The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009337	Burkholderia mallei strain 2002734299 isolate SR092700C chromosome 1, complete sequence	3458247	372230	443310	3458247	protease,transposase	Leptospira_phage(25.0%)	53	NA	NA
WP_004203414.1|372230_372767_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_004198316.1|372776_374120_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.8	3.7e-40
WP_004198315.1|374546_375089_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004198314.1|375108_376389_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004198312.1|376406_376658_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_004200214.1|376982_377882_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_004198307.1|377878_378682_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_004198306.1|378648_379338_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_004198305.1|379690_380836_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004198304.1|380832_381447_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_004198303.1|381458_382772_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_004203411.1|382761_383805_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004198301.1|384178_385123_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187628.1|385268_386489_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.5	7.8e-239
WP_004198300.1|386645_387710_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	46.1	1.3e-80
WP_004191998.1|387936_389400_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189146.1|389758_390781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201442.1|390809_392054_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004188934.1|392234_393524_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_004201440.1|393595_394978_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_004189279.1|395010_395820_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189328.1|396743_397538_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_004189564.1|397782_398034_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_004189634.1|398030_399254_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_004189723.1|399250_400225_+	amino acid--[acyl-carrier-protein] ligase	NA	NA	NA	NA	NA
WP_004196302.1|400221_401310_+	DUF1839 family protein	NA	NA	NA	NA	NA
WP_004196300.1|401306_403826_+	glycoside hydrolase family 2 protein	NA	NA	NA	NA	NA
WP_011807778.1|403822_405799_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004526108.1|405853_407242_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004204872.1|407986_408727_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004189296.1|408754_409996_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004189578.1|410014_410407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189783.1|410373_411024_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_011832305.1|411020_412613_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	27.5	9.4e-43
WP_004190084.1|412647_413844_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004189631.1|413920_415189_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_004190102.1|415366_417730_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004189420.1|418212_418989_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_004203400.1|419058_421350_-	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_004189426.1|421441_421804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196290.1|421805_422168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196288.1|422164_426244_-	TOMM system kinase/cyclase fusion protein	NA	A0A2R8FF19	Brazilian_cedratvirus	27.2	3.6e-14
WP_004190190.1|426254_427253_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_004189885.1|427521_427875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189347.1|427871_428117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024900447.1|428357_428732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189157.1|429018_429396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189582.1|429455_429797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004526091.1|430078_430405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|433445_434565_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_011832309.1|436083_441561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189051.1|441830_442145_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_038802950.1|442189_443310_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 2
NZ_CP009337	Burkholderia mallei strain 2002734299 isolate SR092700C chromosome 1, complete sequence	3458247	1187376	1254919	3458247	protease,coat,tRNA,transposase	Leptospira_phage(16.67%)	57	NA	NA
WP_011203868.1|1187376_1189554_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.7	1.2e-51
WP_004192130.1|1190036_1190684_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004193796.1|1191065_1192154_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_004191507.1|1192286_1192826_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_004192666.1|1192929_1193499_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.6	1.3e-71
WP_004191939.1|1193601_1195881_+	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_004205947.1|1195883_1196606_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_004193337.1|1196739_1197414_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_004191886.1|1197446_1198856_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_011857910.1|1199024_1201325_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004191842.1|1202019_1202730_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004526328.1|1202737_1203256_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004193822.1|1203629_1204640_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_004192784.1|1204812_1205628_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004192680.1|1205810_1206566_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191998.1|1206927_1208391_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004191560.1|1208536_1211521_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_004199404.1|1211633_1211813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193185.1|1211847_1212837_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_004193146.1|1212836_1214816_+	fused uroporphyrinogen-III synthase HemD/membrane protein HemX	NA	NA	NA	NA	NA
WP_004193604.1|1214820_1216011_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_004192161.1|1216191_1217499_-	MFS transporter	NA	NA	NA	NA	NA
WP_004192728.1|1217537_1218296_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004193515.1|1218384_1219824_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004192356.1|1219984_1220512_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.8	9.0e-51
WP_080936883.1|1220570_1221566_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	43.1	2.3e-07
WP_011807749.1|1221544_1221934_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011832356.1|1222554_1223733_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004198600.1|1223853_1225554_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.8	5.8e-91
WP_004193987.1|1225614_1225953_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_004191758.1|1226421_1227510_-	porin	NA	NA	NA	NA	NA
WP_004553879.1|1228404_1229184_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	3.9e-26
WP_004193161.1|1229206_1229920_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004191164.1|1229916_1230606_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004198602.1|1230816_1231593_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004192043.1|1233020_1233566_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_004191521.1|1233807_1234506_+	response regulator	NA	W8CYM9	Bacillus_phage	36.7	2.9e-28
WP_004193003.1|1234489_1235803_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_004198606.1|1235876_1236143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192556.1|1236639_1238397_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004192968.1|1238450_1239791_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	8.2e-32
WP_144410484.1|1240255_1241375_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_041277408.1|1241274_1241805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011857907.1|1242092_1242290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192381.1|1242424_1243843_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_004191763.1|1243835_1244438_+	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	62.8	2.6e-25
WP_004191641.1|1244610_1245222_-	membrane protein	NA	NA	NA	NA	NA
WP_004192472.1|1245951_1247325_-	MFS transporter	NA	NA	NA	NA	NA
WP_004266384.1|1247448_1247961_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_004192184.1|1248535_1248916_-	DUF5594 family protein	NA	NA	NA	NA	NA
WP_004193391.1|1249073_1249343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192840.1|1249949_1250330_-	lipoprotein	NA	NA	NA	NA	NA
WP_004522511.1|1250502_1251042_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004193210.1|1251139_1252276_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_004200110.1|1252532_1252757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193468.1|1253213_1253690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410485.1|1253799_1254919_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	1.8e-48
>prophage 3
NZ_CP009337	Burkholderia mallei strain 2002734299 isolate SR092700C chromosome 1, complete sequence	3458247	2078992	2156527	3458247	coat,tRNA,transposase	Klosneuvirus(20.0%)	60	NA	NA
WP_004191922.1|2078992_2081860_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	2.8e-146
WP_004192544.1|2081946_2082828_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.9	1.9e-69
WP_004526815.1|2082888_2083506_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_004191850.1|2083594_2085988_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_004192128.1|2085998_2087363_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004193573.1|2087359_2088064_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004192096.1|2088391_2088778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193727.1|2089053_2089284_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_004192573.1|2089448_2090486_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004193713.1|2090498_2091518_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_004191536.1|2091510_2092392_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004192875.1|2092636_2093686_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004192697.1|2093786_2094932_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004193469.1|2094944_2095745_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.4	1.3e-13
WP_004191266.1|2095758_2097759_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_004196072.1|2097769_2099755_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_004192432.1|2099751_2100672_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_004196071.1|2100671_2101475_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_004193939.1|2101591_2102296_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_045596944.1|2102292_2104578_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FFL6	Cedratvirus	26.2	2.4e-07
WP_004191272.1|2104570_2105506_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004193685.1|2105510_2105960_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004196068.1|2105860_2106205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192588.1|2106201_2107350_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004193399.1|2107565_2107901_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_004193543.1|2108000_2108552_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004196065.1|2108843_2109521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2112226_2113347_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_011807697.1|2113377_2114094_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_004192193.1|2114240_2115206_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004204967.1|2115709_2118334_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	5.5e-80
WP_004204969.1|2119001_2120222_+	CoA transferase	NA	NA	NA	NA	NA
WP_004534928.1|2120545_2120755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193654.1|2121032_2122742_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.5	8.8e-188
WP_004192426.1|2123073_2123556_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	3.7e-19
WP_004193860.1|2123574_2123961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196725.1|2126262_2126442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004192265.1|2126438_2127299_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_004191662.1|2127342_2128758_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_004193177.1|2128991_2130575_+	acid phosphatase	NA	NA	NA	NA	NA
WP_004266854.1|2130772_2131966_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_004191546.1|2132584_2133772_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004192651.1|2133944_2135564_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004192810.1|2137553_2138186_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004552891.1|2138186_2140268_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.8	1.7e-12
WP_004196717.1|2140678_2141644_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_011832203.1|2141659_2144071_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004191504.1|2144115_2144955_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004526783.1|2144972_2145497_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004191870.1|2145573_2146134_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004192149.1|2146186_2146732_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004542449.1|2146718_2146904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531175.1|2146989_2147211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196705.1|2147548_2148442_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196700.1|2148948_2150145_+	MFS transporter	NA	NA	NA	NA	NA
WP_004192394.1|2150189_2151182_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004193855.1|2151649_2151931_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004191144.1|2152183_2152453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193170.1|2153347_2154661_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_038802950.1|2155407_2156527_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 4
NZ_CP009337	Burkholderia mallei strain 2002734299 isolate SR092700C chromosome 1, complete sequence	3458247	2554557	2618584	3458247	tRNA,protease,transposase	Streptococcus_phage(27.78%)	57	NA	NA
WP_004191998.1|2554557_2556021_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004189921.1|2556167_2557139_-	thymidylate synthase	NA	A0A1V0DY05	Yersinia_phage	36.1	2.9e-47
WP_004189039.1|2557195_2558581_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004195958.1|2558542_2558839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189413.1|2559079_2559316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189886.1|2559628_2559814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011807762.1|2559810_2560746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162486031.1|2560986_2562819_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_004189313.1|2563026_2563530_+	dihydrofolate reductase	NA	A0A0A0PL85	Bacillus_phage	40.4	9.6e-26
WP_004191998.1|2563658_2565122_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004188997.1|2565258_2566629_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_004195962.1|2566774_2567383_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_004195963.1|2567399_2567984_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_004189767.1|2568231_2568837_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	4.2e-28
WP_004189931.1|2568955_2570221_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004189924.1|2570217_2571162_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_004189573.1|2571230_2571548_+	lipoprotein	NA	NA	NA	NA	NA
WP_004195964.1|2571714_2572653_-	CobD/CbiB family protein	NA	NA	NA	NA	NA
WP_004189888.1|2572753_2573407_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_004190182.1|2574366_2574957_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004189360.1|2575277_2575667_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_004189914.1|2575804_2576599_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004195969.1|2576600_2577290_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004189402.1|2577334_2577589_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004189308.1|2579029_2579497_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_004203563.1|2579531_2580689_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_004188962.1|2580797_2581286_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038802950.1|2581435_2582556_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004189387.1|2582673_2583960_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_004189890.1|2585975_2586911_-	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_004189750.1|2586926_2587676_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011807766.1|2587902_2588697_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004189862.1|2588770_2589424_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004190044.1|2589413_2590448_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	6.8e-34
WP_004190087.1|2590756_2591599_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
WP_004188957.1|2591941_2592865_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_004203558.1|2593043_2594339_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004532363.1|2594564_2595467_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_004189725.1|2595790_2596108_-	competence protein ComE	NA	NA	NA	NA	NA
WP_004190173.1|2596179_2597172_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004203554.1|2597230_2598217_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.5	1.8e-15
WP_004189214.1|2598185_2599586_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	2.1e-78
WP_004188993.1|2599706_2600876_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004195986.1|2600928_2601222_-	LapA family protein	NA	NA	NA	NA	NA
WP_144410488.1|2601457_2602920_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	1.5e-79
WP_004189865.1|2603038_2603362_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	38.9	4.7e-10
WP_004189285.1|2603384_2605097_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004189396.1|2605241_2605928_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_096325444.1|2605948_2608171_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004190098.1|2608374_2609457_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_004189993.1|2609491_2610574_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.2	8.5e-88
WP_004189806.1|2610747_2611344_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_004189243.1|2611442_2614043_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.8	9.5e-101
WP_004189892.1|2614553_2615228_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004532296.1|2615396_2616095_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_004190123.1|2616120_2616846_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_038802950.1|2617464_2618584_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
>prophage 5
NZ_CP009337	Burkholderia mallei strain 2002734299 isolate SR092700C chromosome 1, complete sequence	3458247	2652506	2702172	3458247	integrase,tRNA,transposase	Leptospira_phage(15.38%)	46	2649733:2649753	2696572:2696592
2649733:2649753	attL	GCGCGAGCGTCGTCAGCACGT	NA	NA	NA	NA
WP_004186184.1|2652506_2653727_+|transposase	ISL3-like element ISBma1 family transposase	transposase	A9YX10	Burkholderia_phage	99.0	6.6e-238
WP_004190100.1|2654068_2654329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197792.1|2654351_2654828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197793.1|2655083_2655299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197795.1|2655998_2656250_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_004203540.1|2656536_2657025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189437.1|2657021_2658272_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_004188913.1|2658280_2660617_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004189159.1|2660763_2661153_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_011203825.1|2661765_2662359_+	chorismate mutase	NA	NA	NA	NA	NA
WP_004197797.1|2662355_2662514_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
WP_004189968.1|2664774_2665446_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	46.1	1.3e-46
WP_038802950.1|2665476_2666596_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004189780.1|2666790_2667369_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_004189552.1|2667636_2668896_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189626.1|2668868_2669051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189292.1|2669063_2670674_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004191998.1|2670840_2672304_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004186453.1|2672426_2673407_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_004186190.1|2673409_2673865_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_004185928.1|2674003_2674840_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004186391.1|2675133_2675367_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_004185395.1|2675384_2675552_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_004186553.1|2675608_2677321_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_004185611.1|2677512_2678397_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_004185886.1|2678393_2679530_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_004186237.1|2679698_2680895_-	aminotransferase	NA	NA	NA	NA	NA
WP_004186398.1|2681091_2682444_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004186079.1|2682455_2683718_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_004185746.1|2683714_2684377_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.0	1.6e-25
WP_004535897.1|2684501_2685494_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_004185348.1|2685605_2688443_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	26.0	1.6e-80
WP_004186086.1|2688442_2688943_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_004186216.1|2689004_2690216_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.9	3.0e-41
WP_004186718.1|2690279_2690726_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	64.4	7.9e-48
WP_004185819.1|2690814_2691597_-	membrane protein	NA	NA	NA	NA	NA
WP_011832233.1|2691761_2692505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096325434.1|2692744_2693865_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004185841.1|2694927_2695506_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.7	1.1e-44
WP_004197496.1|2695702_2697085_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	27.5	6.1e-30
2696572:2696592	attR	GCGCGAGCGTCGTCAGCACGT	NA	NA	NA	NA
WP_004200482.1|2697079_2697310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004555967.1|2697542_2698571_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004196455.1|2698551_2698758_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_004185994.1|2698931_2699723_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004185840.1|2699931_2700594_+	adenylate kinase	NA	NA	NA	NA	NA
WP_004191998.1|2700708_2702172_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
>prophage 6
NZ_CP009337	Burkholderia mallei strain 2002734299 isolate SR092700C chromosome 1, complete sequence	3458247	2753472	2762709	3458247		unidentified_phage(16.67%)	7	NA	NA
WP_004194112.1|2753472_2755020_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
WP_004194373.1|2755056_2755584_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004194274.1|2755580_2756264_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.6e-05
WP_004194137.1|2756328_2757144_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004194350.1|2757319_2759326_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	9.7e-53
WP_004194374.1|2759359_2760490_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	2.9e-22
WP_004194034.1|2760756_2762709_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
>prophage 7
NZ_CP009337	Burkholderia mallei strain 2002734299 isolate SR092700C chromosome 1, complete sequence	3458247	3383623	3428074	3458247	holin,transposase,plate	Leptospira_phage(20.0%)	37	NA	NA
WP_004198632.1|3383623_3383977_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004198631.1|3383994_3384825_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_004198630.1|3385008_3386499_-	6-aminohexanoate-cyclic-dimer hydrolase	NA	NA	NA	NA	NA
WP_004198629.1|3386595_3387288_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_096325434.1|3388663_3389783_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004204912.1|3389922_3390405_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004202808.1|3390484_3392323_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004200010.1|3392286_3393387_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004202807.1|3393420_3396090_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.0	3.8e-89
WP_004200005.1|3396179_3397301_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004185296.1|3397499_3398432_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004200003.1|3398436_3399426_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004200001.1|3399422_3403316_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004200000.1|3403323_3403437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199998.1|3403587_3404439_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_004199997.1|3404564_3405521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199995.1|3405731_3407180_-	TolC family protein	NA	NA	NA	NA	NA
WP_004199993.1|3407176_3409438_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	4.2e-36
WP_004199991.1|3409452_3410721_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012729786.1|3410746_3411103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204906.1|3411336_3411567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004185238.1|3411669_3411906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071893038.1|3411981_3412380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004204896.1|3412961_3415127_-	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.1	1.9e-46
WP_004199982.1|3415731_3416235_+	lipoprotein	NA	NA	NA	NA	NA
WP_004202806.1|3416194_3416674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004185303.1|3416672_3417791_+	acyltransferase	NA	NA	NA	NA	NA
WP_004539229.1|3417865_3418171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198067.1|3418147_3419284_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004198065.1|3419411_3420308_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004198063.1|3420392_3421016_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_004198062.1|3421353_3421998_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004198061.1|3422156_3423440_+	MFS transporter	NA	NA	NA	NA	NA
WP_004198060.1|3423399_3423975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202805.1|3423936_3424542_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004198058.1|3425139_3426402_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_004191998.1|3426611_3428074_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
>prophage 1
NZ_CP009338	Burkholderia mallei strain 2002734299 isolate SR092700C chromosome 2, complete sequence	2284094	8020	51495	2284094	plate,transposase	Streptococcus_phage(20.0%)	32	NA	NA
WP_144410493.1|8020_9482_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.6e-79
WP_004200939.1|10522_11017_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200941.1|11198_12038_-	universal stress protein	NA	NA	NA	NA	NA
WP_004200942.1|12287_13328_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004200943.1|13695_14841_+	cytochrome P460	NA	NA	NA	NA	NA
WP_004200944.1|15029_16238_+	MFS transporter	NA	NA	NA	NA	NA
WP_004184941.1|16642_17419_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004200946.1|17434_18304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200950.1|19147_20563_+	amino acid permease	NA	NA	NA	NA	NA
WP_004200952.1|21158_21401_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004184704.1|21551_21842_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004200955.1|22235_23552_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004201904.1|23973_24471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004266679.1|24588_25473_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_038802950.1|25583_26704_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004528803.1|27297_27930_-	GTP cyclohydrolase I	NA	A0A0P0HSD2	Acinetobacter_phage	30.6	9.9e-20
WP_004551882.1|27934_28228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201911.1|28186_28432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162473488.1|28391_29615_-	peptidase	NA	NA	NA	NA	NA
WP_011832030.1|30316_34285_-	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_004184888.1|34296_34962_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004206515.1|34958_36356_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004200965.1|36388_37186_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004200966.1|37195_37588_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004200968.1|37616_38378_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004206517.1|38374_39439_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004206518.1|39456_42099_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004184913.1|42124_45148_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.2e-22
WP_011832029.1|45174_48258_-	AAA domain-containing protein	NA	A0A223W0B1	Agrobacterium_phage	29.5	4.6e-78
WP_004200970.1|48244_49267_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004200971.1|49254_50997_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004184744.1|51033_51495_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009338	Burkholderia mallei strain 2002734299 isolate SR092700C chromosome 2, complete sequence	2284094	1226941	1276623	2284094	plate,transposase	Leptospira_phage(25.0%)	39	NA	NA
WP_038802950.1|1226941_1228061_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004196172.1|1229493_1230753_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004190781.1|1230853_1231900_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004190757.1|1231974_1233075_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	5.2e-24
WP_004200631.1|1233183_1234713_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004190433.1|1234814_1235849_-	lipase secretion chaperone	NA	NA	NA	NA	NA
WP_004196164.1|1235893_1236919_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004190808.1|1237269_1239507_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_004190837.1|1239594_1239990_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004190603.1|1240150_1240687_-	cytochrome b	NA	NA	NA	NA	NA
WP_004190805.1|1240955_1241591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011204344.1|1241721_1242486_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_004190911.1|1242764_1243076_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011204342.1|1243520_1243853_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_004190614.1|1244051_1245467_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	30.2	2.1e-41
WP_004190588.1|1245455_1245599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190461.1|1245922_1246600_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_004190245.1|1246562_1247501_-	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	25.3	1.4e-14
WP_004190776.1|1247497_1248922_-	cytosine permease	NA	NA	NA	NA	NA
WP_011204340.1|1249438_1250419_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_045589205.1|1250431_1251193_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_038802950.1|1251092_1252212_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004196154.1|1252240_1253299_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_004196151.1|1253228_1253882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|1253956_1256161_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_011832137.1|1256157_1258812_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	2.3e-78
WP_004190820.1|1258790_1260269_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004190509.1|1260265_1262137_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004196148.1|1262141_1262702_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004190698.1|1262720_1263212_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004190849.1|1263271_1264780_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190671.1|1264772_1265351_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190988.1|1265413_1266493_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004190797.1|1266545_1269143_-	protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.6	5.0e-09
WP_004190273.1|1269141_1269369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011832136.1|1269353_1270259_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_004190681.1|1270255_1273885_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190689.1|1273887_1275204_-	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004190585.1|1275219_1276623_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 3
NZ_CP009338	Burkholderia mallei strain 2002734299 isolate SR092700C chromosome 2, complete sequence	2284094	1946658	2017087	2284094	plate,transposase,holin	Streptococcus_phage(25.0%)	50	NA	NA
WP_011204222.1|1946658_1948122_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	2.0e-79
WP_004200660.1|1948269_1948698_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_004188455.1|1948711_1949440_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_004188251.1|1949476_1950217_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_004187745.1|1950441_1950681_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_004187671.1|1950812_1951685_-	glutamate racemase	NA	NA	NA	NA	NA
WP_004188572.1|1951731_1952208_-	bacterioferritin	NA	NA	NA	NA	NA
WP_004187501.1|1952362_1953898_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_004202253.1|1953937_1954546_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.0	5.4e-23
WP_004188376.1|1955963_1957946_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.8	1.8e-83
WP_041277172.1|1958102_1958423_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_004187151.1|1958416_1960432_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_004196027.1|1962102_1963245_-	alkyl hydroperoxide reductase subunit F	NA	NA	NA	NA	NA
WP_004187548.1|1963448_1964012_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_004200658.1|1964271_1965369_-	chitin-binding protein	NA	C3TWS8	Euproctis_pseudoconspersa_nucleopolyhedrovirus	33.3	8.0e-25
WP_004202249.1|1965926_1966430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188127.1|1966504_1967128_-	nitroreductase	NA	NA	NA	NA	NA
WP_004188408.1|1967359_1967566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004551378.1|1967861_1969277_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_004187979.1|1969371_1970313_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_004188464.1|1970321_1971278_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_004202244.1|1971414_1974837_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_004187774.1|1974976_1977673_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_004200655.1|1977663_1978686_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_004196023.1|1978873_1980376_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_004188593.1|1980479_1981691_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_004202241.1|1982004_1983078_-	FUSC family protein	NA	NA	NA	NA	NA
WP_004196021.1|1983316_1984282_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004187801.1|1984354_1985122_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004187270.1|1985267_1986335_-	2-aminoethylphosphonate aminotransferase	NA	NA	NA	NA	NA
WP_004188554.1|1987523_1989212_-	phosphoenolpyruvate mutase	NA	NA	NA	NA	NA
WP_004188389.1|1989208_1989976_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_011857842.1|1990014_1991016_-	HpnL family protein	NA	NA	NA	NA	NA
WP_004188272.1|1991775_1992465_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_004188420.1|1992829_1994344_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_004188491.1|1996052_1996991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202234.1|1997024_1997573_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190846.1|1997575_1999081_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004196178.1|1999224_1999752_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_004190879.1|1999831_2000263_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|2000276_2002139_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|2002135_2003125_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004196185.1|2005988_2008235_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004190563.1|2008400_2010689_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004200633.1|2010692_2012909_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004202229.1|2012908_2013979_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004190800.1|2013981_2014698_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004190606.1|2014740_2015130_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004196199.1|2015314_2016460_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004206248.1|2016478_2017087_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 4
NZ_CP009338	Burkholderia mallei strain 2002734299 isolate SR092700C chromosome 2, complete sequence	2284094	2123660	2166682	2284094	transposase,holin	Leptospira_phage(33.33%)	31	NA	NA
WP_096325434.1|2123660_2124780_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
WP_004184834.1|2125021_2126482_+	ser/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_009967729.1|2128060_2128993_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_011326545.1|2129436_2130126_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024900894.1|2130157_2130892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144410497.1|2139473_2140594_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	2.3e-48
WP_004266245.1|2141152_2142223_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_004184680.1|2142285_2142780_-	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_004184724.1|2142814_2143294_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004198701.1|2143290_2143626_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011832054.1|2144097_2144997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198708.1|2145095_2145311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198711.1|2145660_2145852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041277152.1|2145878_2146541_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011832052.1|2146774_2148508_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	3.9e-26
WP_004200833.1|2148500_2149403_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_004199315.1|2149525_2150524_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004533171.1|2150624_2151575_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004194983.1|2151964_2152864_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	39.6	1.4e-32
WP_004194984.1|2153744_2154437_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	S4VR59	Pandoravirus	36.3	2.6e-21
WP_004266705.1|2155398_2156370_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004184793.1|2156397_2157174_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_004201828.1|2157255_2158578_-	MFS transporter	NA	NA	NA	NA	NA
WP_004194988.1|2158681_2159323_-	aldolase	NA	A0A077SK32	Escherichia_phage	48.1	9.6e-39
WP_004266704.1|2159319_2160663_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	45.6	3.4e-86
WP_004184805.1|2160685_2161576_-	NAD-binding protein	NA	A0A077SLF7	Escherichia_phage	58.1	7.3e-77
WP_004200845.1|2161654_2162359_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004200846.1|2162549_2163164_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_011857835.1|2163258_2163741_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011204369.1|2164167_2165283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038802950.1|2165562_2166682_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	3.6e-49
