WP_004204377.1|786420_787155_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_004195887.1|787220_788015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004195888.1|788312_790415_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	34.8	1.1e-94
WP_004202928.1|790735_791635_-	cytochrome c	NA	NA	NA	NA	NA
WP_004200089.1|792052_793162_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	79.9	6.5e-168
WP_038802950.1|793252_794372_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198375.1|794652_795789_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_004198376.1|795785_796127_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004198377.1|796854_798504_+	GMC family oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	30.9	2.0e-56
WP_004198379.1|798588_799386_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	28.8	3.3e-12
WP_004198380.1|799431_800241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198382.1|800251_800644_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004198383.1|800699_802205_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004197126.1|802421_803681_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004197127.1|803685_804564_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004205008.1|804560_805610_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004197129.1|805606_806329_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	3.8e-07
WP_004538585.1|806701_807433_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.3	1.6e-05
WP_004199873.1|807555_808515_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004197133.1|808914_810015_-	porin	NA	NA	NA	NA	NA
WP_004197137.1|810552_813582_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	38.7	2.2e-181
WP_004197139.1|813622_815638_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.5	3.3e-85
WP_004197141.1|815892_816075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197145.1|816110_817271_-	porin	NA	NA	NA	NA	NA
WP_004197150.1|817560_818238_-	response regulator	NA	NA	NA	NA	NA
WP_004197153.1|818248_819628_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004201276.1|819705_820554_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004199877.1|820581_821379_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	3.5e-30
WP_004199878.1|821462_822476_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004199879.1|822633_823155_-	DUF2938 domain-containing protein	NA	NA	NA	NA	NA
823108:823126	attR	CACGCCGATCGCGAGCGCG	NA	NA	NA	NA
WP_004199880.1|823147_824023_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004199881.1|824104_824533_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004201278.1|824852_825635_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_004199882.1|825753_826026_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_038802950.1|826650_827771_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004199888.1|828132_828630_-|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	100.0	2.6e-55
WP_004199890.1|828851_829373_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
>prophage 4
NZ_CP009642	Burkholderia mallei strain India86-567-2 chromosome I, complete sequence	3560434	2092326	2166871	3560434	tRNA,transposase	Leptospira_phage(25.0%)	58	NA	NA
WP_004191232.1|2092326_2094234_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.5	1.7e-123
WP_071810680.1|2094283_2094808_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	28.7	4.1e-11
WP_004191477.1|2095000_2095198_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004192938.1|2095228_2095588_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004191909.1|2095736_2096750_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	7.8e-27
WP_004193113.1|2096837_2099270_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004197408.1|2099342_2099747_+	integration host factor subunit alpha	NA	A0A1P8CWT5	Bacillus_phage	41.1	2.8e-12
WP_004526841.1|2099805_2100210_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004205970.1|2100331_2102296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2102408_2103528_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004192528.1|2104316_2105519_-	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
WP_004205966.1|2105529_2106021_-	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_004205956.1|2106370_2107576_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_038802950.1|2108374_2109495_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004193694.1|2109916_2110207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191628.1|2110256_2110514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192834.1|2110662_2110941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192638.1|2111179_2111902_-	YdcF family protein	NA	NA	NA	NA	NA
WP_004199444.1|2112102_2112420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521676.1|2112578_2112836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199443.1|2113041_2113443_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004193481.1|2113861_2114764_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	4.5e-10
WP_004192767.1|2115182_2116511_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	5.3e-23
WP_004191876.1|2116574_2118239_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004193908.1|2118543_2119005_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004193517.1|2119001_2120477_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004197388.1|2120568_2123496_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	5.2e-23
WP_004199441.1|2123601_2123970_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_011203915.1|2123996_2124932_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004193982.1|2125202_2126762_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004192058.1|2126784_2128020_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004191557.1|2128087_2129584_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192835.1|2129683_2130181_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191941.1|2130380_2130521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193111.1|2130473_2132300_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_004191889.1|2132638_2135503_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_004192735.1|2135630_2136905_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_004191219.1|2137004_2138435_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-42
WP_004550551.1|2138541_2139639_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004191720.1|2139833_2140244_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004193599.1|2140480_2140942_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011203914.1|2141185_2142865_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004192734.1|2143015_2144281_-	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004191362.1|2144330_2145884_-	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004521662.1|2145783_2146098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2146410_2147530_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004192661.1|2148897_2151270_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_162473478.1|2151438_2151687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191146.1|2152714_2152861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193126.1|2152860_2153526_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004552809.1|2153823_2154207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073699454.1|2154765_2154948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204696.1|2155664_2158451_-	membrane protein	NA	NA	NA	NA	NA
WP_044302806.1|2158594_2158792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193791.1|2159622_2160594_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004193303.1|2160584_2163086_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004191349.1|2163143_2163914_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004187628.1|2165650_2166871_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
>prophage 5
NZ_CP009642	Burkholderia mallei strain India86-567-2 chromosome I, complete sequence	3560434	2257189	2334713	3560434	coat,tRNA,transposase	Klosneuvirus(20.0%)	60	NA	NA
WP_004191922.1|2257189_2260057_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	2.8e-146
WP_004192544.1|2260143_2261025_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.9	1.9e-69
WP_004526815.1|2261085_2261703_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_004191850.1|2261791_2264185_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_004192128.1|2264195_2265560_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004193573.1|2265556_2266261_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192096.1|2266588_2266975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193727.1|2267250_2267481_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_004192573.1|2267645_2268683_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004193713.1|2268695_2269715_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_004191536.1|2269707_2270589_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004192875.1|2270833_2271883_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004192697.1|2271983_2273129_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004193469.1|2273141_2273942_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	1.3e-13
WP_004191266.1|2273955_2275956_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_004196072.1|2275966_2277952_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_004192432.1|2277948_2278869_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_004196071.1|2278868_2279672_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_004193939.1|2279788_2280493_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_045589034.1|2280489_2282793_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FFL6	Cedratvirus	26.2	2.4e-07
WP_004204954.1|2282785_2283712_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004193685.1|2283716_2284166_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004196068.1|2284066_2284411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192588.1|2284407_2285556_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004193399.1|2285771_2286107_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_004193543.1|2286206_2286758_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004196065.1|2287049_2287727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2290432_2291553_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_011807697.1|2291583_2292300_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_038796370.1|2292446_2293400_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004204967.1|2293903_2296528_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	5.5e-80
WP_080939634.1|2296845_2297085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204969.1|2297186_2298407_+	CoA transferase	NA	NA	NA	NA	NA
WP_004534928.1|2298730_2298940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193654.1|2299217_2300927_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.5	8.8e-188
WP_004192426.1|2301258_2301741_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	3.7e-19
WP_004193860.1|2301759_2302146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196725.1|2304447_2304627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192265.1|2304623_2305484_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_004191662.1|2305527_2306943_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_004193177.1|2307176_2308760_+	acid phosphatase	NA	NA	NA	NA	NA
WP_004192836.1|2308957_2310151_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_004191546.1|2310769_2311957_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004192651.1|2312129_2313749_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004192810.1|2315738_2316371_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004552891.1|2316371_2318453_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.8	1.7e-12
WP_004196717.1|2318863_2319829_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191504.1|2322301_2323141_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004526783.1|2323158_2323683_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|2323759_2324320_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004192149.1|2324372_2324918_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004542449.1|2324904_2325090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531175.1|2325175_2325397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196705.1|2325734_2326628_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196700.1|2327134_2328331_+	MFS transporter	NA	NA	NA	NA	NA
WP_004192394.1|2328375_2329368_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004193855.1|2329835_2330117_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004191144.1|2330369_2330639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193170.1|2331533_2332847_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_038802950.1|2333593_2334713_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 6
NZ_CP009642	Burkholderia mallei strain India86-567-2 chromosome I, complete sequence	3560434	2886552	2970510	3560434	transposase	Streptococcus_phage(33.33%)	58	NA	NA
WP_004191998.1|2886552_2888016_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004199567.1|2888124_2888694_-	phasin family protein	NA	NA	NA	NA	NA
WP_004557110.1|2889363_2890485_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_004191998.1|2890604_2892068_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192702.1|2892324_2894094_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	6.8e-34
WP_080939637.1|2894401_2895652_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_004199569.1|2895784_2898481_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_004192045.1|2898612_2898834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004557112.1|2898753_2901264_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_004193928.1|2901260_2901899_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192825.1|2902215_2903073_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.9	4.1e-37
WP_004199570.1|2903029_2903245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191126.1|2903774_2905874_+	M3 family metallopeptidase	NA	A0A1V0SD92	Indivirus	21.8	1.7e-39
WP_004191702.1|2906103_2907306_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_004192547.1|2907258_2907543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193983.1|2908035_2909316_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_004192248.1|2909359_2910745_+	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_004193149.1|2910995_2914721_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_004193619.1|2914717_2916271_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.5	2.9e-20
WP_004192818.1|2916267_2916972_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_004191967.1|2917008_2917695_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_004193869.1|2917836_2919759_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004192421.1|2919794_2920496_+	response regulator	NA	NA	NA	NA	NA
WP_004193531.1|2920642_2921419_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_004191998.1|2921701_2923165_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192209.1|2923297_2924833_-	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_004192981.1|2924870_2926013_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004191998.1|2926137_2927601_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004192601.1|2927772_2929188_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_004191860.1|2929592_2930057_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004192990.1|2930309_2931128_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_004193555.1|2931124_2931958_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_004192998.1|2932501_2933491_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_004192001.1|2933507_2934500_-	beta-propeller fold lactonase family protein	NA	A0A2H4JCI3	uncultured_Caudovirales_phage	59.6	3.5e-11
WP_004202033.1|2934601_2938729_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.5	4.3e-47
WP_004192168.1|2938752_2940129_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_004193961.1|2940181_2940457_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_004192533.1|2940629_2941961_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_038796647.1|2942169_2943705_-	CoA transferase	NA	NA	NA	NA	NA
WP_004206369.1|2943701_2945495_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004193679.1|2945603_2946506_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038802950.1|2948343_2949464_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004191758.1|2950017_2951106_+	porin	NA	NA	NA	NA	NA
WP_004193987.1|2951574_2951913_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_004198600.1|2951973_2953674_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.8	5.8e-91
WP_004192390.1|2953794_2954973_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011807749.1|2955593_2955983_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038796551.1|2955961_2956867_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	43.1	2.1e-07
WP_004192356.1|2956925_2957453_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.8	9.0e-51
WP_004193515.1|2957613_2959053_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004192728.1|2959141_2959900_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004192161.1|2959938_2961246_+	MFS transporter	NA	NA	NA	NA	NA
WP_004193604.1|2961426_2962617_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_004193146.1|2962621_2964601_-	fused uroporphyrinogen-III synthase HemD/membrane protein HemX	NA	NA	NA	NA	NA
WP_004193185.1|2964600_2965590_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_004199404.1|2965624_2965804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191560.1|2965916_2968901_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_011203959.1|2969046_2970510_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.6e-79
>prophage 7
NZ_CP009642	Burkholderia mallei strain India86-567-2 chromosome I, complete sequence	3560434	3200974	3265192	3560434	tRNA,protease,transposase	Streptococcus_phage(27.78%)	57	NA	NA
WP_004191998.1|3200974_3202438_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189921.1|3202548_3203520_-	thymidylate synthase	NA	A0A1V0DY05	Yersinia_phage	36.1	2.9e-47
WP_004189039.1|3203576_3204962_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004195958.1|3204923_3205220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189413.1|3205460_3205697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189886.1|3206009_3206195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011807762.1|3206191_3207127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162486048.1|3207367_3209209_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_004189313.1|3209416_3209920_+	dihydrofolate reductase	NA	A0A0A0PL85	Bacillus_phage	40.4	9.6e-26
WP_004191998.1|3210048_3211512_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004188997.1|3211648_3213019_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_004195962.1|3213164_3213773_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_004195963.1|3213789_3214374_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_004189767.1|3214621_3215227_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	4.2e-28
WP_004189931.1|3215345_3216611_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004189924.1|3216607_3217552_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_004189573.1|3217620_3217938_+	lipoprotein	NA	NA	NA	NA	NA
WP_004195964.1|3218104_3219043_-	CobD/CbiB family protein	NA	NA	NA	NA	NA
WP_004189888.1|3219143_3219797_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_004190182.1|3220750_3221341_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004189360.1|3221661_3222051_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_004189914.1|3222188_3222983_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004195969.1|3222984_3223674_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004189402.1|3223718_3223973_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004189308.1|3225413_3225881_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_004189906.1|3225915_3227073_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_004188962.1|3227181_3227670_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004189387.1|3227817_3229104_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004189890.1|3231119_3232055_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_004189750.1|3232070_3232820_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011807766.1|3233046_3233841_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004189862.1|3233914_3234568_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004190044.1|3234557_3235592_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	6.8e-34
WP_004190087.1|3235900_3236743_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
WP_004188957.1|3237085_3238009_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_004195984.1|3238187_3239483_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004532363.1|3239708_3240611_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_004189725.1|3240934_3241252_-	competence protein ComE	NA	NA	NA	NA	NA
WP_004190173.1|3241323_3242316_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004200795.1|3242374_3243361_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.5	8.8e-15
WP_004189214.1|3243329_3244730_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
WP_004188993.1|3244850_3246020_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004195986.1|3246072_3246366_-	LapA family protein	NA	NA	NA	NA	NA
WP_004191998.1|3246601_3248065_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189865.1|3248183_3248507_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	38.9	4.7e-10
WP_004189285.1|3248529_3250242_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004189396.1|3250386_3251073_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_096325444.1|3251093_3253316_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004190098.1|3253519_3254602_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_004189993.1|3254636_3255719_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.2	8.5e-88
WP_004189806.1|3255892_3256489_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_004189243.1|3256587_3259188_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.8	9.5e-101
WP_004189892.1|3259698_3260373_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004532296.1|3260541_3261240_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_004190123.1|3261265_3261991_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_144410474.1|3262588_3263709_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	2.3e-48
WP_004186184.1|3263971_3265192_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	6.6e-238
>prophage 8
NZ_CP009642	Burkholderia mallei strain India86-567-2 chromosome I, complete sequence	3560434	3298934	3337105	3560434	tRNA,integrase,transposase	Leptospira_phage(30.0%)	36	3309302:3309361	3335938:3337134
WP_004186184.1|3298934_3300155_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	6.6e-238
WP_004190100.1|3300496_3300757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197792.1|3300779_3301256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197793.1|3301511_3301727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197795.1|3302426_3302678_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_004203540.1|3302964_3303453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189437.1|3303449_3304700_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_004188913.1|3304708_3307045_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004189159.1|3307191_3307581_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_011203825.1|3308193_3308787_+	chorismate mutase	NA	NA	NA	NA	NA
WP_004197797.1|3308783_3308942_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
3309302:3309361	attL	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCC	NA	NA	NA	NA
WP_038802950.1|3309348_3310469_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004189968.1|3310499_3311171_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	46.1	1.3e-46
WP_144410475.1|3311884_3313005_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200457.1|3313287_3313776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191998.1|3314077_3315541_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004186453.1|3315663_3316644_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_004186190.1|3316646_3317102_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_004185928.1|3317240_3318077_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004186391.1|3318370_3318604_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004185395.1|3318621_3318789_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_004186553.1|3318845_3320558_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_004185611.1|3320749_3321634_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_004185886.1|3321630_3322767_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_004186237.1|3322935_3324132_-	aminotransferase	NA	NA	NA	NA	NA
WP_004186398.1|3324328_3325681_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004186079.1|3325692_3326955_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_004185746.1|3326951_3327614_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.0	1.6e-25
WP_004535897.1|3327738_3328731_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_004185348.1|3328842_3331680_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.0	1.6e-80
WP_004186086.1|3331679_3332180_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_004186216.1|3332241_3333453_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.9	3.0e-41
WP_004186718.1|3333516_3333963_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	64.4	7.9e-48
WP_004185819.1|3334051_3334834_-	membrane protein	NA	NA	NA	NA	NA
WP_004185697.1|3334998_3335745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|3335984_3337105_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
3335938:3337134	attR	TGACCTGCCCCCTTCGATAGGGCCAATGGGCTTCTAGCAAAGTCCCTTTAAACCAACTCCTGGAAAGCGGCAGGAGCGTCCGCGGTTGCCCGATGTTTCGCCGCAAACTCTGACGGCGCAAGGTAGTTCAGTGCGCTGTGCGGCCTTTGCTCGTTGTAGTCCTGACGCCATGCCGCGATGACTGCCCGAGCGTGCGCGAGCGTCGTGAACCAGTGCTCGTTAAGGCATTCGTCGCGGAACTTGCCGTTGAACGATTCGATGTACGCATTCTGCGTGGGCTTGCCCGCCTGAATCAACTTCAGCGTGACGCCGTTCGCATACGCCCACTGGTCAAGCGCGCGGCTCGTAAATTCGGGTCCCTGGTCTGTTCGCACCGCCTTGGGATAGCCACGGAAGCGAGCTGCACGGTCCAATGCCCGAGCGACATACAAACCTGAGATGCCATGGTCGACGACGATGTCGACAGCCTCTTTCGTGAAATCGTCGACGACGGTCAGGCACTTCACGCGCCGGCCGTTGGAAAGCGCATCCATCACGAAATCGATTGACCATACCTCGTTGGGTGCGCCCGGCAATGCCAGTTGCTCGCGCTCAATCATGACGCCGTGGCGCTTGCGACGGCGCCGCACAGCCAGCCCTGCCTCACGGTACAGGCGATAGATGCGCTTGTGATTGGCGTGCGTGCCTTCGCGTTCCACCAGGGCGTGCAGTCGGCGGTAGCCGAATCGACGACGTTCGTGCGCCAACTTCACCAGACGCGCCGCGAGCACCTCATTCTCGTGGTCCGGCTTCGCGTCGTAATGCAGCACGCTGCGAGAAAGCCCGACAAGCCGGCAGGCGCGGCGCTCGGAGATGTTGACCTTCTCCCGAATCGCCAACACTGCTTCGCGTTTGGCTTGCGGGCTCAGGGCTTTCCCTTGACGACAACCTTCAACGCTTCCATATCGAGCATTGCTTCGGCCAGCAGTTTCTTCAGTCGGGCATTCTCCACCTCGAGGCCCTTGAGCCGGCGGGCTTCCGAAACTTCCATGCCGCCGAACTTCGCGCGCCAGGTGTAGAACGACGCGTCACTGAACCCATGCTTCCTGCACAGTTCCTTGACCGGCATACCGGCCTCGGCTTCCTTCAGAAACCCGATGATTTGCTGTTCCGTAAAGCGCTTCTTCATGTTCGTCTTCTTCTCCGAAAACGAACTTT	NA	NA	NA	NA
>prophage 9
NZ_CP009642	Burkholderia mallei strain India86-567-2 chromosome I, complete sequence	3560434	3458323	3515901	3560434	tRNA,portal,protease,transposase	Vibrio_phage(17.65%)	50	NA	NA
WP_004191998.1|3458323_3459787_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190029.1|3459953_3460724_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004189747.1|3460755_3461595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190092.1|3461721_3463194_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004189326.1|3463196_3464687_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|3464799_3465099_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004189550.1|3465464_3466508_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|3466627_3467701_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004189260.1|3467697_3468210_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004189575.1|3468393_3470802_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|3470813_3471962_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004190168.1|3472319_3473096_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|3473092_3473878_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004189793.1|3474299_3474752_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|3474771_3475404_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|3475497_3476232_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_004189647.1|3476699_3477383_-	response regulator	NA	NA	NA	NA	NA
WP_004189034.1|3477383_3479792_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|3479793_3480384_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004189046.1|3480380_3481790_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|3482167_3483025_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004189288.1|3483134_3483770_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004200737.1|3483890_3484874_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004201745.1|3484905_3485409_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.7e-12
WP_004190020.1|3485637_3486828_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|3486887_3487259_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004200734.1|3487469_3490079_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|3490300_3491356_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188904.1|3491805_3492822_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004189208.1|3492942_3493812_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|3493849_3494254_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004187628.1|3494644_3495865_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_038802950.1|3497181_3498301_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004200731.1|3498353_3498836_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004188977.1|3498832_3499117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200730.1|3499189_3500281_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	92.3	2.0e-193
WP_004200729.1|3500679_3501090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189258.1|3501226_3502102_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	47.3	9.6e-74
WP_004190014.1|3502112_3503225_-	histone deacetylase	NA	A0A2K9KZC4	Tupanvirus	30.8	3.2e-37
WP_004201742.1|3503253_3504348_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004189434.1|3504490_3505459_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189874.1|3505561_3506131_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004189689.1|3506723_3507272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189592.1|3507535_3508984_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	33.5	4.9e-30
WP_004200727.1|3509002_3510616_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004200726.1|3510775_3511717_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004190110.1|3511713_3512808_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.4	3.8e-19
WP_004197761.1|3513209_3513626_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004197759.1|3513849_3514404_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_038802950.1|3514781_3515901_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 1
NZ_CP009643	Burkholderia mallei strain India86-567-2 chromosome II, complete sequence	2126012	23511	81220	2126012	transposase,holin,plate	Leptospira_phage(33.33%)	44	NA	NA
WP_004190851.1|23511_24501_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004196180.1|24497_26360_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190879.1|26373_26805_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196178.1|26884_27412_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_004190846.1|27555_29061_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004202234.1|29063_29612_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004188491.1|29645_30584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325460.1|30706_31827_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004188420.1|33532_35047_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_004188272.1|35411_36101_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_004206084.1|36860_37862_+	HpnL family protein	NA	NA	NA	NA	NA
WP_004188389.1|37900_38668_+|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_004188554.1|38664_40353_+	phosphoenolpyruvate mutase	NA	NA	NA	NA	NA
WP_004187270.1|41541_42609_+	2-aminoethylphosphonate aminotransferase	NA	NA	NA	NA	NA
WP_004187801.1|42754_43522_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004196021.1|43594_44560_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187681.1|44798_45872_+	FUSC family protein	NA	NA	NA	NA	NA
WP_004188593.1|46185_47397_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_004196023.1|47500_49003_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004200655.1|49190_50213_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_004187774.1|50203_52900_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_004188267.1|53039_56462_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_004188464.1|56598_57555_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_004187979.1|57563_58505_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_004551378.1|58599_60015_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_004188408.1|60310_60517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188127.1|60748_61372_+	nitroreductase	NA	NA	NA	NA	NA
WP_004202249.1|61446_61950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200658.1|62507_63605_+	chitin-binding protein	NA	C3TWS8	Euproctis_pseudoconspersa_nucleopolyhedrovirus	33.3	8.0e-25
WP_004187548.1|63864_64428_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_004196027.1|64631_65774_+	alkyl hydroperoxide reductase subunit F	NA	NA	NA	NA	NA
WP_038802950.1|65673_66793_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004187151.1|67446_69462_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_004196029.1|69455_69776_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_004188376.1|69932_71915_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.8	1.8e-83
WP_004202253.1|73332_73941_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.0	5.4e-23
WP_004187501.1|73980_75516_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_004188572.1|75670_76147_+	bacterioferritin	NA	NA	NA	NA	NA
WP_004187671.1|76193_77066_+	glutamate racemase	NA	NA	NA	NA	NA
WP_004187745.1|77197_77437_+	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_004188251.1|77661_78402_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_004188455.1|78438_79167_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_004200660.1|79180_79609_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_004191998.1|79756_81220_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
>prophage 2
NZ_CP009643	Burkholderia mallei strain India86-567-2 chromosome II, complete sequence	2126012	192101	266189	2126012	transposase,plate	Organic_Lake_phycodnavirus(25.0%)	52	NA	NA
WP_004187303.1|192101_193187_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004187986.1|193186_195076_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004187068.1|195106_195688_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004187921.1|195674_196640_-	ImpE/SciE family protein	NA	NA	NA	NA	NA
WP_004188539.1|196636_197383_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_004196243.1|200847_201429_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004188012.1|201463_202963_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004188308.1|203079_203565_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004187276.1|203671_204175_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004188743.1|204196_205543_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004188530.1|205631_206897_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_004188288.1|211020_211251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196246.1|211836_213183_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187006.1|213425_214352_-	catecholic dioxygenase	NA	NA	NA	NA	NA
WP_004187502.1|214406_215378_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004187879.1|215406_217275_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	25.9	3.0e-24
WP_004187705.1|217320_218805_-	Pyoverdin chromophore biosynthetic protein pvcC	NA	NA	NA	NA	NA
WP_004188574.1|218830_219730_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_004188150.1|219726_220785_-	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_157047211.1|220783_221161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188385.1|221386_224347_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_004196252.1|224558_226475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187552.1|226916_227282_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004202300.1|227421_227706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188660.1|227725_228466_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004188170.1|229010_229943_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004204001.1|230095_231343_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004554722.1|231506_232406_+	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004196262.1|233017_233458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201242.1|233949_234990_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004188790.1|235283_236120_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004187366.1|236461_237364_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187422.1|237543_238734_+	amidohydrolase	NA	NA	NA	NA	NA
WP_004188653.1|240121_240751_+	porin	NA	NA	NA	NA	NA
WP_004203996.1|240944_242342_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.7	2.3e-45
WP_096325434.1|243481_244601_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198864.1|244646_245393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188578.1|246779_247529_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004188783.1|247772_248678_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_004187664.1|248993_250073_+	porin	NA	NA	NA	NA	NA
WP_004187771.1|250114_251593_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_004188039.1|251669_252797_-	OpgC domain-containing protein	NA	NA	NA	NA	NA
WP_004204611.1|253196_254090_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_004187760.1|254086_254383_-	acylphosphatase	NA	NA	NA	NA	NA
WP_004202312.1|254543_255551_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_004188344.1|255805_257260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188250.1|257485_258670_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_004187484.1|259063_260005_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_004187762.1|260017_261178_+	adenosyl-hopene transferase HpnH	NA	NA	NA	NA	NA
WP_004187860.1|261522_261876_+	DOPA 4,5-dioxygenase family protein	NA	NA	NA	NA	NA
WP_004200694.1|262424_263783_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_004191998.1|264725_266189_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
>prophage 3
NZ_CP009643	Burkholderia mallei strain India86-567-2 chromosome II, complete sequence	2126012	694969	761735	2126012	tRNA,transposase,portal,integrase	Burkholderia_phage(16.67%)	59	699334:699393	762039:762586
WP_004190269.1|694969_695974_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004190833.1|697971_699051_+	putative membrane protein	NA	NA	NA	NA	NA
WP_038802950.1|699116_700236_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
699334:699393	attL	TGCTCGATATGGAAGCGTTGAAGGTTGTCGTCAAGGGAAAGCCCTGAGCCCGCAAGCCAA	NA	NA	NA	NA
WP_004190721.1|700264_701152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004195671.1|701334_701661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190242.1|701891_702740_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190802.1|702835_703429_+	LysE family translocator	NA	NA	NA	NA	NA
WP_004195676.1|703670_704081_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004190743.1|704333_705572_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_004190434.1|705636_706092_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_004190582.1|707376_709020_+	DUF3459 domain-containing protein	NA	NA	NA	NA	NA
WP_004190469.1|709178_709808_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004190954.1|709804_711145_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004190659.1|711230_712010_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004190540.1|712102_713023_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004190343.1|713089_713965_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190990.1|714062_714446_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_004195687.1|714643_716566_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_004190826.1|716600_717449_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_004190506.1|717992_718694_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	2.9e-20
WP_004190258.1|718695_719370_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004195689.1|719382_720183_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004204469.1|720623_721322_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004190691.1|721572_722721_+	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_004190391.1|722817_722976_+	DUF3563 domain-containing protein	NA	NA	NA	NA	NA
WP_004190960.1|723088_723508_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_004190487.1|723645_724098_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038730270.1|724217_724469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190835.1|724600_725413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190439.1|725403_726399_-	homoserine kinase	NA	NA	NA	NA	NA
WP_004190726.1|726492_726891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190957.1|727046_728573_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_004195697.1|728656_729343_-|integrase	tyrosine-type recombinase/integrase	integrase	E5E3N4	Burkholderia_phage	81.6	3.3e-93
WP_009950031.1|729339_729627_-|portal	phage portal protein	portal	K4NZV0	Burkholderia_phage	94.4	6.4e-43
WP_004203322.1|731968_732232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190352.1|732667_733159_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004190916.1|733818_734103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190924.1|734254_734524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004530319.1|734520_735270_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190446.1|735271_738052_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	2.9e-71
WP_004190401.1|738370_739753_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038763983.1|740128_741922_-	membrane protein	NA	NA	NA	NA	NA
WP_004204467.1|742261_742483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190499.1|742635_743511_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004190656.1|743569_744439_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_045589192.1|744563_746027_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190814.1|746179_747286_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004190549.1|747555_747849_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004190235.1|747845_748730_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004266656.1|748813_750718_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004195713.1|750868_751678_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_011204325.1|752068_753109_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	1.7e-93
WP_004190760.1|753248_754472_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004190342.1|754551_754764_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004190948.1|754930_755377_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	8.8e-23
WP_004190679.1|755471_757346_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.2	4.9e-67
WP_004540553.1|757392_757731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190933.1|757789_759832_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_004191998.1|760271_761735_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
762039:762586	attR	TGCTCGATATGGAAGCGTTGAAGGTTGTCGTCAAGGGAAAGCCCTGAGCCCGCAAGCCAAACGCGAAGCAGTGTTGGCGATTCGGGAGAAGGTCAACATCTCCGAGCGCCGCGCCTGCCGGCTTGTCGGGCTTTCTCGCAGCGTGCTGCATTACGACGCGAAGCCGGACCACGAGAATGAGGTGCTCGCGGCGCGTCTGGTGAAGTTGGCGCACGAACGTCGTCGATTCGGCTACCGCCGACTGCACGCCCTGGTGGAACGCGAAGGCACGCACGCCAATCACAAGCGCATCTATCGCCTGTACCGTGAGGCAGGGCTGGCTGTGCGGCGCCGTCGCAAGCGCCACGGCGTCATGATTGAGCGCGAGCAACTGGCATTGCCGGGCGCACCCAACGAGGTATGGTCAATCGATTTCGTGATGGATGCGCTTTCCAACGGCCGGCGCGTGAAGTGCCTGACCGTCGTCGACGATTTCACGAAAGAGGCTGTCGACATCGTCGTCGACCATGGCATCTCAGGTTTGTATGTCGCTCGGGCATTGGACCGTG	NA	NA	NA	NA
>prophage 4
NZ_CP009643	Burkholderia mallei strain India86-567-2 chromosome II, complete sequence	2126012	817334	867024	2126012	transposase,plate	Leptospira_phage(25.0%)	38	NA	NA
WP_004190585.1|817334_818738_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190689.1|818753_820070_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004190681.1|820072_823702_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190273.1|824598_824826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011807597.1|824824_827413_+	protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	27.0	2.5e-08
WP_004190988.1|827465_828545_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004190671.1|828607_829186_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190849.1|829178_830687_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|830746_831238_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004196148.1|831256_831817_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004190509.1|831821_833693_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190820.1|833689_835168_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004190714.1|835146_837801_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	2.3e-78
WP_004203275.1|837797_840002_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_045589201.1|840076_840730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162486055.1|840659_841742_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_038802950.1|841752_842873_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_045589205.1|842772_843534_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_011204340.1|843546_844527_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004190776.1|845043_846468_+	cytosine permease	NA	NA	NA	NA	NA
WP_004190245.1|846464_847403_+	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	25.3	1.4e-14
WP_004190461.1|847365_848043_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_004190588.1|848366_848510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190614.1|848498_849914_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	30.2	2.1e-41
WP_011204342.1|850112_850445_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004190911.1|850889_851201_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011204344.1|851479_852244_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_004190805.1|852374_853010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190603.1|853278_853815_+	cytochrome b	NA	NA	NA	NA	NA
WP_004190837.1|853975_854371_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_045589206.1|854458_856696_+	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_004196164.1|857046_858072_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004190433.1|858116_859151_+	lipase secretion chaperone	NA	NA	NA	NA	NA
WP_004200631.1|859252_860782_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004190757.1|860890_861991_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	5.2e-24
WP_004190781.1|862065_863112_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004196172.1|863212_864472_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038802950.1|865903_867024_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 5
NZ_CP009643	Burkholderia mallei strain India86-567-2 chromosome II, complete sequence	2126012	1356869	1406552	2126012	transposase	Streptococcus_phage(37.5%)	40	NA	NA
WP_004191998.1|1356869_1358333_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004194660.1|1359048_1359447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004204055.1|1359809_1360595_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_004194608.1|1360908_1362033_-	alanine racemase	NA	NA	NA	NA	NA
WP_153260196.1|1362134_1362434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038716969.1|1362561_1362942_+	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_024900545.1|1363106_1364342_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_004194656.1|1364346_1365321_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_004204048.1|1365539_1366028_-	DUF3455 domain-containing protein	NA	NA	NA	NA	NA
WP_004194613.1|1366317_1367133_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_038802950.1|1367224_1368345_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004198724.1|1369366_1371421_-	sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein	NA	NA	NA	NA	NA
WP_004204041.1|1371680_1372136_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_004194708.1|1372132_1372987_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_004194588.1|1373034_1374381_+	MFS transporter	NA	NA	NA	NA	NA
WP_004194610.1|1374634_1375744_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_004194640.1|1375981_1377064_+	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004194602.1|1377120_1378218_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.5	5.5e-26
WP_004194612.1|1378195_1379143_+	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004194685.1|1379132_1379993_+	2-aminoethylphosphonate ABC transport system, membrane component PhnV	NA	NA	NA	NA	NA
WP_004199121.1|1380036_1381308_+	phosphonoacetate hydrolase	NA	NA	NA	NA	NA
WP_004194628.1|1381304_1382759_+	phosphonoacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004194622.1|1382763_1383315_+	HD domain-containing protein	NA	A0A2K9L141	Tupanvirus	34.1	2.3e-20
WP_073699529.1|1383754_1383871_+	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
WP_038802950.1|1389468_1390589_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004199588.1|1390734_1391145_-	heme-binding protein	NA	NA	NA	NA	NA
WP_004198129.1|1391204_1392605_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_004198128.1|1392601_1393444_-	iron transporter OFeT family	NA	NA	NA	NA	NA
WP_004198127.1|1393503_1393833_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_004266710.1|1393892_1394444_-	membrane protein	NA	NA	NA	NA	NA
WP_004199587.1|1394667_1396758_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_004198124.1|1397045_1398245_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_004191998.1|1398403_1399867_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004204588.1|1400071_1400860_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_004198121.1|1401047_1402019_+	NADP-dependent aryl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004198120.1|1402167_1403013_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_004204587.1|1403025_1403304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011204222.1|1403527_1404991_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004198117.1|1405115_1405262_-	DUF3563 family protein	NA	NA	NA	NA	NA
WP_038802950.1|1405432_1406552_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
