The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009551	Burkholderia pseudomallei PB08298010 chromosome I, complete sequence	4185347	288635	299582	4185347	protease	Agrobacterium_phage(16.67%)	10	NA	NA
WP_004196461.1|288635_290936_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|290932_291247_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|291779_291983_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_028358616.1|292112_293723_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|293735_293918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|293890_295150_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|295417_295996_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|296258_296477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|296657_297167_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|297467_299582_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
>prophage 2
NZ_CP009551	Burkholderia pseudomallei PB08298010 chromosome I, complete sequence	4185347	1102160	1167361	4185347	protease,transposase,tRNA,portal	Streptococcus_phage(13.33%)	59	NA	NA
WP_076903462.1|1102160_1103624_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.7	1.2e-79
WP_004199069.1|1103727_1104915_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.7	2.2e-121
WP_004199068.1|1105181_1106066_+	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_004199067.1|1106106_1106976_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_004199066.1|1107023_1107737_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_004199064.1|1107788_1108721_+	tyrosine recombinase XerC	NA	G1JX48	Mycobacterium_phage	28.0	2.4e-14
WP_004534321.1|1108809_1110087_+	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_004199061.1|1110264_1111341_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_004198318.1|1111890_1112307_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004203414.1|1112561_1113098_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_025985937.1|1113107_1114451_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.4	5.3e-39
WP_004198315.1|1114877_1115420_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004198314.1|1115439_1116720_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004198312.1|1116737_1116989_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_004200214.1|1117313_1118213_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_004198307.1|1118209_1119013_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_004523085.1|1118979_1119669_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_004198305.1|1120021_1121167_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004198304.1|1121163_1121778_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_004523086.1|1121789_1123103_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_004535313.1|1123092_1124145_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004525862.1|1124518_1125463_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004523088.1|1125672_1126737_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.8	1.3e-80
WP_080341099.1|1126976_1128440_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	4.0e-80
WP_004190029.1|1128611_1129382_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004523089.1|1129413_1130253_-	polyphosphate kinase	NA	NA	NA	NA	NA
WP_028358474.1|1130379_1131852_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004525859.1|1131854_1133345_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|1133457_1133757_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004189550.1|1134122_1135166_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|1135285_1136359_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004523092.1|1136355_1136868_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_028358729.1|1137051_1139463_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|1139474_1140623_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004525856.1|1140971_1141748_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|1141744_1142530_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004189793.1|1142951_1143404_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|1143423_1144056_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|1144149_1144884_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_009935896.1|1145352_1146036_-	response regulator	NA	NA	NA	NA	NA
WP_004523096.1|1146036_1148445_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004188929.1|1148446_1149037_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_004537745.1|1149033_1150443_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|1150940_1151798_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004189288.1|1151907_1152543_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004537742.1|1152663_1153647_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004525852.1|1153678_1154182_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.1e-12
WP_038731646.1|1154410_1155601_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|1155660_1156032_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004525850.1|1156242_1158852_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|1159073_1160129_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004523104.1|1160567_1161584_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_028358728.1|1161706_1162576_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|1162613_1163018_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_154218334.1|1163420_1163789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038731643.1|1163890_1164895_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_004200731.1|1165432_1165915_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004523107.1|1165911_1166196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028358727.1|1166269_1167361_-|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	92.3	2.0e-193
>prophage 3
NZ_CP009551	Burkholderia pseudomallei PB08298010 chromosome I, complete sequence	4185347	1397213	1403122	4185347	integrase	Ralstonia_phage(33.33%)	7	1392062:1392113	1407931:1407982
1392062:1392113	attL	CTGCCCTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAAG	NA	NA	NA	NA
WP_028359367.1|1397213_1398131_+	hypothetical protein	NA	A0A077JGB2	Xanthomonas_phage	31.6	2.8e-15
WP_028359366.1|1398127_1399492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038761951.1|1399568_1400150_+	hypothetical protein	NA	A0A0K2QQ53	Ralstonia_phage	58.0	1.0e-10
WP_028359365.1|1400597_1401377_+	hypothetical protein	NA	A0A1W5LU59	Ralstonia_phage	40.7	9.3e-36
WP_028359364.1|1401743_1402331_+|integrase	integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	50.6	7.0e-44
WP_028359363.1|1402371_1402797_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	37.2	3.5e-13
WP_028359362.1|1402789_1403122_+	transcriptional regulator	NA	A0A088CD40	Shigella_phage	56.6	4.2e-14
1407931:1407982	attR	CTGCCCTCCGAAGGCAGGGGTTGCTGGTTCGATCCCAGCCGGGCGCGCCAAG	NA	NA	NA	NA
>prophage 4
NZ_CP009551	Burkholderia pseudomallei PB08298010 chromosome I, complete sequence	4185347	1624277	1684376	4185347	protease,transposase,tail,integrase	Burkholderia_phage(21.43%)	63	1660839:1660855	1682100:1682116
WP_004196743.1|1624277_1624991_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004196742.1|1625281_1629985_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_028358410.1|1630078_1631545_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_004196738.1|1631824_1633336_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_004201288.1|1633332_1633893_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_004527892.1|1634169_1635936_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_004521927.1|1636538_1637672_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004199938.1|1637720_1637918_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_004199935.1|1637970_1638786_+	thiazole synthase	NA	NA	NA	NA	NA
WP_004555437.1|1638782_1639886_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004199931.1|1639985_1640804_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	3.4e-20
WP_004199929.1|1640800_1641568_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_004545631.1|1641580_1642147_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_004527890.1|1642194_1643154_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_004199924.1|1643268_1643901_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004199923.1|1643897_1644167_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_004521934.1|1644462_1645389_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	2.0e-21
WP_004199919.1|1645385_1646141_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004199917.1|1646226_1646466_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004521935.1|1646479_1647829_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004199915.1|1647825_1648482_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004527888.1|1648523_1649861_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_004199913.1|1650016_1651087_+	histidinol-phosphate transaminase	NA	A0A1X7BZP2	Faustovirus	26.6	2.1e-14
WP_004199911.1|1651150_1651738_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_004199909.1|1651793_1652414_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_004199907.1|1652410_1653052_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_004199906.1|1653219_1653975_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_004557290.1|1654057_1654831_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_004201279.1|1654830_1655244_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_004202813.1|1655240_1655609_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_004202812.1|1655661_1656051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185206.1|1656079_1656445_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_004199902.1|1656533_1656767_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_004531855.1|1656793_1657321_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004199900.1|1657359_1658142_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.7	8.7e-26
WP_004521939.1|1658482_1659691_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.9	8.5e-12
WP_004202811.1|1659712_1660459_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_004204996.1|1660679_1661300_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
1660839:1660855	attL	GTCGACATCGGCGCGCT	NA	NA	NA	NA
WP_004199894.1|1661300_1662683_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_004521940.1|1662705_1663464_+	cytochrome c1	NA	NA	NA	NA	NA
WP_004185176.1|1663556_1664168_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004527881.1|1664237_1664759_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_028358673.1|1664952_1665996_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.3	3.4e-49
WP_038761028.1|1666296_1666509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038761030.1|1666512_1667244_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_154302346.1|1667249_1667411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080291545.1|1667550_1667790_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_028358674.1|1667800_1668940_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_028358675.1|1668942_1669398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080291546.1|1669740_1670442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028358676.1|1670681_1671407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028358677.1|1671403_1672066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028358678.1|1673068_1674685_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	22.6	1.7e-23
WP_080291547.1|1674797_1675682_+	sce7726 family protein	NA	NA	NA	NA	NA
WP_038761033.1|1675744_1676695_+	sce7725 family protein	NA	NA	NA	NA	NA
WP_004555439.1|1677634_1678639_+	AAA family ATPase	NA	Q677Q6	Lymphocystis_disease_virus	31.7	2.6e-14
WP_004555440.1|1678695_1680993_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_100209513.1|1680951_1681467_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	52.5	4.0e-27
WP_123903074.1|1681391_1681919_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	49.2	5.1e-30
WP_028358682.1|1682006_1682420_+|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	99.2	6.8e-70
1682100:1682116	attR	GTCGACATCGGCGCGCT	NA	NA	NA	NA
WP_028358683.1|1682437_1682920_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	90.2	3.9e-77
WP_111963042.1|1683316_1683907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004547581.1|1684010_1684376_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	88.4	1.5e-52
>prophage 5
NZ_CP009551	Burkholderia pseudomallei PB08298010 chromosome I, complete sequence	4185347	2019418	2028665	4185347		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|2019418_2021371_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004533593.1|2021636_2022767_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	3.8e-22
WP_028359422.1|2022800_2024810_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.4	2.2e-52
WP_004194137.1|2024993_2025809_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004532195.1|2025873_2026557_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194373.1|2026553_2027081_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004554168.1|2027117_2028665_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 6
NZ_CP009551	Burkholderia pseudomallei PB08298010 chromosome I, complete sequence	4185347	2938219	2946414	4185347		Burkholderia_virus(50.0%)	12	NA	NA
WP_004196630.1|2938219_2938483_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	2.2e-26
WP_071897863.1|2938466_2938652_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.2	4.4e-21
WP_009920998.1|2938672_2939398_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	44.0	5.8e-32
WP_038763587.1|2939404_2940007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004527237.1|2940348_2940855_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.1	5.1e-19
WP_004527236.1|2940851_2941277_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	3.8e-15
WP_004557051.1|2941557_2941953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531416.1|2942206_2942434_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_004527234.1|2942469_2942703_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	60.6	4.3e-13
WP_004550288.1|2942778_2943240_-	avidin	NA	NA	NA	NA	NA
WP_004193371.1|2944486_2945110_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_004192901.1|2945304_2946414_-	class II histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	31.0	7.8e-36
>prophage 7
NZ_CP009551	Burkholderia pseudomallei PB08298010 chromosome I, complete sequence	4185347	3628519	3698210	4185347	transposase,tRNA,integrase	Salmonella_phage(12.5%)	53	3622305:3622320	3655243:3655258
3622305:3622320	attL	GTCTCGCGACGAGCTT	NA	NA	NA	NA
WP_028359486.1|3628519_3629569_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_080291464.1|3629911_3630334_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_028358315.1|3630662_3631961_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	52.2	1.0e-111
WP_004191606.1|3633274_3634987_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.3	8.3e-13
WP_028358316.1|3635521_3637009_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_028358317.1|3637235_3638822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004545269.1|3639196_3640909_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_004193730.1|3640955_3641582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192889.1|3641725_3642280_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004192776.1|3642689_3643916_+	MFS transporter	NA	NA	NA	NA	NA
WP_004526875.1|3644132_3645083_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004199468.1|3645267_3647040_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.9	6.6e-37
WP_009970647.1|3647060_3648071_+	DUF1571 domain-containing protein	NA	NA	NA	NA	NA
WP_004521652.1|3648245_3648518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028358318.1|3648822_3649425_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_028358319.1|3649575_3650289_-	DUF2968 domain-containing protein	NA	NA	NA	NA	NA
WP_004191821.1|3650379_3651771_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004526869.1|3651787_3653596_-	membrane protein	NA	NA	NA	NA	NA
WP_004192804.1|3653603_3653990_-	DUF3613 domain-containing protein	NA	NA	NA	NA	NA
WP_004542205.1|3654011_3654947_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_004547033.1|3654983_3656000_-	type II secretion system F family protein	NA	NA	NA	NA	NA
3655243:3655258	attR	AAGCTCGTCGCGAGAC	NA	NA	NA	NA
WP_004526866.1|3656005_3657013_-	fimbriae-related outer membrane protein	NA	NA	NA	NA	NA
WP_004521658.1|3657005_3658349_-	CpaF family protein	NA	NA	NA	NA	NA
WP_004193624.1|3658352_3659591_-	fimbrial protein	NA	NA	NA	NA	NA
WP_004192085.1|3659657_3660983_-	type II and III secretion system protein family protein	NA	NA	NA	NA	NA
WP_004521659.1|3661046_3661946_-	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_004193213.1|3662025_3662493_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_004521660.1|3662489_3662990_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_004521661.1|3663072_3663270_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_028359351.1|3663907_3665332_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_004192734.1|3665381_3666647_+	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_028359352.1|3666821_3668477_+	sugar transporter	NA	NA	NA	NA	NA
WP_004193599.1|3668720_3669182_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004191720.1|3669418_3669829_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_020850655.1|3670023_3671121_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004521669.1|3671227_3672658_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	1.9e-42
WP_004535634.1|3672757_3674023_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_004526855.1|3674157_3677022_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_045591085.1|3677376_3678840_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	1.2e-79
WP_004193111.1|3678951_3680778_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_004192835.1|3681070_3681568_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004534804.1|3681667_3683164_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004521673.1|3683231_3684467_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004193982.1|3684489_3686049_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011203915.1|3686319_3687255_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004199441.1|3687281_3687650_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004526850.1|3687755_3690683_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.3	6.8e-23
WP_004193517.1|3690774_3692250_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004193908.1|3692246_3692708_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004521674.1|3693012_3694677_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_028358349.1|3694740_3696069_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.1	4.0e-23
WP_004193481.1|3696487_3697390_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.6	4.5e-10
WP_004199443.1|3697808_3698210_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP009551	Burkholderia pseudomallei PB08298010 chromosome I, complete sequence	4185347	3798358	3863558	4185347	transposase,tRNA,coat,plate	Klosneuvirus(14.29%)	46	NA	NA
WP_004204967.1|3798358_3800983_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	5.5e-80
WP_004204969.1|3801518_3802739_+	CoA transferase	NA	NA	NA	NA	NA
WP_004196731.1|3803067_3803307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028359090.1|3803556_3805266_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.1	2.2e-186
WP_154302354.1|3805219_3805561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552886.1|3805721_3806204_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	1.7e-19
WP_004193860.1|3806222_3806609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028359091.1|3806896_3808996_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_004192265.1|3809097_3809958_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_028359092.1|3810001_3811435_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_004526793.1|3811668_3813252_+	acid phosphatase	NA	NA	NA	NA	NA
WP_004538373.1|3813449_3814643_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_004526790.1|3815266_3816454_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004545235.1|3816635_3818255_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_028359093.1|3818256_3819927_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192810.1|3820230_3820863_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004545138.1|3820863_3822945_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.3	3.9e-12
WP_004196717.1|3823355_3824321_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_028359094.1|3824336_3826748_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004526784.1|3826792_3827632_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004526783.1|3827649_3828174_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_028359095.1|3828250_3828811_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004538378.1|3828863_3829409_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004531175.1|3829669_3829891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196705.1|3830228_3831122_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009920898.1|3831564_3832824_+	MFS transporter	NA	NA	NA	NA	NA
WP_009920900.1|3832868_3833861_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004193855.1|3834328_3834610_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009966448.1|3834862_3835135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162486887.1|3835452_3835887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004554454.1|3836029_3837343_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_004526761.1|3837602_3838523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028359096.1|3841481_3842357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028359097.1|3842358_3845199_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.9	1.4e-20
WP_004521762.1|3845211_3845517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009954547.1|3845534_3845777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045588731.1|3846866_3847334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085952878.1|3847338_3848549_-|transposase	IS3-like element ISButh2 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.1	7.0e-99
WP_038760534.1|3852131_3854540_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_009943538.1|3854536_3855130_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_028358364.1|3855126_3855684_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_028358365.1|3855820_3856654_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_028358366.1|3856656_3859455_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.0	5.7e-27
WP_004193592.1|3859974_3860241_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_028358367.1|3860264_3861680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521775.1|3861707_3863558_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 1
NZ_CP009550	Burkholderia pseudomallei PB08298010 chromosome II, complete sequence	3190204	682251	753777	3190204	holin,plate	Vibrio_phage(25.0%)	55	NA	NA
WP_004188389.1|682251_683019_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_004206084.1|683057_684059_-	HpnL family protein	NA	NA	NA	NA	NA
WP_004525542.1|684055_684829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188272.1|684825_685515_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_004188420.1|685879_687394_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_004530037.1|689113_690052_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004202234.1|690085_690634_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190846.1|690636_692142_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|692285_692813_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004190879.1|692892_693324_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|693337_695200_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|695196_696186_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004525547.1|696188_699059_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_028359191.1|699049_701341_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_023358637.1|701506_703795_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004200633.1|703798_706015_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004547094.1|706014_707085_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004525551.1|707087_707804_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004190606.1|707846_708236_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004530042.1|708241_708835_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004525552.1|708831_710193_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004525553.1|710275_711934_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004525554.1|711930_715434_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190863.1|715492_715852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530792.1|715874_716297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004536812.1|716617_716893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524288.1|717443_718343_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_161935598.1|718384_718687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011205424.1|718576_719896_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004542407.1|719892_721476_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004186828.1|721698_722694_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_080291636.1|722819_723002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004528656.1|722998_724582_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004186853.1|725098_726352_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004198244.1|726897_728562_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.4	5.4e-57
WP_028359445.1|728694_730179_-	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_004530052.1|730448_731465_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004523135.1|731925_733125_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004198247.1|733302_734328_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_160457400.1|734341_734626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004545861.1|734761_736036_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_028359444.1|736108_737080_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004186987.1|737230_737764_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004186960.1|737824_739888_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186901.1|739890_741816_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004202150.1|741820_742993_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004186884.1|742989_743775_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004523139.1|743799_745068_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004530056.1|745088_746234_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004186918.1|746343_747207_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004186811.1|747387_749043_+	APC family permease	NA	NA	NA	NA	NA
WP_004186920.1|749129_750005_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_028359443.1|750148_751027_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186939.1|751189_752743_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_004530058.1|752739_753777_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 2
NZ_CP009550	Burkholderia pseudomallei PB08298010 chromosome II, complete sequence	3190204	2771565	2855138	3190204	plate,transposase	Ralstonia_phage(14.29%)	49	NA	NA
WP_028358330.1|2771565_2772294_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	31.2	7.1e-22
WP_028358329.1|2773116_2774877_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004555168.1|2774919_2775162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076849157.1|2784829_2785027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004533385.1|2785027_2785291_-	putative Immunity protein 75	NA	NA	NA	NA	NA
WP_004544773.1|2785646_2785808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555170.1|2785914_2790510_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	38.3	1.1e-27
WP_028358328.1|2790496_2791765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555171.1|2791780_2793985_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.2	4.2e-41
WP_004538232.1|2795198_2796419_-|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	4.6e-239
WP_154233463.1|2796450_2796717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004548493.1|2797301_2797901_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_004524853.1|2797925_2798336_-	RidA family protein	NA	NA	NA	NA	NA
WP_004555164.1|2798450_2799560_-	asparaginase	NA	NA	NA	NA	NA
WP_004555165.1|2799740_2800373_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_004524850.1|2801269_2801707_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038716319.1|2804435_2805860_-	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_017880942.1|2806075_2807260_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_004524845.1|2807270_2808158_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_028358331.1|2808160_2808931_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_028358332.1|2808945_2809809_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.4	1.9e-13
WP_004524842.1|2809805_2810774_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004524841.1|2810794_2811793_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_028358333.1|2811830_2813033_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.9	4.0e-46
WP_004557914.1|2813043_2813757_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004544619.1|2813888_2814779_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004548470.1|2815220_2815817_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.0e-27
WP_004543854.1|2815857_2817420_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.5	2.2e-145
WP_004543818.1|2817449_2817797_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.6e-40
WP_038760450.1|2818631_2820665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028358335.1|2820905_2823077_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004524829.1|2823081_2823933_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004524828.1|2823933_2824857_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004524827.1|2824919_2826161_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004524825.1|2826196_2827441_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.1e-22
WP_004557920.1|2827483_2828122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029670706.1|2829894_2831049_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004524822.1|2832810_2833551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009960547.1|2833979_2834135_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	67.6	2.0e-06
WP_004557924.1|2836894_2837461_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_172644509.1|2837462_2837945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028359486.1|2840831_2841881_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004549102.1|2843685_2844837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157801140.1|2844847_2845099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028358323.1|2846142_2848155_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.6	2.3e-30
WP_004196151.1|2848084_2848738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|2848812_2851017_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004540478.1|2851013_2853680_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	1.8e-78
WP_028358324.1|2853692_2855138_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
