The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009488	Burkholderia ubonensis MSMB22 chromosome I, complete sequence	3546310	928166	936844	3546310		Escherichia_phage(33.33%)	8	NA	NA
WP_045566553.1|928166_929612_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.2	2.6e-52
WP_045566554.1|929864_930761_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-27
WP_045566555.1|930757_931309_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.9	2.0e-48
WP_045566556.1|931293_932187_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.1	3.7e-97
WP_045566557.1|932198_933260_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	47.7	2.1e-86
WP_045566558.1|933753_935106_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_045566559.1|935102_935726_+	acetyltransferase	NA	NA	NA	NA	NA
WP_045566560.1|935740_936844_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	33.7	1.2e-44
>prophage 2
NZ_CP009488	Burkholderia ubonensis MSMB22 chromosome I, complete sequence	3546310	1045901	1058910	3546310		Bodo_saltans_virus(12.5%)	11	NA	NA
WP_063889959.1|1045901_1047092_+	Tet(A)/Tet(B)/Tet(C) family tetracycline efflux MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	25.0	4.0e-06
WP_045566627.1|1047187_1048243_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.6	1.4e-71
WP_071733195.1|1048268_1049207_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_042583174.1|1049218_1049896_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_045566628.1|1049901_1051422_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.3	1.4e-24
WP_010091451.1|1051455_1052001_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_042583172.1|1051997_1052684_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	24.3	5.2e-06
WP_045566629.1|1052725_1053541_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	30.5	6.3e-35
WP_045566630.1|1053685_1055563_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	37.1	4.2e-58
WP_042583169.1|1055567_1056701_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.2	1.1e-24
WP_045566631.1|1056957_1058910_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	3.5e-148
>prophage 3
NZ_CP009488	Burkholderia ubonensis MSMB22 chromosome I, complete sequence	3546310	1371155	1419891	3546310	transposase,plate,integrase	uncultured_Caudovirales_phage(57.14%)	44	1414853:1414901	1419986:1420034
WP_042582990.1|1371155_1372256_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_042582989.1|1372219_1374055_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_042582988.1|1374120_1374606_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_010096526.1|1374668_1375172_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_042582987.1|1375240_1376731_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_045566761.1|1376746_1377274_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_045566762.1|1377317_1377959_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045566763.1|1378333_1378945_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_042582984.1|1379047_1380394_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_042582983.1|1380390_1381170_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_045566764.1|1381227_1381605_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_045567868.1|1381621_1382014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071733161.1|1382399_1382813_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_045566765.1|1382942_1383449_-	DUF4265 domain-containing protein	NA	A0A2H4JD65	uncultured_Caudovirales_phage	47.6	6.4e-38
WP_059705640.1|1383456_1384047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045566767.1|1384093_1384417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045566768.1|1384584_1386414_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.1	1.8e-13
WP_045566769.1|1387244_1387439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157376861.1|1387435_1387612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045566770.1|1387791_1388133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045567869.1|1388311_1388800_-	DUF4265 domain-containing protein	NA	NA	NA	NA	NA
WP_042582972.1|1388947_1389211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143135278.1|1389463_1389793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071733162.1|1390254_1390728_-	DUF4265 domain-containing protein	NA	NA	NA	NA	NA
WP_045566771.1|1396301_1399475_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.8	3.9e-56
WP_045566772.1|1399796_1400597_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_045566773.1|1400683_1400887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029226620.1|1401279_1401531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045566774.1|1401733_1402285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033355802.1|1402358_1402910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045566775.1|1402896_1404837_-	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	35.2	3.7e-09
WP_052686560.1|1404861_1405341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045566777.1|1405413_1408311_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.3	6.5e-50
WP_045566778.1|1409217_1409433_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045566779.1|1409774_1410599_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_042582963.1|1410714_1411578_+	beta-1,4-mannosyl-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	NA	A0A0P0YM34	Yellowstone_lake_phycodnavirus	30.3	6.5e-22
WP_080340773.1|1411721_1412951_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_088507991.1|1412956_1414081_+	heptosyltransferase	NA	NA	NA	NA	NA
WP_155016937.1|1414276_1414486_-	dioxygenase	NA	NA	NA	NA	NA
1414853:1414901	attL	CATTGGTGCCGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAAT	NA	NA	NA	NA
WP_045566781.1|1415304_1416171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157652714.1|1416170_1416314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157652715.1|1416889_1417339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045565817.1|1417483_1418686_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_045567872.1|1418853_1419891_-|integrase	tyrosine-type recombinase/integrase	integrase	W6MYA3	Pseudomonas_phage	37.1	2.9e-45
1419986:1420034	attR	CATTGGTGCCGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAAT	NA	NA	NA	NA
>prophage 4
NZ_CP009488	Burkholderia ubonensis MSMB22 chromosome I, complete sequence	3546310	1588082	1673371	3546310	transposase,holin,integrase,tail,plate	Burkholderia_phage(60.61%)	80	1629510:1629528	1681605:1681623
WP_010093000.1|1588082_1588436_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_045566844.1|1588583_1590002_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	2.6e-44
WP_045567881.1|1590435_1591446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045566845.1|1591445_1592072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010093004.1|1592111_1592846_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_042586791.1|1592868_1593684_-	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_045566846.1|1593676_1595440_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_042586789.1|1595436_1597539_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_045566847.1|1597535_1598735_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_045566849.1|1599360_1600617_-	DUF3443 domain-containing protein	NA	NA	NA	NA	NA
WP_045566850.1|1600631_1601135_-	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_010093013.1|1601362_1602097_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_029226639.1|1602098_1602494_-	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	2.1e-07
WP_010093015.1|1602560_1603637_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_042586783.1|1603654_1604446_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_045566851.1|1604442_1605408_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_045566852.1|1605411_1607316_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.8	9.6e-10
WP_010093021.1|1607352_1607868_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_045566853.1|1607915_1610147_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_010093024.1|1610180_1610558_-	response regulator	NA	NA	NA	NA	NA
WP_042586779.1|1610574_1611597_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_010093026.1|1611610_1612471_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_042586778.1|1612647_1613202_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_010093028.1|1613294_1613615_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_042586777.1|1614275_1615340_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_042586776.1|1615526_1615823_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_045566854.1|1616118_1616862_+	aquaporin Z	NA	NA	NA	NA	NA
WP_042586774.1|1617030_1617855_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_045566855.1|1618000_1618879_-	ATPase	NA	NA	NA	NA	NA
WP_042586772.1|1619023_1619626_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_006401410.1|1619712_1619925_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_045566856.1|1620489_1621308_+	flagellin	NA	NA	NA	NA	NA
WP_042586770.1|1621499_1622924_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_042586769.1|1622957_1623254_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_045566857.1|1623421_1625704_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045566858.1|1625700_1628190_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045566859.1|1628186_1630685_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
1629510:1629528	attL	GTCGACGTTGCCCTGCGCG	NA	NA	NA	NA
WP_045566860.1|1630699_1631905_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_080340738.1|1631901_1632882_-	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	46.2	5.2e-84
WP_045566861.1|1632839_1634627_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_042586764.1|1635030_1635816_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042586763.1|1635816_1637202_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_045566862.1|1637198_1637921_+	WbqC family protein	NA	NA	NA	NA	NA
WP_045566863.1|1638067_1639225_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	34.9	1.8e-19
WP_045567883.1|1639227_1642632_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_045567884.1|1642650_1642908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045567885.1|1643043_1644618_-	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_042586759.1|1645214_1645421_+|tail	tail protein X	tail	E5E3W5	Burkholderia_phage	72.1	1.1e-20
WP_010095861.1|1645436_1645781_+	membrane protein	NA	A4JWU2	Burkholderia_virus	79.6	6.7e-39
WP_045566864.1|1645782_1646049_+|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	66.3	1.6e-24
WP_045566865.1|1646052_1646883_+	N-acetylmuramidase family protein	NA	A4JWZ0	Burkholderia_virus	68.0	1.1e-95
WP_059813410.1|1646879_1647320_+	protein lysB	NA	K4NXJ2	Burkholderia_phage	45.2	6.0e-16
WP_045566867.1|1647436_1647892_+|tail	phage tail protein	tail	E5E3V9	Burkholderia_phage	56.5	8.1e-32
WP_045566868.1|1647888_1648800_+|plate	baseplate J/gp47 family protein	plate	E5FFH3	Burkholderia_phage	50.2	4.1e-75
WP_045566869.1|1648792_1649359_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	58.0	7.7e-40
WP_052686531.1|1649355_1650306_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	35.0	5.1e-36
WP_042586752.1|1651534_1652218_+|plate	phage baseplate assembly protein V	plate	E5E3V6	Burkholderia_phage	67.3	1.2e-76
WP_042586751.1|1652214_1652577_+	GPW/gp25 family protein	NA	K4PAX6	Burkholderia_phage	66.7	4.2e-39
WP_045566870.1|1652573_1653488_+|plate	baseplate J/gp47 family protein	plate	E5FFH3	Burkholderia_phage	74.6	3.1e-123
WP_045566871.1|1653480_1654023_+|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	70.9	8.1e-71
WP_045566873.1|1655430_1655892_+	hypothetical protein	NA	U3TK13	Ralstonia_phage	29.9	4.5e-06
WP_045566874.1|1655931_1657104_+|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	82.8	1.7e-187
WP_010095894.1|1657138_1657642_+|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	74.3	4.8e-70
WP_045566875.1|1657711_1658095_+|tail	phage tail assembly protein	tail	A4JWS5	Burkholderia_virus	64.8	6.0e-28
WP_010095898.1|1658103_1658217_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	81.1	1.8e-09
WP_045566876.1|1658232_1660785_+	hypothetical protein	NA	A4JWS3	Burkholderia_virus	47.5	1.9e-154
WP_045566877.1|1660814_1661270_+|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	62.8	3.1e-39
WP_045566878.1|1661266_1662346_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	72.4	3.9e-133
WP_042586742.1|1662477_1662774_-	hypothetical protein	NA	E5E3U3	Burkholderia_phage	51.6	4.2e-13
WP_124471127.1|1663143_1663599_-	helix-turn-helix transcriptional regulator	NA	E5E3U2	Burkholderia_phage	62.9	2.1e-43
WP_010095910.1|1663725_1663941_+	hypothetical protein	NA	E5E3U1	Burkholderia_phage	81.4	2.0e-20
WP_010095912.1|1664065_1664314_+	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	91.5	5.9e-37
WP_045566879.1|1664517_1664781_+	hypothetical protein	NA	E5E3N6	Burkholderia_phage	63.9	4.2e-17
WP_045566880.1|1664784_1667577_+	toprim domain-containing protein	NA	E5E3N5	Burkholderia_phage	92.4	0.0e+00
WP_071764486.1|1667573_1667933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080340739.1|1667942_1668392_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_045566881.1|1668259_1669336_+|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	84.3	3.0e-170
WP_042586738.1|1669715_1670597_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_045565817.1|1670852_1672055_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_045567889.1|1672345_1673371_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
1681605:1681623	attR	CGCGCAGGGCAACGTCGAC	NA	NA	NA	NA
>prophage 5
NZ_CP009488	Burkholderia ubonensis MSMB22 chromosome I, complete sequence	3546310	3017448	3124885	3546310	transposase,tRNA,protease,capsid,head,terminase,integrase,tail,portal,plate	uncultured_Caudovirales_phage(21.74%)	111	3015527:3015545	3080465:3080483
3015527:3015545	attL	CGGTTGCGCAGGGCGACGA	NA	NA	NA	NA
WP_045567501.1|3017448_3018975_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	35.2	4.7e-84
WP_143135230.1|3019058_3020163_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	35.5	3.7e-06
WP_045567503.1|3020296_3021994_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.9	7.9e-56
WP_045567504.1|3022003_3023083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010091965.1|3023219_3024473_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_042584366.1|3024531_3025227_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.2	1.0e-33
WP_042584365.1|3025304_3026093_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_045567505.1|3026150_3028625_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_045567506.1|3028709_3029540_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_045567507.1|3029679_3031341_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.2	1.3e-151
WP_010091972.1|3031337_3032192_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.9	4.0e-48
WP_006478406.1|3032296_3033580_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.4	3.8e-151
WP_042584362.1|3033661_3034096_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_045567977.1|3034188_3034536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042584361.1|3034640_3035591_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_045567508.1|3035616_3036141_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_088501203.1|3036336_3037191_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_042584359.1|3037320_3038211_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_042584358.1|3038306_3039137_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_045567509.1|3039210_3039843_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_045567510.1|3039897_3040560_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_010091982.1|3040568_3041771_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_045567511.1|3041767_3042379_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_045567512.1|3042425_3043331_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_045567513.1|3043441_3044587_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_045567514.1|3044591_3045368_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_162296965.1|3045461_3045644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045567515.1|3045966_3047190_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_042584350.1|3047222_3047765_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_045567516.1|3047744_3049022_-	membrane protein	NA	NA	NA	NA	NA
WP_059902055.1|3049002_3051615_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	1.3e-25
WP_045567518.1|3051849_3053151_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	59.1	2.2e-151
WP_071733872.1|3053101_3053344_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	61.6	9.3e-19
WP_157642547.1|3053352_3053718_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	65.0	8.8e-05
WP_045567520.1|3053710_3054070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045567979.1|3054171_3055524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045567521.1|3055523_3056123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045567522.1|3056119_3056476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045567523.1|3056527_3056746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157660973.1|3056873_3057332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080340754.1|3057279_3057831_-	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	37.4	9.5e-11
WP_045567527.1|3058203_3058761_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	47.1	7.1e-30
WP_045567528.1|3058762_3059146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045567529.1|3059304_3061803_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.2	7.2e-98
WP_045567980.1|3062018_3062792_+	zinc finger-like domain-containing protein	NA	NA	NA	NA	NA
WP_045567530.1|3063166_3063541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045567531.1|3063622_3063814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045567532.1|3064310_3066425_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	52.7	1.9e-179
WP_045567533.1|3066438_3066645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045567534.1|3066641_3068135_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	52.5	3.8e-139
WP_045567981.1|3068124_3069222_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	35.5	1.0e-48
WP_045567535.1|3069234_3069579_+|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	52.9	2.4e-20
WP_045567536.1|3069645_3070641_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	60.3	4.6e-112
WP_045567537.1|3070642_3070933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045567538.1|3070938_3071466_+|tail	phage tail protein	tail	D4HTU8	Vibrio_phage	29.8	7.0e-19
WP_045567539.1|3071458_3071986_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	37.9	2.3e-22
WP_045567540.1|3071982_3072663_+|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	29.8	3.4e-18
WP_045567541.1|3072727_3072934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045567542.1|3072930_3073275_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	51.9	2.5e-25
WP_045567543.1|3073271_3074165_+|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	38.1	3.2e-48
WP_045567544.1|3074154_3074721_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	48.9	2.6e-35
WP_052686550.1|3074717_3075803_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	43.9	6.4e-67
WP_045567545.1|3075816_3076272_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_045567546.1|3076352_3077522_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	74.0	1.5e-162
WP_045567547.1|3077532_3078036_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	49.4	2.3e-43
WP_045567983.1|3078120_3078450_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_045567548.1|3078516_3080949_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.0	2.1e-54
3080465:3080483	attR	CGGTTGCGCAGGGCGACGA	NA	NA	NA	NA
WP_045567549.1|3080961_3081843_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	38.7	1.7e-33
WP_045567550.1|3081817_3082024_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	1.6e-16
WP_045567551.1|3082033_3083086_+	phage late control D protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.1	1.7e-80
WP_045567552.1|3083159_3083609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045567553.1|3083605_3084172_+	N-acetylmuramidase	NA	A0A0E3JI96	Rhodoferax_phage	55.3	6.7e-52
WP_052686551.1|3084168_3084801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045567554.1|3084981_3085218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045567555.1|3085612_3086401_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	91.2	1.5e-145
WP_045567556.1|3086440_3087151_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	39.3	1.3e-36
WP_071733818.1|3087163_3087772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045567559.1|3088119_3088623_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	46.2	3.4e-23
WP_080340755.1|3088626_3089037_-	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	48.8	4.0e-14
WP_045567560.1|3089127_3089778_-	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	44.7	9.4e-42
WP_162487879.1|3090094_3090826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045567562.1|3091359_3091983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157380455.1|3092665_3093277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045567986.1|3094513_3095248_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	40.1	5.3e-33
WP_060284440.1|3095253_3095622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071737961.1|3095716_3096196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045567564.1|3096188_3096692_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	41.7	4.6e-20
WP_045567565.1|3096696_3097107_-	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	48.8	6.8e-14
WP_080340756.1|3097360_3098194_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_157641787.1|3098464_3099019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045567567.1|3099468_3099807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045567568.1|3100029_3100956_+	DUF2806 domain-containing protein	NA	A0A291AUV8	Sinorhizobium_phage	32.3	1.4e-25
WP_157641788.1|3101237_3101597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157641789.1|3101651_3102038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157641790.1|3103078_3103726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059920973.1|3103965_3105234_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.3	2.3e-39
WP_045567571.1|3106545_3107526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157641734.1|3108371_3109568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045567572.1|3111606_3113010_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_045567573.1|3113507_3114143_+	LysE family translocator	NA	NA	NA	NA	NA
WP_042584345.1|3114222_3115026_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_042584344.1|3115304_3116123_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_010092003.1|3116297_3117071_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_042584343.1|3117117_3117918_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_045567574.1|3117941_3118433_-	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	29.6	2.6e-07
WP_042584342.1|3118523_3119099_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	39.3	2.4e-12
WP_042584341.1|3119156_3119879_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045567575.1|3120113_3121511_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.6	2.4e-42
WP_045567576.1|3121554_3122355_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_006478433.1|3122457_3123429_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_045567577.1|3123475_3124885_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP009486	Burkholderia ubonensis MSMB22 chromosome II, complete sequence	2722556	353958	426929	2722556	holin,transposase	uncultured_virus(22.22%)	54	NA	NA
WP_045565287.1|353958_354984_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_045563935.1|356058_357939_+	ATP-dependent endonuclease	NA	E5E3R2	Burkholderia_phage	81.0	2.5e-284
WP_059920973.1|358809_360078_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.3	2.3e-39
WP_045563940.1|360360_361383_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_045563941.1|361408_363076_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_010089345.1|363250_363451_-	DUF3079 domain-containing protein	NA	NA	NA	NA	NA
WP_045563942.1|363532_364342_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.0	2.2e-08
WP_045563943.1|364522_366589_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_042588600.1|366738_367425_+	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	NA	NA	NA	NA
WP_042588601.1|367459_368416_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045565288.1|368495_368894_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_045565289.1|368922_369861_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045563944.1|370004_370430_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_080340558.1|370503_370914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042588605.1|371252_372203_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_162487840.1|372308_373289_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042588607.1|373445_374342_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_073563892.1|374334_375432_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	2.9e-27
WP_052686397.1|376233_377208_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045563946.1|377265_378825_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	36.8	1.3e-81
WP_045563947.1|378856_379831_+	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_045563948.1|380194_380845_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010089329.1|381060_381276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045563949.1|381372_382272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162487841.1|383625_392739_+	hemagglutinin	NA	NA	NA	NA	NA
WP_045563952.1|392840_393515_+	OmpA family protein	NA	NA	NA	NA	NA
WP_045565296.1|393917_395063_+	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_045563953.1|395077_396232_+	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_045563954.1|396255_397392_+	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_045563955.1|397410_397782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045565297.1|397862_398663_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_045563956.1|399184_400327_-	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_045563957.1|400487_402485_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_045563958.1|402534_403320_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_042588622.1|403337_404945_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	56.3	6.0e-21
WP_045563959.1|404986_406168_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_088502216.1|406365_407088_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045563960.1|407406_409569_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_045563961.1|409726_410518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080340559.1|410541_411609_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_045563962.1|411658_412369_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_162487818.1|412365_413361_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_045563963.1|413648_415565_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_139253459.1|415622_415823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042588631.1|415980_416412_-	GFA family protein	NA	NA	NA	NA	NA
WP_045565300.1|416451_417645_-	porin	NA	NA	NA	NA	NA
WP_052686401.1|418125_420867_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_045563964.1|420893_421433_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080340561.1|421546_422008_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_045563965.1|422072_422684_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_045563966.1|422702_424025_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	25.8	1.3e-10
WP_045563967.1|424021_424762_-	response regulator	NA	W8CYM9	Bacillus_phage	34.4	2.6e-27
WP_045563968.1|425002_425578_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_045563969.1|425660_426929_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	1.3e-42
>prophage 2
NZ_CP009486	Burkholderia ubonensis MSMB22 chromosome II, complete sequence	2722556	1306370	1362752	2722556	plate	uncultured_Caudovirales_phage(25.0%)	44	NA	NA
WP_045564485.1|1306370_1306802_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_045564486.1|1306814_1307477_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_060212190.1|1307473_1308820_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_045564488.1|1308877_1310266_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_045564489.1|1310527_1312879_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.0	2.4e-10
WP_157641991.1|1312883_1313729_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_045564491.1|1313791_1316446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045564492.1|1317069_1317510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045565392.1|1319473_1319914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071753798.1|1319981_1320233_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_045565393.1|1320312_1321509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045564493.1|1321505_1325036_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_045564494.1|1325052_1326867_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_045565394.1|1326965_1327946_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_045564495.1|1327992_1328637_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_162487828.1|1328784_1329504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010098089.1|1329510_1329942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045564497.1|1330030_1331632_-	tyrosinase family protein	NA	NA	NA	NA	NA
WP_045564498.1|1332221_1333100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162487829.1|1333099_1333270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080340651.1|1333343_1335134_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_045564499.1|1335179_1337147_-	glycosyltransferase	NA	M1HVH2	Acanthocystis_turfacea_Chlorella_virus	26.4	3.8e-25
WP_042588732.1|1337149_1338487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045564500.1|1338507_1339971_-	multidrug transporter	NA	NA	NA	NA	NA
WP_042588734.1|1340718_1341123_+	TIGR02594 family protein	NA	A0A249Y3Q7	Serratia_phage	43.7	1.7e-28
WP_045564501.1|1341151_1342588_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_045565396.1|1342598_1344173_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_045564502.1|1344204_1345296_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_010098074.1|1345360_1345792_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045564503.1|1345841_1346780_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042587257.1|1346881_1347310_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045564504.1|1347564_1348812_+	aconitase X catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_045564505.1|1348804_1349290_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_045564506.1|1349406_1350516_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_045564507.1|1350593_1352627_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_042587262.1|1352665_1353070_-	DUF2471 domain-containing protein	NA	NA	NA	NA	NA
WP_045564508.1|1353226_1354120_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045564509.1|1354207_1354996_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_045564510.1|1355003_1355429_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_045564511.1|1355425_1358155_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	1.1e-86
WP_006479553.1|1358294_1358780_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_045564512.1|1358872_1360621_-	OmpA family protein	NA	NA	NA	NA	NA
WP_045564513.1|1360647_1361403_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_045564514.1|1361399_1362752_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
