The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009555	Burkholderia oklahomensis C6786 chromosome I, complete sequence	4132035	7432	87969	4132035	plate,transposase,tRNA,coat	uncultured_Caudovirales_phage(23.08%)	65	NA	NA
WP_010115800.1|7432_9142_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.5	1.0e-183
WP_010115802.1|9380_9857_-	NUDIX domain-containing protein	NA	A0A2I6PFL2	Proteus_phage	42.8	1.6e-22
WP_010104311.1|9875_10262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010115804.1|10490_12596_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_025989856.1|12697_13558_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_010115807.1|13582_14860_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_010115809.1|14898_16086_+	MFS transporter	NA	NA	NA	NA	NA
WP_010115812.1|16082_17171_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	27.5	4.8e-14
WP_010115814.1|17167_17371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025989857.1|17522_18869_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_010104319.1|19101_20685_+	acid phosphatase	NA	NA	NA	NA	NA
WP_010115818.1|21042_22236_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_010115820.1|22305_22563_-	trans-aconitate methyltransferase	NA	NA	NA	NA	NA
WP_038802563.1|22570_23203_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_025989858.1|23203_25279_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.3	5.9e-13
WP_010115833.1|25692_26658_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_010115835.1|26673_29082_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025989859.1|29126_29966_-	molecular chaperone	NA	NA	NA	NA	NA
WP_038800852.1|29983_30508_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_010104331.1|30590_31151_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025989860.1|31203_31749_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_010115842.1|32011_32212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157135620.1|32352_32502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010104335.1|32578_33472_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010115844.1|33918_35154_+	MFS transporter	NA	NA	NA	NA	NA
WP_010115846.1|35199_36126_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025989861.1|36598_36880_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_010104341.1|37330_37594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025989862.1|38243_38897_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010115854.1|39215_40166_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	37.3	3.2e-06
WP_010115856.1|40310_41159_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010115858.1|41183_42344_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_010115860.1|42356_43535_+	CoA transferase	NA	NA	NA	NA	NA
WP_010104356.1|43616_44999_+	MFS transporter	NA	NA	NA	NA	NA
WP_025989863.1|45379_46219_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_010122797.1|47362_48676_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_045568013.1|49405_50368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124072275.1|50503_50818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081470019.1|51912_52599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157135687.1|52860_53970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010111647.1|54194_54542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045568267.1|54663_55566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010104369.1|55679_58529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010115868.1|58525_59401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025989864.1|59402_62243_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_010104373.1|62254_62809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124072276.1|62845_63073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010104375.1|63159_63654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045568014.1|63631_66967_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.5	2.6e-10
WP_038801968.1|67075_69484_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_010104384.1|69480_70080_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_025989866.1|70076_70655_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_010115877.1|70767_71604_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_010115878.1|71606_74405_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.6	8.2e-26
WP_010115879.1|74921_75188_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_045568268.1|75211_76618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010122528.1|76697_78548_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_085970897.1|78833_79968_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.9	4.5e-15
WP_081470033.1|80344_81064_+	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
WP_107950886.1|81297_82284_-	helix-turn-helix domain-containing protein	NA	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	66.0	4.8e-98
WP_010122519.1|82421_84044_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.8	1.9e-54
WP_010122518.1|84143_84497_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.8	6.3e-16
WP_010122516.1|84496_84970_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_010112332.1|85503_86421_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	43.3	6.1e-71
WP_010112330.1|86616_87969_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	48.6	1.0e-98
>prophage 2
NZ_CP009555	Burkholderia oklahomensis C6786 chromosome I, complete sequence	4132035	116525	201817	4132035	tail,integrase,head,capsid,terminase,holin,transposase,portal	Burkholderia_virus(90.62%)	96	141974:142019	198378:198423
WP_038802199.1|116525_117926_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_144411686.1|118199_119099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081470040.1|119909_120566_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_081470039.1|120893_121598_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_124072278.1|121587_121938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107950866.1|122030_123230_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	1.2e-42
WP_025990584.1|124038_124353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124072279.1|124366_124708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124072280.1|125319_126558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010122736.1|127153_128314_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_010122737.1|128315_129722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802202.1|129718_130264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124072281.1|130665_132000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010122741.1|132107_133559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124072282.1|133589_135359_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_085970860.1|135417_136628_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.8	4.0e-102
WP_082094580.1|136706_137312_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_010121254.1|137565_137904_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_081470000.1|138051_138243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082094581.1|139189_140791_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_010121256.1|140950_141721_-	hypothetical protein	NA	NA	NA	NA	NA
141974:142019	attL	CTGGCCCGCCCTACACGATTCGAACGTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_010121261.1|142507_143176_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	92.8	4.1e-125
WP_025990441.1|143260_143902_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	89.7	1.3e-107
WP_025990442.1|144031_145126_-	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	95.5	5.2e-202
WP_010109969.1|145153_145888_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	96.3	7.0e-134
WP_010121267.1|145884_146445_-	hypothetical protein	NA	A4JX23	Burkholderia_virus	93.5	1.8e-97
WP_081470002.1|146640_147540_-	hypothetical protein	NA	A4JX22	Burkholderia_virus	83.3	4.4e-130
WP_010121271.1|147601_148144_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	87.2	1.9e-72
WP_025990443.1|148143_148641_-	lysozyme	NA	A4JX20	Burkholderia_virus	79.5	3.1e-69
WP_025990444.1|148633_148846_-|holin	holin	holin	A4JX19	Burkholderia_virus	100.0	1.3e-29
WP_081470003.1|148888_149605_-	hypothetical protein	NA	A4JX18	Burkholderia_virus	90.8	2.0e-125
WP_010121280.1|149912_153218_-	host specificity protein J	NA	Q8W6T0	Burkholderia_virus	94.5	0.0e+00
WP_025990446.1|153214_153799_-|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	93.3	2.5e-94
WP_010109982.1|153795_154548_-	C40 family peptidase	NA	Q6JIL4	Burkholderia_virus	89.2	4.2e-134
WP_010121284.1|154597_155281_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	95.2	2.8e-129
WP_010121286.1|155277_156663_-|tail	tail fiber domain-containing protein	tail	A4JX12	Burkholderia_virus	81.0	2.9e-221
WP_010121288.1|156671_157010_-|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	92.0	7.8e-56
WP_010121289.1|157006_161071_-|tail	phage tail tape measure protein	tail	Q6JIL8	Burkholderia_virus	84.6	0.0e+00
WP_010109990.1|161084_161369_-	DUF4035 domain-containing protein	NA	Q6JIL9	Burkholderia_virus	93.6	3.5e-41
WP_025990447.1|161368_161833_-|tail	tail assembly protein	tail	A4JX08	Burkholderia_virus	90.3	5.5e-76
WP_025990448.1|161860_162316_-	hypothetical protein	NA	A4JX07	Burkholderia_virus	94.0	8.5e-74
WP_010121292.1|162379_162727_-	DUF3168 domain-containing protein	NA	Q6JIM2	Burkholderia_virus	93.0	4.0e-55
WP_009901139.1|162723_163146_-	HK97 gp10 family phage protein	NA	Q6JIM3	Burkholderia_virus	96.4	5.5e-67
WP_010121293.1|163138_163465_-|head	phage head closure protein	head	Q8W6U2	Burkholderia_virus	95.4	1.6e-53
WP_010121294.1|163464_164031_-	hypothetical protein	NA	Q8W6U3	Burkholderia_virus	92.0	1.4e-94
WP_010121295.1|164037_164223_-	hypothetical protein	NA	Q8W6U4	Burkholderia_virus	75.4	9.2e-19
WP_010121296.1|164282_165590_-|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	86.2	1.1e-201
WP_010121298.1|165691_166660_-	S49 family peptidase	NA	A4JX00	Burkholderia_virus	93.8	5.2e-161
WP_025990449.1|166656_167916_-|portal	phage portal protein	portal	Q8W6U7	Burkholderia_virus	94.0	9.8e-229
WP_010121302.1|167919_168105_-	hypothetical protein	NA	Q8W6U8	Burkholderia_virus	83.6	8.6e-17
WP_010121303.1|168101_169814_-|terminase	terminase large subunit	terminase	Q8W6U9	Burkholderia_virus	95.8	0.0e+00
WP_025990450.1|169823_170309_-|terminase	phage terminase small subunit P27 family	terminase	Q8W6V0	Burkholderia_virus	94.4	7.4e-84
WP_025990451.1|170457_170814_-	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	93.2	1.1e-60
WP_004549735.1|170874_171132_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	100.0	2.4e-41
WP_004548635.1|171128_171515_+	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	99.2	1.4e-64
WP_010121307.1|172946_174146_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_010121309.1|174142_174739_+	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_157135679.1|174725_175388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010121313.1|175403_176195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010121314.1|176568_177216_-	hypothetical protein	NA	Q8W6N4	Burkholderia_virus	91.1	1.2e-102
WP_025990452.1|177224_177485_-	hypothetical protein	NA	Q8W6N5	Burkholderia_virus	84.9	1.9e-38
WP_124072284.1|177460_177769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010121320.1|177765_178188_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	74.5	4.2e-51
WP_025990453.1|178184_178559_-	hypothetical protein	NA	A4JX57	Burkholderia_virus	84.7	6.8e-53
WP_010121324.1|178555_179059_-	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	87.4	1.0e-75
WP_038802137.1|179103_180096_-	hypothetical protein	NA	Q6JIG0	Burkholderia_virus	97.6	7.1e-174
WP_010110014.1|180249_180510_-	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	87.2	1.3e-34
WP_010121328.1|180506_181328_-	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	97.4	3.5e-142
WP_010121330.1|181362_182325_-	phosphoadenosine phosphosulfate reductase family protein	NA	A9YWY5	Burkholderia_phage	96.5	2.0e-165
WP_085970892.1|182321_183554_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	53.8	4.3e-112
WP_010110021.1|183564_184005_-	hypothetical protein	NA	Q8W6P5	Burkholderia_virus	89.0	1.0e-68
WP_009901179.1|184188_184425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107950890.1|184676_184916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038801590.1|184922_185237_-	transcriptional regulator	NA	Q6JIG9	Burkholderia_virus	82.2	2.3e-41
WP_010110024.1|185300_185702_+	hypothetical protein	NA	Q6JIH0	Burkholderia_virus	89.5	8.9e-59
WP_010110026.1|186047_187337_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	91.1	8.3e-215
WP_025990457.1|187491_188385_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	92.3	5.8e-159
WP_010110028.1|188771_188999_+	hypothetical protein	NA	A4JX40	Burkholderia_virus	88.0	1.2e-31
WP_010121341.1|189162_189324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802134.1|189352_189589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010121343.1|189634_189850_+	hypothetical protein	NA	Q6JIH9	Burkholderia_virus	80.3	1.1e-28
WP_025990459.1|190366_191005_-	hypothetical protein	NA	A4JX33	Burkholderia_virus	56.3	6.5e-11
WP_162486564.1|191095_191404_+	hypothetical protein	NA	Q6JII2	Burkholderia_virus	87.3	2.2e-41
WP_010121349.1|191400_192213_+	prohibitin family protein	NA	Q8W6Q7	Burkholderia_virus	95.9	1.7e-141
WP_010121351.1|192471_192633_+	hypothetical protein	NA	Q8W6Q8	Burkholderia_virus	83.0	7.3e-12
WP_157135680.1|194062_194221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124072285.1|194213_194453_+	hypothetical protein	NA	Q6JIJ1	Burkholderia_virus	78.4	3.1e-27
WP_010121356.1|194449_194710_+	hypothetical protein	NA	A9YWU5	Burkholderia_phage	81.2	3.8e-34
WP_107950822.1|194702_194987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010121358.1|194983_196027_+	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	66.2	6.4e-133
WP_010121362.1|196464_196674_-	hypothetical protein	NA	Q6JIJ5	Burkholderia_virus	91.3	2.4e-31
WP_025990460.1|196755_196980_-	hypothetical protein	NA	Q6JIJ6	Burkholderia_virus	89.2	4.7e-33
WP_010121366.1|197273_198353_+|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	38.2	4.5e-57
WP_010121369.1|198621_199452_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
198378:198423	attR	CTGGCCCGCCCTACACGATTCGAACGTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_010102906.1|200001_200910_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_010102904.1|201115_201817_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	43.8	1.9e-11
>prophage 3
NZ_CP009555	Burkholderia oklahomensis C6786 chromosome I, complete sequence	4132035	711842	720255	4132035	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_124072298.1|711842_713636_+	alpha-galactosidase	NA	A0A2P0VP48	Tetraselmis_virus	30.3	4.6e-46
WP_010112903.1|714230_714584_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.8	9.7e-17
WP_038802501.1|716017_717565_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	51.2	2.2e-137
WP_025990543.1|717707_719189_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.5	5.7e-34
WP_038802500.1|719518_719851_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	71.6	4.7e-37
WP_038802864.1|719847_720255_-	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	44.1	2.0e-13
>prophage 4
NZ_CP009555	Burkholderia oklahomensis C6786 chromosome I, complete sequence	4132035	798950	809808	4132035	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_010114282.1|798950_801251_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.3	6.7e-167
WP_009892611.1|801247_801562_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
WP_004196460.1|802091_802295_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_045568050.1|802418_804005_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_010102073.1|804172_805432_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	1.5e-11
WP_010102068.1|805691_806270_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_081463944.1|806533_806749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025989693.1|806936_807446_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.5e-14
WP_010102066.1|807693_809808_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.8	4.4e-56
>prophage 5
NZ_CP009555	Burkholderia oklahomensis C6786 chromosome I, complete sequence	4132035	1857330	1864686	4132035	transposase	Burkholderia_phage(50.0%)	7	NA	NA
WP_010117455.1|1857330_1857873_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	59.1	7.6e-53
WP_010117454.1|1858130_1858583_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	53.1	3.7e-29
WP_010117452.1|1858582_1859659_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	91.7	4.3e-148
WP_010117446.1|1860723_1861872_+	DNA cytosine methyltransferase	NA	I6NLI4	Burkholderia_phage	61.4	3.4e-135
WP_010117442.1|1861871_1862804_+	DUF4928 family protein	NA	NA	NA	NA	NA
WP_010117439.1|1862800_1863259_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	54.8	8.4e-37
WP_107950858.1|1863486_1864686_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.2	4.6e-42
>prophage 6
NZ_CP009555	Burkholderia oklahomensis C6786 chromosome I, complete sequence	4132035	2043371	2106873	4132035	integrase,plate,protease,transposase	Burkholderia_phage(25.0%)	60	2065730:2065747	2088958:2088975
WP_010106907.1|2043371_2044085_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010106906.1|2044378_2049082_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_010117283.1|2049174_2050641_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_045568119.1|2050918_2052433_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_025990026.1|2052429_2052990_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_010117269.1|2053644_2054946_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_010117268.1|2054970_2056215_-	MFS transporter	NA	NA	NA	NA	NA
WP_025990025.1|2056732_2058499_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_010117260.1|2059123_2060257_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010106892.1|2060298_2060496_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_010117258.1|2060547_2061363_+	thiazole synthase	NA	NA	NA	NA	NA
WP_010117255.1|2061359_2062463_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_010106887.1|2062562_2063381_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	6.8e-21
WP_010106886.1|2063377_2064145_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_010117253.1|2064157_2064691_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_010117250.1|2064738_2065692_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
2065730:2065747	attL	GACGGCGGCCGGCGCGAA	NA	NA	NA	NA
WP_010106880.1|2065806_2066439_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010106879.1|2066435_2066705_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_010106878.1|2066934_2067861_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	32.9	2.6e-21
WP_010117247.1|2067857_2068613_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006029348.1|2068707_2068947_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_010117245.1|2068960_2070310_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_010106872.1|2070306_2070963_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010106871.1|2071003_2072341_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_010106870.1|2072492_2073563_+	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	25.9	1.2e-14
WP_010106868.1|2073626_2074214_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_010106867.1|2074269_2074890_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_010106865.1|2074886_2075528_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_010106863.1|2075694_2076450_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_010106861.1|2076532_2077306_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_010106859.1|2077305_2077719_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_010106857.1|2077715_2078084_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_010106856.1|2078137_2078527_+	membrane protein	NA	NA	NA	NA	NA
WP_010106855.1|2078555_2078921_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_010106854.1|2079008_2079245_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_010117244.1|2079267_2079795_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_010106852.1|2079833_2080616_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.7	1.9e-25
WP_010106851.1|2080923_2082132_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.9	6.5e-12
WP_010106850.1|2082153_2082900_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_025990024.1|2083120_2083741_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_010106848.1|2083741_2085124_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_010117241.1|2085145_2085904_+	cytochrome c1	NA	NA	NA	NA	NA
WP_010106845.1|2085997_2086609_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_025990023.1|2086678_2087203_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.5	8.7e-22
WP_010117237.1|2087375_2088404_-|integrase	tyrosine-type recombinase/integrase	integrase	E5E3T0	Burkholderia_phage	88.3	2.4e-172
WP_038802022.1|2088403_2088682_-	DUF4224 domain-containing protein	NA	E5E3T1	Burkholderia_phage	84.1	1.2e-33
WP_081469853.1|2088786_2089353_-|plate	Baseplate J family protein	plate	A0A089FGR9	Burkholderia_phage	79.3	3.8e-47
2088958:2088975	attR	GACGGCGGCCGGCGCGAA	NA	NA	NA	NA
WP_085970859.1|2089544_2090778_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.8	6.9e-102
WP_010117664.1|2092432_2092870_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_010117665.1|2092886_2093903_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010117666.1|2093919_2094372_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025990088.1|2094901_2095747_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010117668.1|2095733_2096588_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010117669.1|2096584_2097616_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010117671.1|2098277_2098586_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_045568121.1|2099000_2101790_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.2	8.1e-90
WP_045568122.1|2101803_2104044_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	27.7	8.1e-24
WP_052712363.1|2104062_2105709_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_010117228.1|2105718_2105982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107950761.1|2106115_2106873_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP009555	Burkholderia oklahomensis C6786 chromosome I, complete sequence	4132035	2457476	2466866	4132035		Hokovirus(16.67%)	7	NA	NA
WP_010116963.1|2457476_2459426_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	5.0e-147
WP_010116959.1|2459687_2460821_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.6	1.7e-22
WP_010116957.1|2460852_2462853_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	32.2	2.7e-55
WP_010116954.1|2463177_2463993_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.7	3.7e-35
WP_010116953.1|2464057_2464741_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	4.4e-05
WP_010116951.1|2464737_2465265_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_010106192.1|2465300_2466866_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.6	3.3e-24
>prophage 8
NZ_CP009555	Burkholderia oklahomensis C6786 chromosome I, complete sequence	4132035	3934946	3950993	4132035	integrase,transposase	Leptospira_phage(25.0%)	14	3926186:3926203	3956375:3956392
3926186:3926203	attL	CGTCGCGAGGCCGAGCGC	NA	NA	NA	NA
WP_025989824.1|3934946_3936551_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_010107948.1|3936650_3937004_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.0	1.3e-16
WP_010115644.1|3937003_3937498_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_010112228.1|3937847_3938048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010112230.1|3938044_3938503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085970860.1|3939473_3940684_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.8	4.0e-102
WP_010121075.1|3942139_3942532_-	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_010121077.1|3942573_3943866_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025990429.1|3944004_3944676_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107950808.1|3944874_3945685_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107950810.1|3945982_3946800_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	2.5e-07
WP_124072273.1|3947780_3948503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045568335.1|3948766_3949381_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A090C6M9	Clostridium_phage	29.0	7.1e-07
WP_010122425.1|3949961_3950993_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
3956375:3956392	attR	CGTCGCGAGGCCGAGCGC	NA	NA	NA	NA
