The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LM993812	Escherichia coli strain K-12 substr. HMS174 chromosome 1	4584860	247636	296320	4584860	transposase,integrase	Streptococcus_phage(20.0%)	49	262122:262181	296430:296489
WP_000006255.1|247636_248134_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|248357_250097_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|250041_250827_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|250897_251953_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|252004_252298_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|252300_252699_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|252708_253161_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|253466_253733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352051.1|253644_254202_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|254258_255716_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|255976_256435_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|256526_257771_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|257828_258230_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|258268_259324_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|259611_260715_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|260726_261980_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
262122:262181	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|262551_262893_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|262913_263231_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|263249_263471_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|263479_263956_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|263971_264430_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|264527_264767_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|264843_265311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|265333_265777_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|265776_266004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|266407_267229_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|267320_268184_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|268512_269406_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|269826_270978_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|273324_274341_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|274548_275952_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|275938_276871_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|276979_278026_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|279247_279586_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|279608_279959_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|280052_281207_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|281501_282410_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|282424_284392_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|284618_286001_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|286012_287623_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|287627_288386_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|288524_289529_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|290723_291455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|291545_292172_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|292443_293142_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|293168_294023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|294141_294366_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|294362_294803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|294919_296320_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
296430:296489	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_LM993812	Escherichia coli strain K-12 substr. HMS174 chromosome 1	4584860	518361	581320	4584860	lysis,tRNA,terminase,transposase,integrase,protease	Enterobacteria_phage(50.0%)	66	563978:564024	585280:585326
WP_001295836.1|518361_518985_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|518955_519642_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|519638_522053_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|522483_526764_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|526803_527172_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|527862_528123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297301.1|528179_528353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|529354_530449_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|530517_531444_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|531673_532156_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|532233_533049_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|533138_534920_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|534932_535709_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|535808_536687_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|536855_538310_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|538369_539731_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|539787_541089_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|541110_542256_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|542483_543269_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|543279_544515_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|544536_545586_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|545902_547570_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|547579_548839_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|548849_549665_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|549661_550555_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|550749_551817_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|551813_552323_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|552440_553163_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|553165_553660_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|553833_555219_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|555254_555776_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|555883_556096_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_045152971.1|556097_556964_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.8	2.2e-30
WP_000776555.1|557434_557977_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|558196_558889_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|558919_561523_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|561501_562542_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|562552_563068_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|563070_563703_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
563978:564024	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|564037_565201_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|565320_565584_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|565906_566002_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|566064_567226_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|567537_567870_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|567917_568067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|568124_569651_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|570115_570667_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|570676_571474_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|571590_571692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|571688_572144_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|572143_572314_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|572306_572597_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|572593_572956_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|572952_573093_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|573178_573562_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|573959_574976_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|574980_576048_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|576620_576836_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|576835_577333_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|577549_577732_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|577822_578116_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|578406_578817_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|579102_579309_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|579473_579668_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|580056_580602_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|580576_581320_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
585280:585326	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_LM993812	Escherichia coli strain K-12 substr. HMS174 chromosome 1	4584860	1381792	1437663	4584860	lysis,transposase,tail	Escherichia_phage(37.5%)	51	NA	NA
WP_010723085.1|1381792_1382809_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000105143.1|1383299_1385900_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1386001_1386277_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1386351_1386522_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1386521_1386743_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1387184_1387673_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1387669_1387825_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1388278_1388755_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1388878_1389175_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1389197_1389620_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1389632_1390490_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1390496_1391243_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1391265_1391826_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1391913_1392099_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1392295_1393753_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1393890_1394154_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1394134_1394494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1396259_1397240_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_000279097.1|1397562_1400925_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1400924_1401500_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1401597_1402188_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1402504_1402738_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1402806_1402920_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1403698_1404133_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1404273_1405407_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_000628244.1|1405773_1409298_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1409571_1409838_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|1409834_1410257_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|1410367_1411357_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_000900941.1|1411564_1414204_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|1414200_1414386_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|1414393_1414720_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|1414891_1415797_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|1416032_1417532_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|1417589_1419863_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|1420110_1422156_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|1422440_1423370_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|1423381_1423669_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|1423677_1424424_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|1424438_1424936_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|1424943_1426014_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|1426010_1426778_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|1426777_1427566_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|1427567_1428995_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|1428984_1429407_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|1429406_1430612_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|1430638_1431952_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|1432052_1433003_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|1432984_1433575_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|1433678_1433744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|1436434_1437663_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 4
NZ_LM993812	Escherichia coli strain K-12 substr. HMS174 chromosome 1	4584860	1599412	1621215	4584860	tail,lysis,transposase	Enterobacteria_phage(39.13%)	40	NA	NA
WP_000527743.1|1599412_1600873_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1600961_1602245_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1602849_1602963_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1603031_1603265_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1603581_1604172_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1604269_1604845_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1604844_1605807_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1605757_1606327_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1606715_1606949_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1607006_1607417_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1607568_1607742_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1607913_1608069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1608147_1608213_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1608215_1608404_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1608414_1608627_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1608989_1609487_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1609483_1610017_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1610013_1610325_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1610329_1610545_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1611298_1611514_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1611814_1612027_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1612081_1612171_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1612448_1613201_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001393597.1|1613214_1614264_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_012304870.1|1614265_1614544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1614610_1614862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1615078_1615234_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1615305_1615593_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1615592_1615832_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1615856_1616162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1616364_1616697_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1617133_1617283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1617579_1617810_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1617893_1618301_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1618467_1618623_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1618782_1619001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014639039.1|1619004_1619169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1619568_1619757_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_045152978.1|1619753_1619912_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_088895425.1|1619987_1621215_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
>prophage 5
NZ_LM993812	Escherichia coli strain K-12 substr. HMS174 chromosome 1	4584860	2058832	2067503	4584860		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2058832_2059936_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2059943_2061191_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2061187_2061745_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2061744_2062626_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2062683_2063583_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2063582_2064668_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2065040_2065934_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2066108_2067503_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 6
NZ_LM993812	Escherichia coli strain K-12 substr. HMS174 chromosome 1	4584860	2417681	2428891	4584860	tail,integrase	Enterobacteria_phage(53.33%)	16	2415656:2415672	2432566:2432582
2415656:2415672	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2417681_2418614_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2418925_2420083_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2420235_2420598_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2420594_2421515_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2421511_2422843_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2422877_2423159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2423457_2423898_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2423924_2424443_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2424492_2424768_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2424767_2425262_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2425984_2426347_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2426412_2427237_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2427364_2427901_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2427891_2428254_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2428253_2428559_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2428690_2428891_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2432566:2432582	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 7
NZ_LM993812	Escherichia coli strain K-12 substr. HMS174 chromosome 1	4584860	2809472	2816611	4584860		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2809472_2812034_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2812139_2812796_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2812846_2813614_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2813809_2814718_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2814714_2815881_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2815972_2816611_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
