The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009549	Burkholderia sp. 2002721687 chromosome I, complete sequence	4067533	320551	329549	4067533	integrase	Ralstonia_phage(37.5%)	10	308100:308115	333847:333862
308100:308115	attL	TCGATCGCCGCGAGCG	NA	NA	NA	NA
WP_009913961.1|320551_321475_+	AAA family ATPase	NA	E5F074	Ralstonia_phage	36.5	4.0e-30
WP_043281864.1|321471_322842_+	type II secretory pathway protein	NA	NA	NA	NA	NA
WP_009913959.1|322941_323523_+	hypothetical protein	NA	A0A0K2QQ53	Ralstonia_phage	53.1	5.5e-09
WP_043281862.1|323967_324747_+	hypothetical protein	NA	A0A1W5LU59	Ralstonia_phage	41.1	2.7e-35
WP_045554880.1|324957_325701_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	48.7	4.2e-54
WP_009913956.1|325741_326074_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	51.9	3.7e-18
WP_009913954.1|326081_326399_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	55.7	1.1e-14
WP_158354520.1|326442_327324_+	DUF4935 domain-containing protein	NA	A4PE40	Ralstonia_virus	42.4	3.8e-46
WP_009913949.1|328316_328550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043281860.1|328787_329549_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	75.1	2.3e-100
333847:333862	attR	TCGATCGCCGCGAGCG	NA	NA	NA	NA
>prophage 2
NZ_CP009549	Burkholderia sp. 2002721687 chromosome I, complete sequence	4067533	937821	947006	4067533		Hokovirus(16.67%)	7	NA	NA
WP_009913494.1|937821_939771_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	1.0e-147
WP_006025367.1|940034_941168_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.2	9.1e-24
WP_009913491.1|941199_943161_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	32.3	3.8e-54
WP_006025369.1|943327_944143_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.1	9.7e-36
WP_006025370.1|944207_944891_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
WP_006025371.1|944887_945415_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_006025372.1|945452_947006_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 3
NZ_CP009549	Burkholderia sp. 2002721687 chromosome I, complete sequence	4067533	1279006	1314681	4067533	integrase,capsid,head,transposase,tail,plate	Ralstonia_phage(37.14%)	49	1308506:1308522	1321407:1321423
WP_009913260.1|1279006_1279801_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	65.5	1.5e-102
WP_009913259.1|1279950_1280343_-	hypothetical protein	NA	A0A1S5NV54	Burkholderia_phage	37.5	1.9e-13
WP_006025663.1|1281515_1282088_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_006025664.1|1282084_1283152_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	42.7	2.1e-67
WP_006025665.1|1283151_1283502_-	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	56.5	2.3e-26
WP_006025666.1|1283567_1284170_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	42.4	1.3e-37
WP_009916826.1|1284166_1285291_-|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	42.3	4.1e-77
WP_006025668.1|1285274_1286585_-	DMT family permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	29.4	1.0e-42
WP_006025669.1|1286586_1288839_-|tail	tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	30.3	9.5e-57
WP_006025670.1|1288969_1289368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006025671.1|1289364_1289742_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	42.5	1.3e-22
WP_006025672.1|1289771_1291193_-|tail	tail sheath protein	tail	B7SDP8	Haemophilus_phage	48.0	5.5e-103
WP_006025673.1|1291196_1291424_-	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	56.5	1.9e-05
WP_006025674.1|1291420_1292089_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_006025675.1|1292093_1292507_-	DUF1320 domain-containing protein	NA	A0A2P9JZJ4	Alteromonadaceae_phage	40.4	1.5e-13
WP_006025676.1|1292513_1293047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006025677.1|1293165_1294059_-|head	head protein	head	A0A0M4UKB9	Ralstonia_phage	64.3	7.0e-112
WP_006025678.1|1294101_1294512_-	hypothetical protein	NA	A0A0M4TU84	Ralstonia_phage	53.7	1.2e-29
WP_006025679.1|1294578_1295688_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	47.4	2.3e-72
WP_006025680.1|1295887_1296472_-	phage virion morphogenesis protein	NA	B7SDZ4	Pseudomonas_virus	39.3	7.2e-09
WP_006025681.1|1296575_1297889_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	47.3	4.8e-61
WP_006025682.1|1297878_1299450_-	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	52.1	2.2e-145
WP_006025683.1|1299479_1301264_-	hypothetical protein	NA	A0A0M4U7A1	Ralstonia_phage	73.7	2.1e-253
WP_006025684.1|1301265_1301463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043282361.1|1301475_1301973_-	DUF1804 family protein	NA	A0A0A1IX73	Pseudomonas_phage	67.5	2.6e-55
WP_006025686.1|1301976_1302186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006025687.1|1302182_1302452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006025688.1|1302475_1302709_-	conjugal transfer protein TraR	NA	A0A0M4UVB2	Ralstonia_phage	45.3	7.8e-07
WP_006025689.1|1302709_1303330_-	hypothetical protein	NA	Q6QIC6	Burkholderia_phage	32.3	7.2e-07
WP_006025690.1|1303310_1303556_-	hypothetical protein	NA	A0A0M4UKB4	Ralstonia_phage	44.3	1.2e-10
WP_006025691.1|1303574_1304096_-	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	53.4	2.1e-36
WP_006025692.1|1304235_1304670_-|transposase	transposase	transposase	A0A0A1IWZ1	Pseudomonas_phage	40.7	5.2e-20
WP_006025693.1|1304666_1305077_-	regulatory protein GemA	NA	A0A0M5MRZ7	Ralstonia_phage	44.5	1.7e-25
WP_006025694.1|1305143_1305842_-	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	37.8	1.2e-31
WP_006025695.1|1305854_1306115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006025696.1|1306117_1306735_-	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	53.5	6.6e-61
WP_009916815.1|1306768_1307074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009916814.1|1307070_1307508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009916813.1|1307519_1307837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009916811.1|1307891_1308197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006025700.1|1308196_1308556_-	hypothetical protein	NA	NA	NA	NA	NA
1308506:1308522	attL	CATCAGGCCGTTCACGA	NA	NA	NA	NA
WP_006025701.1|1308548_1309184_-	hypothetical protein	NA	L7P7I3	Pseudomonas_phage	36.8	1.3e-24
WP_006025702.1|1309173_1309476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099975908.1|1309475_1310108_-	ATP-binding protein	NA	A0A0M4UT94	Ralstonia_phage	66.9	9.5e-55
WP_009916808.1|1310253_1312512_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M4U788	Ralstonia_phage	59.0	9.9e-147
WP_006025705.1|1312511_1312985_-	hypothetical protein	NA	A0A0M3VI79	Ralstonia_phage	58.7	5.4e-47
WP_080595004.1|1313028_1313385_-	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	61.1	1.3e-24
WP_059213559.1|1313576_1314029_+	helix-turn-helix transcriptional regulator	NA	Q5ZQZ8	Pseudomonas_phage	43.8	6.4e-05
WP_009916804.1|1314042_1314681_+	hypothetical protein	NA	A0A0M4UKA3	Ralstonia_phage	47.9	1.9e-31
1321407:1321423	attR	TCGTGAACGGCCTGATG	NA	NA	NA	NA
>prophage 4
NZ_CP009549	Burkholderia sp. 2002721687 chromosome I, complete sequence	4067533	1331086	1339519	4067533		Bacillus_phage(16.67%)	8	NA	NA
WP_006025719.1|1331086_1332487_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.2e-78
WP_015601685.1|1332518_1333442_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.5	5.7e-16
WP_006025721.1|1333500_1334493_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.6	1.0e-26
WP_006025722.1|1334564_1334882_+	competence protein ComE	NA	NA	NA	NA	NA
WP_009916396.1|1335220_1336123_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.2	2.3e-54
WP_006025724.1|1336218_1337454_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_006025725.1|1337632_1338556_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	2.4e-43
WP_080595006.1|1338676_1339519_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.1	3.2e-18
>prophage 5
NZ_CP009549	Burkholderia sp. 2002721687 chromosome I, complete sequence	4067533	2631282	2722326	4067533	integrase,head,transposase,terminase,tail,tRNA,coat	Ralstonia_phage(50.0%)	79	2655019:2655037	2719041:2719059
WP_006026452.1|2631282_2633907_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	1.9e-80
WP_045554854.1|2634145_2635261_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_043282559.1|2635640_2636861_+	CoA transferase	NA	NA	NA	NA	NA
WP_006026449.1|2637055_2637862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041861885.1|2638187_2638397_-	ornithine acetyltransferase	NA	NA	NA	NA	NA
WP_006026447.1|2638677_2640387_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.9	1.4e-185
WP_006026446.1|2640420_2640903_-	NUDIX hydrolase	NA	A0A0G2SS60	Proteus_phage	41.2	2.6e-20
WP_009912747.1|2640921_2641308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006026444.1|2641509_2643609_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_043282558.1|2643710_2644571_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_043282556.1|2644613_2645987_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_006026441.1|2646220_2647804_+	acid phosphatase	NA	NA	NA	NA	NA
WP_006026440.1|2647977_2649171_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_009912761.1|2649214_2649847_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_043282555.1|2649847_2651920_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.8	9.1e-30
WP_006026437.1|2652010_2652334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006026436.1|2652330_2653296_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_006026435.1|2653311_2655723_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
2655019:2655037	attL	GATCACGTCGCCTGCGGTG	NA	NA	NA	NA
WP_043282554.1|2655767_2656604_-	molecular chaperone	NA	NA	NA	NA	NA
WP_006026433.1|2656621_2657146_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_006026432.1|2657228_2657789_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_043282658.1|2657841_2658387_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009912775.1|2659187_2660081_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080595033.1|2660506_2661778_+	MFS transporter	NA	NA	NA	NA	NA
WP_006026428.1|2661831_2662758_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_009917351.1|2663250_2663532_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009917353.1|2663739_2664042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006026424.1|2664486_2665143_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_006026423.1|2665167_2666118_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	36.1	4.2e-06
WP_006026422.1|2666260_2667109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006026421.1|2667137_2668298_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_006026420.1|2668310_2669489_+	CoA transferase	NA	NA	NA	NA	NA
WP_006026418.1|2670869_2671709_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_006026417.1|2671784_2672051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006026416.1|2672282_2673596_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_156436722.1|2673953_2674502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156436723.1|2674513_2674879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006026414.1|2675467_2676946_+	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_009916596.1|2677041_2678598_-	MCE family protein	NA	NA	NA	NA	NA
WP_041861722.1|2678820_2679054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006026412.1|2679120_2679783_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_006026411.1|2680019_2680601_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006026410.1|2680779_2681115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009916599.1|2681717_2682056_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009916600.1|2682348_2683635_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	71.7	4.3e-171
WP_006026409.1|2683767_2684673_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	76.4	2.3e-131
WP_006026408.1|2685755_2686775_+|integrase	site-specific integrase	integrase	A0A0A1I5U0	Burkholderia_phage	38.0	1.6e-48
WP_006026407.1|2686831_2687851_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	48.1	4.9e-77
WP_009916602.1|2687969_2688305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009916603.1|2688301_2688757_-	lysozyme	NA	A0A1S6L191	Ralstonia_phage	52.6	5.6e-33
WP_006026405.1|2688756_2688975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006026404.1|2688978_2690775_-|terminase	phage terminase large subunit	terminase	A0A1L7DQE6	Ralstonia_phage	77.3	4.0e-276
WP_006026403.1|2690764_2691079_-	hypothetical protein	NA	A0A1S6L1A7	Ralstonia_phage	45.3	6.0e-10
WP_043282551.1|2691075_2691264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080595031.1|2691273_2691678_-	hypothetical protein	NA	A0A1S5NV54	Burkholderia_phage	33.8	8.8e-14
WP_006026402.1|2691677_2693243_-	hypothetical protein	NA	A0A1S6L1B3	Ralstonia_phage	50.0	5.2e-38
WP_006026401.1|2693323_2698225_-	transglycosylase SLT domain-containing protein	NA	A0A1L7DQA5	Ralstonia_phage	37.0	4.8e-239
WP_006026400.1|2698292_2700398_-	hypothetical protein	NA	A0A0A1I5M8	Burkholderia_phage	33.1	3.7e-79
WP_009916605.1|2700587_2701493_-	hypothetical protein	NA	B5BTX1	Ralstonia_phage	37.3	7.3e-16
WP_009916606.1|2701492_2704054_-	hypothetical protein	NA	A0A0A1I627	Burkholderia_phage	50.8	2.7e-249
WP_080595030.1|2704053_2704665_-|tail	phage tail protein	tail	A0A0A1I5V9	Burkholderia_phage	47.3	6.3e-48
WP_006026396.1|2704723_2705737_-	hypothetical protein	NA	A0A1L7DQF3	Ralstonia_phage	70.2	9.0e-132
WP_009916609.1|2705877_2706732_-	hypothetical protein	NA	A0A0A1I5M7	Burkholderia_phage	52.0	4.0e-48
WP_009916610.1|2706738_2708298_-|head,tail	head-tail joining protein	head,tail	A0A1L7DQD6	Ralstonia_phage	63.3	2.4e-176
WP_009916611.1|2708297_2708741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009916612.1|2708750_2709353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006026391.1|2709353_2709785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009916614.1|2709792_2709963_-	hypothetical protein	NA	A0A1S6L1E2	Ralstonia_phage	56.9	2.1e-09
WP_006026390.1|2710039_2712496_-	DNA-directed RNA polymerase	NA	A0A0A8KWP2	Burkholderia_phage	57.5	1.0e-274
WP_006026389.1|2712495_2713419_-	hypothetical protein	NA	A0A0A1I650	Burkholderia_phage	46.4	1.9e-67
WP_009916616.1|2713432_2714143_-	hypothetical protein	NA	A0A0A1I625	Burkholderia_phage	44.0	4.2e-35
WP_006026387.1|2714135_2714363_-	hypothetical protein	NA	A0A1S6L1D4	Ralstonia_phage	57.0	2.6e-15
WP_009916617.1|2714362_2715565_-	hypothetical protein	NA	F1ADQ5	Caulobacter_phage	56.3	2.5e-120
WP_009916618.1|2715564_2715966_-	hypothetical protein	NA	A0A1L7DQG2	Ralstonia_phage	48.0	1.3e-17
WP_009916619.1|2715943_2716891_-	hypothetical protein	NA	A0A1L7DQH5	Ralstonia_phage	53.2	3.1e-78
WP_144411943.1|2716890_2717811_-	hypothetical protein	NA	A0A1L7DQE1	Ralstonia_phage	55.0	5.2e-70
WP_099975903.1|2717822_2720270_-	DNA polymerase A family protein	NA	A0A1L7DQB7	Ralstonia_phage	63.0	7.2e-284
2719041:2719059	attR	GATCACGTCGCCTGCGGTG	NA	NA	NA	NA
WP_006026384.1|2720272_2721487_-	AAA family ATPase	NA	A0A1S6L1C9	Ralstonia_phage	65.0	1.8e-150
WP_009916623.1|2721519_2722326_-	DNA primase	NA	A0A1L7DQD5	Ralstonia_phage	47.8	3.7e-64
>prophage 6
NZ_CP009549	Burkholderia sp. 2002721687 chromosome I, complete sequence	4067533	2832374	2886039	4067533	integrase,transposase,tRNA,protease	Burkholderia_phage(20.0%)	34	2857600:2857623	2884487:2884510
WP_045554907.1|2832374_2833559_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	93.0	2.2e-214
WP_006026271.1|2833630_2833804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006026269.1|2834104_2836051_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_006026268.1|2836274_2836487_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_006026267.1|2836738_2836963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006026266.1|2837107_2838040_+	DMT family transporter	NA	NA	NA	NA	NA
WP_006026264.1|2838526_2839819_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_006026263.1|2840096_2840501_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_043282531.1|2840497_2843170_-	AAA family ATPase	NA	A0A1P8DII4	Virus_Rctr197k	36.3	8.2e-15
WP_006026261.1|2843166_2846979_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	29.4	4.7e-08
WP_006026260.1|2846975_2850320_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_006026259.1|2850582_2852877_+	membrane protein	NA	NA	NA	NA	NA
WP_009911841.1|2852873_2853065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006026258.1|2853061_2854426_+	amino acid permease	NA	NA	NA	NA	NA
WP_006026256.1|2854970_2856008_+	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006026255.1|2855997_2857674_+	iron ABC transporter permease	NA	NA	NA	NA	NA
2857600:2857623	attL	GCGCTCGCGATCGTCGTCGCGGGC	NA	NA	NA	NA
WP_006026254.1|2857684_2858455_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.5e-25
WP_009892050.1|2858493_2858961_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_006026252.1|2859105_2859735_+	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_006026251.1|2860222_2861140_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_009911821.1|2861201_2861843_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_009911820.1|2861981_2862443_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_006026248.1|2862532_2862988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009916732.1|2863308_2865249_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_080595023.1|2865914_2867300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158354529.1|2867301_2869023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006026245.1|2869094_2870636_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_043282527.1|2870645_2873069_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_080595022.1|2873099_2873927_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_144411946.1|2874203_2874800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006026243.1|2875130_2876408_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	49.4	2.5e-102
WP_009916975.1|2878243_2879278_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_006026240.1|2879788_2881297_-	Fic family protein	NA	NA	NA	NA	NA
WP_009916973.1|2884677_2886039_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
2884487:2884510	attR	GCCCGCGACGACGATCGCGAGCGC	NA	NA	NA	NA
>prophage 7
NZ_CP009549	Burkholderia sp. 2002721687 chromosome I, complete sequence	4067533	3392545	3403452	4067533	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_006024809.1|3392545_3394846_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.3e-167
WP_006024808.1|3394842_3395157_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	45.8	1.2e-13
WP_004196460.1|3395686_3395890_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_043282172.1|3396013_3397612_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_006024806.1|3397782_3399042_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	8.9e-12
WP_006024805.1|3399306_3399885_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_080594897.1|3400145_3400361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043282056.1|3400553_3401063_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	40.2	3.2e-13
WP_006024803.1|3401337_3403452_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.5	1.5e-56
>prophage 1
NZ_CP009548	Burkholderia sp. 2002721687 chromosome II, complete sequence	2913181	624712	696279	2913181	holin,transposase,plate	Cronobacter_phage(12.5%)	52	NA	NA
WP_009914155.1|624712_625804_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_006029722.1|625803_627693_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009914154.1|627722_628304_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_006029724.1|628290_628641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006029725.1|628637_629231_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_006029726.1|629763_632475_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.3	4.6e-82
WP_006029727.1|632508_633090_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006029728.1|633123_634623_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006029729.1|634739_635225_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_043283389.1|635320_635824_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_006029731.1|635845_637192_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_080595283.1|637265_638591_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_045554707.1|638620_642685_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_006029735.1|642794_643073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006029736.1|643464_645381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043283392.1|646018_646759_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006029739.1|646852_647740_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006029740.1|647838_649086_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_009914138.1|649149_650049_+	glutamate/aspartate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006029742.1|650108_650549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043283391.1|652085_652922_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_006029745.1|653027_653858_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045554708.1|654216_656997_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.8	4.1e-25
WP_045554709.1|657034_658987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080595190.1|659061_660024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080595167.1|660035_660323_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_099975874.1|660674_661430_+	MFS transporter	NA	NA	NA	NA	NA
WP_006028471.1|661667_662990_+|transposase	IS5-like element ISButh4 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	51.4	6.4e-61
WP_006028470.1|663127_664276_+	porin	NA	NA	NA	NA	NA
WP_009914131.1|664442_664676_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_009914130.1|664942_667588_+	amylase	NA	NA	NA	NA	NA
WP_043282980.1|667587_667941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006028466.1|668344_669595_+	ROK family protein	NA	NA	NA	NA	NA
WP_009914123.1|669581_671135_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.2e-13
WP_015603444.1|671177_672212_+	branched-chain amino acid transport system / permease component family protein	NA	NA	NA	NA	NA
WP_009914122.1|672288_673236_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006028462.1|673336_674716_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	31.9	3.6e-59
WP_006028461.1|675101_676490_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.1	4.7e-14
WP_009914120.1|676604_677630_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_006028459.1|677730_678126_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_015603421.1|678150_679128_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_043282978.1|679167_681975_-	non-ribosomal peptide synthetase	NA	NA	NA	NA	NA
WP_156436732.1|681989_682262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006028456.1|682803_684012_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_006028455.1|684124_685579_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_043282976.1|685671_686838_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.1	4.5e-42
WP_006028453.1|686919_688245_-	MFS transporter	NA	NA	NA	NA	NA
WP_006028452.1|688506_690900_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	26.7	2.3e-29
WP_144411857.1|691894_692671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009917547.1|692976_693303_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_006028448.1|693336_693756_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_006028447.1|694083_696279_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
>prophage 2
NZ_CP009548	Burkholderia sp. 2002721687 chromosome II, complete sequence	2913181	1336102	1347200	2913181		Burkholderia_phage(44.44%)	14	NA	NA
WP_006027894.1|1336102_1337866_-	DNA methyltransferase	NA	A9YX21	Burkholderia_phage	91.8	7.2e-185
WP_006027893.1|1337862_1338873_-	RNA-directed DNA polymerase	NA	H7BVN7	unidentified_phage	36.4	1.6e-40
WP_009916876.1|1339195_1339570_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_006027891.1|1339584_1340049_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_006027890.1|1340079_1340442_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_006027889.1|1340531_1341155_-	hypothetical protein	NA	A9YX18	Burkholderia_phage	90.6	2.4e-18
WP_006027888.1|1341151_1342918_-	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	37.0	7.9e-75
WP_009916878.1|1342914_1343799_-	cell division protein FtsK	NA	J7I0T4	Pseudomonas_phage	35.6	3.1e-35
WP_009916879.1|1343829_1345110_-	hypothetical protein	NA	A0A2I7RZ22	Vibrio_phage	34.2	5.3e-20
WP_043282918.1|1345125_1345935_-	hypothetical protein	NA	J7HXJ4	Pseudomonas_phage	59.8	1.5e-89
WP_006027884.1|1345931_1346228_-	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	80.8	7.6e-39
WP_009916881.1|1346500_1346668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006027881.1|1346664_1347021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006027880.1|1347017_1347200_-	hypothetical protein	NA	A9YWW6	Burkholderia_phage	73.0	1.9e-08
>prophage 3
NZ_CP009548	Burkholderia sp. 2002721687 chromosome II, complete sequence	2913181	1350372	1388926	2913181	terminase,capsid	Burkholderia_phage(75.0%)	54	NA	NA
WP_009916889.1|1350372_1350717_-	helix-turn-helix domain-containing protein	NA	A9YWX7	Burkholderia_phage	84.3	1.5e-46
WP_009916890.1|1350801_1351056_+	transcriptional regulator	NA	A9YWX8	Burkholderia_phage	86.2	3.3e-35
WP_156436744.1|1351052_1351505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009916891.1|1351813_1352188_+	hypothetical protein	NA	A9YWX9	Burkholderia_phage	87.9	1.9e-58
WP_006027870.1|1352184_1352406_+	hypothetical protein	NA	A9YWY0	Burkholderia_phage	83.8	3.1e-29
WP_006027869.1|1352459_1352624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006027868.1|1352620_1352890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009916892.1|1352886_1353747_+	hypothetical protein	NA	A9YWY3	Burkholderia_phage	51.9	2.8e-73
WP_006027866.1|1353743_1354220_+	hypothetical protein	NA	Q6JIG5	Burkholderia_virus	77.7	1.7e-64
WP_043282916.1|1354260_1355247_+	YdaU family protein	NA	NA	NA	NA	NA
WP_009917271.1|1355243_1355477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006027863.1|1355473_1355734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006027861.1|1355903_1356374_+	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	75.6	9.1e-63
WP_006027860.1|1356408_1356588_+	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	79.6	6.0e-15
WP_006027859.1|1356597_1356927_+	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	66.7	1.4e-25
WP_006027858.1|1356923_1357517_+	hypothetical protein	NA	A9YWZ1	Burkholderia_phage	94.7	2.5e-102
WP_006027857.1|1358038_1358704_+	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	90.5	1.3e-118
WP_006027856.1|1358722_1359202_+	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	77.0	6.5e-56
WP_009917273.1|1359152_1360706_+|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	45.4	3.2e-112
WP_006027854.1|1360726_1362196_+	DUF1073 domain-containing protein	NA	A9YWZ7	Burkholderia_phage	94.2	3.2e-263
WP_006027853.1|1362192_1362948_+|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	96.8	1.2e-133
WP_006027852.1|1362949_1363234_+	hypothetical protein	NA	A9YWZ9	Burkholderia_phage	92.6	8.3e-51
WP_006027851.1|1363414_1364872_+	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	85.4	3.9e-205
WP_009917274.1|1364881_1365388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009917275.1|1365457_1366549_+	DUF2184 domain-containing protein	NA	A9YX23	Burkholderia_phage	96.0	4.3e-156
WP_043282997.1|1366559_1367027_+	hypothetical protein	NA	A9YX24	Burkholderia_phage	84.5	7.5e-25
WP_009917276.1|1367090_1367474_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	98.4	1.4e-64
WP_006027846.1|1367502_1367982_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	96.2	1.6e-78
WP_009917277.1|1368043_1368415_+	hypothetical protein	NA	A9YX28	Burkholderia_phage	92.7	2.1e-62
WP_006027844.1|1368419_1369010_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	93.4	4.3e-102
WP_006027843.1|1369019_1370495_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	48.3	2.6e-111
WP_006027842.1|1370510_1370951_+	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	58.9	1.1e-41
WP_006027841.1|1370953_1371514_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	35.7	1.1e-17
WP_006027840.1|1371697_1373824_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	36.6	1.5e-40
WP_006027839.1|1373820_1374396_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	39.2	9.6e-22
WP_006027838.1|1374395_1374713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006027837.1|1374709_1375678_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	89.0	2.3e-145
WP_006027836.1|1375674_1376046_-	hypothetical protein	NA	A9YX05	Burkholderia_phage	90.2	1.2e-57
WP_043282915.1|1376056_1376809_+	phage protein	NA	A9YX06	Burkholderia_phage	91.2	1.8e-121
WP_006027834.1|1376817_1377171_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	95.7	5.6e-57
WP_006027833.1|1377167_1378349_+	hypothetical protein	NA	A9YX12	Burkholderia_phage	93.4	2.0e-199
WP_006027832.1|1378348_1379011_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	92.3	4.1e-117
WP_144411866.1|1379075_1380929_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	57.8	1.5e-71
WP_043282914.1|1380925_1381108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080595168.1|1381108_1381879_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_006027829.1|1381998_1382271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004532301.1|1382440_1382623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043282913.1|1382615_1383113_+	lysozyme	NA	Q3HQU9	Burkholderia_phage	93.9	1.2e-84
WP_006027827.1|1383109_1383658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006027826.1|1383654_1384131_+	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	80.6	3.8e-56
WP_009917287.1|1384166_1384364_+	hypothetical protein	NA	Q3HQV3	Burkholderia_phage	73.8	2.3e-23
WP_006027825.1|1384712_1384997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006027824.1|1385394_1386144_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	9.6e-22
WP_006027823.1|1386145_1388926_+	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	31.8	1.1e-70
>prophage 4
NZ_CP009548	Burkholderia sp. 2002721687 chromosome II, complete sequence	2913181	1571550	1659138	2913181	holin,transposase,plate	Stx2-converting_phage(25.0%)	53	NA	NA
WP_085954781.1|1571550_1572367_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	5.0e-08
WP_009917387.1|1573277_1573682_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_043283433.1|1573678_1573969_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	68.8	3.0e-32
WP_006029858.1|1575464_1575680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043283419.1|1575676_1576477_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	37.4	7.3e-36
WP_043283420.1|1576436_1577966_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.7	2.4e-27
WP_043283410.1|1578735_1579443_-	response regulator	NA	NA	NA	NA	NA
WP_144411869.1|1579636_1582279_-	response regulator	NA	A0A1V0SGX0	Hokovirus	38.4	7.5e-37
WP_006029833.1|1584738_1586355_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_099975922.1|1587952_1589899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006029831.1|1590103_1594726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006029830.1|1594756_1597645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144411870.1|1597746_1600962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144411871.1|1600982_1603010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006029827.1|1603615_1605307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009917408.1|1605908_1607327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009917406.1|1607626_1608088_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_043283406.1|1608845_1609880_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_043283433.1|1610722_1611013_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	68.8	3.0e-32
WP_009917387.1|1611009_1611414_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_006029793.1|1612261_1614724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045554727.1|1614879_1616109_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	48.9	5.8e-101
WP_144411872.1|1616161_1617820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045554788.1|1618095_1620003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006029789.1|1621867_1622965_-	chitin-binding protein	NA	Q0N444	Clanis_bilineata_nucleopolyhedrovirus	33.3	1.5e-23
WP_006029788.1|1623404_1623896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006029787.1|1623966_1624590_-	nitroreductase	NA	NA	NA	NA	NA
WP_144411873.1|1624579_1625206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015603545.1|1625228_1626644_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_009914420.1|1626736_1627678_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_006029784.1|1627686_1628652_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_006029783.1|1628765_1632182_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_045554729.1|1632413_1635065_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_015603888.1|1635055_1636084_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_009914430.1|1636032_1637613_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_009914432.1|1637718_1638924_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_006029778.1|1639080_1639812_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_009914434.1|1639808_1640621_-	DinB family protein	NA	NA	NA	NA	NA
WP_009914437.1|1641340_1642414_-	FUSC family protein	NA	NA	NA	NA	NA
WP_006029774.1|1642664_1643732_-	2-aminoethylphosphonate aminotransferase	NA	NA	NA	NA	NA
WP_006029773.1|1643746_1644928_-	phosphonopyruvate decarboxylase	NA	NA	NA	NA	NA
WP_006029772.1|1644924_1646613_-	phosphoenolpyruvate mutase	NA	NA	NA	NA	NA
WP_006029771.1|1646609_1647377_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_006029770.1|1647418_1648420_-	HpnL family protein	NA	NA	NA	NA	NA
WP_009914447.1|1648416_1649190_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_006029768.1|1649186_1649876_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_006029767.1|1650239_1651754_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_006029766.1|1653067_1653994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009914448.1|1654027_1654579_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006029764.1|1654581_1656084_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|1656227_1656755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006029763.1|1656833_1657265_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_006029762.1|1657278_1659138_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP009548	Burkholderia sp. 2002721687 chromosome II, complete sequence	2913181	2255350	2324247	2913181	capsid,transposase,portal,holin,head,tail,protease,terminase,plate	Burkholderia_virus(52.17%)	66	NA	NA
WP_043282853.1|2255350_2256760_+	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	37.9	8.6e-64
WP_045554745.1|2258659_2258866_+	DNA methyltransferase	NA	A4JWW1	Burkholderia_virus	97.1	1.4e-31
WP_006027269.1|2258865_2260665_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	91.3	0.0e+00
WP_006027268.1|2260680_2260947_+	ogr/Delta-like zinc finger family protein	NA	A4JWV9	Burkholderia_virus	96.5	2.3e-42
WP_006027267.1|2260943_2261150_+	ogr/Delta-like zinc finger family protein	NA	A4JWV8	Burkholderia_virus	98.5	5.6e-33
WP_009914986.1|2261239_2261893_+	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	100.0	5.4e-114
WP_009914987.1|2262126_2262249_+	hypothetical protein	NA	A4JWV6	Burkholderia_virus	97.5	5.0e-13
WP_006027265.1|2262351_2262885_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	97.7	7.9e-95
WP_006027264.1|2262881_2263646_+	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	96.1	7.8e-128
WP_075644823.1|2263626_2264748_+	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	97.9	5.5e-215
WP_006027262.1|2265412_2265709_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	99.0	5.6e-50
WP_004202809.1|2265711_2266068_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_006027261.1|2266111_2267167_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	98.3	7.0e-204
WP_006027260.1|2267163_2268933_-|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	97.3	0.0e+00
WP_006027259.1|2269076_2269886_+|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	95.9	2.6e-142
WP_006027258.1|2269930_2270941_+|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	93.5	4.1e-177
WP_006027257.1|2270937_2271627_+|terminase	terminase endonuclease subunit	terminase	A4JWP8	Burkholderia_virus	95.6	1.7e-113
WP_006027256.1|2271726_2272206_+|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	96.9	2.7e-78
WP_009914992.1|2272205_2272457_+	hypothetical protein	NA	K4NXI9	Burkholderia_phage	96.4	4.9e-39
WP_004524438.1|2272453_2272660_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	100.0	2.4e-31
WP_004553021.1|2272674_2273019_+	membrane protein	NA	K4NZQ3	Burkholderia_phage	99.1	6.5e-50
WP_004524440.1|2273020_2273293_+|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_006027254.1|2273289_2274102_+	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	97.8	2.5e-148
WP_009914993.1|2274098_2274539_+	hypothetical protein	NA	K4NXJ2	Burkholderia_phage	97.3	2.7e-69
WP_006027252.1|2274643_2275060_+|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	99.3	1.6e-71
WP_006027251.1|2275056_2275524_+	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	97.4	2.5e-76
WP_043282852.1|2276118_2276880_-	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	94.8	4.4e-139
WP_006027249.1|2277053_2277734_+|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	95.1	1.9e-117
WP_043282752.1|2277730_2278093_+|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	95.0	3.6e-59
WP_080595128.1|2278588_2278993_+|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	97.0	3.8e-65
WP_043282751.1|2278985_2279540_+|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	96.2	3.3e-96
WP_006027245.1|2279550_2281914_+	hypothetical protein	NA	Q45YG3	Burkholderia_virus	89.7	0.0e+00
WP_006027244.1|2281930_2282602_+|tail	tail assembly chaperone	tail	A4JWS8	Burkholderia_virus	97.3	5.6e-106
WP_006027243.1|2282657_2283830_+|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	98.2	1.3e-219
WP_014696837.1|2283845_2284355_+|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	98.8	3.2e-93
WP_004531064.1|2284412_2284757_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	100.0	1.0e-55
WP_009914998.1|2284765_2284882_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	86.8	8.3e-10
WP_006027241.1|2284884_2287764_+	hypothetical protein	NA	A4JWS3	Burkholderia_virus	77.1	0.0e+00
WP_009914999.1|2287781_2288207_+|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	100.0	3.3e-72
WP_009915000.1|2288206_2289307_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	97.5	1.6e-198
WP_006027238.1|2289379_2289598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009915001.1|2289678_2289999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045554746.1|2291250_2292573_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	51.0	8.3e-61
WP_009915007.1|2293011_2293494_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_006027235.1|2294209_2294407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006027234.1|2294595_2294925_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_006027233.1|2294938_2295454_-	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_006027232.1|2295749_2296514_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_006027231.1|2296845_2297418_+	DUF2760 domain-containing protein	NA	NA	NA	NA	NA
WP_006027230.1|2297414_2299262_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_006027229.1|2299265_2302091_+	hsp70 family protein	NA	A0A2H4UU19	Bodo_saltans_virus	24.8	4.7e-05
WP_009915016.1|2302240_2303470_-	hypothetical protein	NA	S4VS02	Pandoravirus	54.6	1.6e-111
WP_009915017.1|2303612_2303867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006027226.1|2304594_2307108_-	cation-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	28.5	2.8e-57
WP_041861909.1|2308250_2309096_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_043282847.1|2309166_2310609_-	thiamine pyridinylase	NA	NA	NA	NA	NA
WP_006027222.1|2310674_2311475_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_006027221.1|2313127_2313868_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006027220.1|2313883_2314873_-	thymidylate synthase	NA	NA	NA	NA	NA
WP_006027219.1|2314874_2315330_-	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_006027218.1|2315326_2315818_-	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	42.9	3.3e-15
WP_009915029.1|2316558_2317197_-	LysE family translocator	NA	NA	NA	NA	NA
WP_144411889.1|2319528_2319873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006027214.1|2319904_2321395_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_006027213.1|2321580_2322186_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_009915032.1|2322264_2324247_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	45.7	1.1e-104
>prophage 6
NZ_CP009548	Burkholderia sp. 2002721687 chromosome II, complete sequence	2913181	2600497	2648815	2913181	holin,tail,plate	Catovirus(16.67%)	39	NA	NA
WP_006028749.1|2600497_2602195_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	29.3	1.3e-50
WP_006028750.1|2603170_2606542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043283131.1|2606727_2608155_+	MFS transporter	NA	NA	NA	NA	NA
WP_006028752.1|2608218_2609697_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_006028753.1|2609693_2610146_-	response regulator	NA	NA	NA	NA	NA
WP_043283174.1|2610171_2612322_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	25.6	2.2e-18
WP_006028755.1|2612796_2613282_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_006028756.1|2613321_2614254_-	2-hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	33.6	1.7e-20
WP_006028757.1|2614365_2614626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015603514.1|2615497_2616133_-	sarcosine oxidase gamma subunit	NA	NA	NA	NA	NA
WP_006028760.1|2616122_2619131_-	sarcosine oxidase subunit alpha family protein	NA	NA	NA	NA	NA
WP_009915278.1|2619127_2619421_-	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_009915279.1|2619601_2620846_-	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_006028763.1|2620862_2622248_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_006028764.1|2622537_2623683_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_006028765.1|2623694_2623880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009915280.1|2623958_2624660_-	YceH family protein	NA	NA	NA	NA	NA
WP_009915282.1|2624844_2625582_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_006028768.1|2626283_2627291_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_006028769.1|2627620_2627890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006028770.1|2628104_2628494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009915283.1|2628516_2629998_+|tail	phage tail sheath family protein	tail	A0A1J0GW47	Streptomyces_phage	30.4	3.3e-34
WP_006028772.1|2630031_2630556_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_043283141.1|2630599_2631337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144411903.1|2631336_2632167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045554756.1|2632163_2633513_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_006028777.1|2633509_2635438_+	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	34.3	8.2e-09
WP_006028778.1|2635434_2635866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052687557.1|2635862_2637125_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_156436738.1|2637121_2637295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006028781.1|2637291_2640096_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_006028782.1|2640092_2640752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006028783.1|2640849_2641200_+|plate	baseplate wedge protein 53	plate	NA	NA	NA	NA
WP_006028784.1|2641213_2642338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006028785.1|2642334_2642847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015602894.1|2642849_2643167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006028787.1|2643177_2643546_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_043283147.1|2643542_2646077_+|plate	putative baseplate assembly protein	plate	A0A1Q1PVP2	Phage_DP-2017a	21.0	2.9e-09
WP_043283148.1|2646073_2648815_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
>prophage 7
NZ_CP009548	Burkholderia sp. 2002721687 chromosome II, complete sequence	2913181	2744820	2808138	2913181	transposase,integrase,plate	Ralstonia_phage(60.0%)	57	2745042:2745058	2811629:2811645
WP_006028869.1|2744820_2745291_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
2745042:2745058	attL	CACGAATCTCGCGGGCG	NA	NA	NA	NA
WP_006028870.1|2745319_2747071_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_043283161.1|2747058_2748081_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_006028872.1|2748067_2750896_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.9	1.1e-83
WP_006028873.1|2750923_2753908_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.5	3.5e-22
WP_006028874.1|2753933_2756597_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_006028875.1|2756614_2757679_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_043283179.1|2757675_2758428_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_006028877.1|2758455_2758848_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_006028878.1|2758857_2759634_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_043283162.1|2759666_2761064_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_006028880.1|2761060_2761747_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_043283181.1|2761758_2765622_+	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_006028882.1|2765801_2766944_+	peptidase	NA	NA	NA	NA	NA
WP_006028883.1|2766934_2767990_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_006028884.1|2768142_2768586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006028885.1|2768703_2769348_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_006028886.1|2769622_2770075_-	chaperone SicP	NA	NA	NA	NA	NA
WP_006028887.1|2770071_2771625_-	autophagy evasion T3SS effector BopA	NA	NA	NA	NA	NA
WP_009915423.1|2772017_2772803_+	type III secretion system protein	NA	NA	NA	NA	NA
WP_006028889.1|2773176_2773731_-	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	39.9	5.2e-17
WP_006028890.1|2773727_2774009_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_006028891.1|2774005_2776315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006028892.1|2776428_2777364_-	type III secretion system needle tip protein SctA	NA	NA	NA	NA	NA
WP_009915432.1|2777425_2777716_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_006028894.1|2777849_2779100_-	IpaC/SipC family type III secretion system effector	NA	NA	NA	NA	NA
WP_009915437.1|2779141_2781025_-	type III secretion system translocon subunit BipB	NA	NA	NA	NA	NA
WP_006028896.1|2781095_2781611_-	type III secretion system translocator chaperone SicA	NA	NA	NA	NA	NA
WP_006028897.1|2781736_2782837_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_006028898.1|2782840_2783611_-	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_004187417.1|2783629_2783884_-	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_006028899.1|2783917_2784607_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_006028900.1|2784596_2785571_-	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_006028901.1|2785567_2786809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006028902.1|2786786_2787251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006028903.1|2787247_2788576_-	FliI/YscN family ATPase	NA	NA	NA	NA	NA
WP_009915457.1|2788572_2788980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006028905.1|2788991_2791064_-	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_006028906.1|2791066_2792242_-	type III secretion system gatekeeper subunit SctW	NA	NA	NA	NA	NA
WP_006028907.1|2792238_2794122_-	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_041862113.1|2794135_2794801_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009915465.1|2795287_2796565_+	PrgH/EprH family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_009915466.1|2796561_2796831_+	EscF/YscF/HrpA family type III secretion system needle major subunit	NA	NA	NA	NA	NA
WP_006028911.1|2796890_2797193_+	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_006028912.1|2797197_2798100_+	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_006028913.1|2798096_2798684_+	type III secretion apparatus protein OrgA/MxiK	NA	NA	NA	NA	NA
WP_006028914.1|2798652_2799327_+	type III secretion system stator protein SctL	NA	NA	NA	NA	NA
WP_043283163.1|2799289_2799490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043283164.1|2800060_2800972_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_006028917.1|2800986_2801424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009915478.1|2801405_2801654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144411896.1|2801680_2801917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009915479.1|2802109_2803807_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_085954773.1|2804070_2804682_+	MFS transporter	NA	NA	NA	NA	NA
WP_043283165.1|2804824_2806138_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	23.5	5.1e-10
WP_045554808.1|2806130_2807000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009917513.1|2807100_2808138_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	63.7	1.6e-128
2811629:2811645	attR	CGCCCGCGAGATTCGTG	NA	NA	NA	NA
>prophage 1
NZ_CP009547	Burkholderia sp. 2002721687 plasmid pBTU, complete sequence	305110	110031	207220	305110	transposase	Tupanvirus(33.33%)	50	NA	NA
WP_006029260.1|110031_110454_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_009917397.1|112211_113057_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_006029264.1|113295_114534_-	MFS transporter	NA	NA	NA	NA	NA
WP_006029265.1|114589_115465_-	thioesterase	NA	NA	NA	NA	NA
WP_006029266.1|115445_116291_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006029267.1|116295_117888_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_006029268.1|117900_120369_-	peptide synthase	NA	D0R7J2	Paenibacillus_phage	35.6	1.3e-38
WP_009915096.1|120349_123826_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.4	3.2e-51
WP_006029270.1|123865_127855_-	SDR family oxidoreductase	NA	D0R7J2	Paenibacillus_phage	39.8	7.3e-52
WP_009915097.1|127847_132440_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_043283262.1|132447_137040_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.2	1.4e-67
WP_006029273.1|137381_139304_+	M3 family metallopeptidase	NA	A0A1V0SID3	Klosneuvirus	24.1	5.8e-39
WP_009915100.1|139857_140568_+	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	28.4	4.7e-18
WP_006029275.1|140684_141542_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_043283265.1|141592_142825_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_043283296.1|143455_143863_+	DUF4902 domain-containing protein	NA	NA	NA	NA	NA
WP_006029278.1|143945_144566_+	N-acylhomoserine lactone synthase	NA	NA	NA	NA	NA
WP_006029279.1|144634_146152_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.8	3.9e-46
WP_045554675.1|146268_147288_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_006029280.1|147577_147823_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_004528420.1|147988_148912_+	chlorinating enzyme	NA	NA	NA	NA	NA
WP_009915110.1|149002_149299_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_080595245.1|150133_150382_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_009917079.1|150368_150782_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_045554676.1|151179_152733_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	54.8	3.1e-155
WP_045554677.1|152763_153108_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	69.6	2.7e-40
WP_063840029.1|153104_153509_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	44.8	4.2e-16
WP_051990355.1|154076_155471_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_006029673.1|155467_156376_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_009917210.1|156372_157245_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_006029672.1|157252_158092_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006029671.1|158188_158992_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	2.6e-33
WP_006029670.1|158988_159882_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_006029669.1|159875_161309_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_009917209.1|161435_162314_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006029667.1|162360_163494_-	porin	NA	NA	NA	NA	NA
WP_043283425.1|165430_166654_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	31.1	6.7e-49
WP_045554678.1|167839_168640_-	thioesterase	NA	NA	NA	NA	NA
WP_043283376.1|168636_169551_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006029660.1|169618_170524_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009916649.1|170580_171546_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_006029658.1|171542_172715_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_099975905.1|172711_178483_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.0	3.2e-64
WP_082262297.1|178479_187725_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	19.5	1.3e-56
WP_043283373.1|187721_191285_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	30.8	5.0e-28
WP_006029652.1|191281_195946_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006029651.1|195972_200949_-	non-ribosomal peptide synthase	NA	A0A2K9L3I8	Tupanvirus	27.6	9.5e-41
WP_009916311.1|202762_203575_+	helix-turn-helix transcriptional regulator	NA	A0A291LAM3	Bordetella_phage	38.0	2.6e-12
WP_085954782.1|205054_205865_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_043283425.1|205996_207220_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	31.1	6.7e-49
