The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN649235	Salmonella enterica subsp. enterica serovar Infantis strain 1326/28 chromosome 1	4710675	967876	975189	4710675	protease,integrase	Dickeya_phage(16.67%)	7	969127:969141	980381:980395
WP_001201750.1|967876_968995_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_023993622.1|968991_970938_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
969127:969141	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|971067_971289_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|971612_971933_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|971963_974240_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|974452_974650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023993623.1|974811_975189_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	40.2	1.0e-19
980381:980395	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
NZ_LN649235	Salmonella enterica subsp. enterica serovar Infantis strain 1326/28 chromosome 1	4710675	1311592	1360535	4710675	tail,integrase,head,capsid,terminase,tRNA,lysis,portal,holin,protease	Salmonella_phage(50.79%)	68	1303814:1303830	1346533:1346549
1303814:1303830	attL	TCAGGCGCTGACCAAGA	NA	NA	NA	NA
WP_023230808.1|1311592_1312804_+|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	99.0	3.6e-236
WP_000509169.1|1313243_1313510_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
WP_045159934.1|1313586_1314447_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	61.3	3.9e-59
WP_015995294.1|1314450_1314669_-	DUF4014 family protein	NA	B9UDM3	Salmonella_phage	100.0	4.9e-35
WP_045159935.1|1314898_1315483_-	ead/Ea22-like family protein	NA	I6RSM9	Salmonella_phage	92.9	2.6e-43
WP_045159936.1|1315591_1316209_-	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	64.9	4.0e-66
WP_071827193.1|1316205_1316376_-	DUF2737 family protein	NA	I6S642	Salmonella_phage	98.2	3.0e-24
WP_001111312.1|1316386_1316680_-	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_045160680.1|1316695_1317244_-	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	95.1	1.5e-101
WP_023994437.1|1317252_1317759_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	90.5	6.1e-81
WP_038989105.1|1317759_1318467_-	recombinase	NA	I6R0N0	Salmonella_phage	89.7	2.2e-121
WP_000902089.1|1318463_1318607_-	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	95.7	1.6e-18
WP_000156731.1|1318596_1318785_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000141641.1|1318765_1318924_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_045159937.1|1319149_1319824_-	pentapeptide repeat-containing protein	NA	Q8HAH0	Salmonella_phage	78.9	3.8e-46
WP_045159938.1|1319907_1320153_-	hypothetical protein	NA	U5PUY0	Salmonella_phage	61.0	9.4e-19
WP_045159939.1|1320160_1320493_-	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	94.5	1.1e-51
WP_042827545.1|1320856_1321060_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	97.0	4.5e-27
WP_044128249.1|1321203_1322226_-	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	40.9	6.2e-72
WP_045159940.1|1322281_1322971_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	99.6	5.0e-126
WP_000182204.1|1323081_1323297_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_017441422.1|1323404_1323683_+	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	91.3	6.4e-40
WP_001125981.1|1323717_1323864_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_042827542.1|1323856_1324690_+	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	98.9	1.2e-150
WP_001248404.1|1324686_1326063_+	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	99.8	4.3e-254
WP_024142086.1|1326136_1326577_+	recombination protein NinB	NA	K7PKW7	Enterobacterial_phage	97.3	1.9e-78
WP_024142085.1|1326573_1327164_+	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	76.5	9.7e-86
WP_024142084.1|1327160_1327334_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	91.2	2.7e-28
WP_001659070.1|1327300_1327477_+	NinE family protein	NA	I6RSI9	Salmonella_phage	100.0	2.3e-27
WP_023242798.1|1327473_1327644_+	hypothetical protein	NA	I6R994	Salmonella_phage	87.0	7.4e-23
WP_001749499.1|1327636_1327873_+	hypothetical protein	NA	C6ZR59	Salmonella_phage	88.5	3.4e-34
WP_023242800.1|1328311_1328494_+	hypothetical protein	NA	C6ZR61	Salmonella_phage	95.0	6.1e-23
WP_001047565.1|1328490_1329264_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	99.6	5.3e-132
WP_045159941.1|1329688_1330015_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	99.1	1.1e-51
WP_023254271.1|1329998_1330436_+	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.2	4.1e-73
WP_042827540.1|1330432_1330903_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	84.1	1.5e-60
WP_020898878.1|1331021_1331366_+	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	75.7	1.0e-47
WP_010835825.1|1331498_1331963_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
WP_045159942.1|1331916_1333659_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	1.6e-141
WP_024142077.1|1333658_1334966_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.5	6.4e-215
WP_010835822.1|1334979_1335828_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	3.4e-132
WP_010835821.1|1335837_1337055_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	6.0e-199
WP_045159943.1|1337098_1337377_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	3.1e-10
WP_001648719.1|1337376_1337703_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
WP_020898872.1|1337712_1338051_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
WP_010835820.1|1338047_1338497_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	96.6	2.5e-73
WP_001648721.1|1338493_1338841_+	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	96.5	5.5e-57
WP_010835819.1|1338897_1339602_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	74.4	3.3e-93
WP_001129939.1|1339629_1340001_+|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	94.2	3.0e-61
WP_024134502.1|1340024_1340303_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
WP_000404385.1|1340359_1340695_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	100.0	7.0e-57
WP_045159944.1|1340741_1344056_+|tail	phage tail tape measure protein	tail	S4TTF9	Salmonella_phage	96.0	0.0e+00
WP_024142074.1|1344426_1344681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010835817.1|1344843_1345437_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	99.5	1.9e-110
WP_010835816.1|1345436_1346021_+	hypothetical protein	NA	S4TND4	Salmonella_phage	97.4	3.2e-105
WP_010835815.1|1346027_1346426_+	hypothetical protein	NA	S4TR39	Salmonella_phage	94.7	2.9e-70
WP_045159945.1|1346425_1349137_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	95.8	0.0e+00
1346533:1346549	attR	TCAGGCGCTGACCAAGA	NA	NA	NA	NA
WP_042827531.1|1349145_1350105_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.1	9.0e-182
WP_045159946.1|1350115_1351414_+	hypothetical protein	NA	I6R0Q9	Salmonella_phage	99.3	2.9e-244
WP_045159947.1|1351650_1352070_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	1.1e-35
WP_000457671.1|1352072_1353341_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.9	2.1e-239
WP_001144226.1|1353672_1355601_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
WP_001574431.1|1355604_1356147_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001124225.1|1356242_1356440_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|1356490_1356847_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1356967_1357012_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018570.1|1357148_1358132_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_023994543.1|1358147_1360535_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_LN649235	Salmonella enterica subsp. enterica serovar Infantis strain 1326/28 chromosome 1	4710675	2021349	2028600	4710675		Morganella_phage(33.33%)	8	NA	NA
WP_023993342.1|2021349_2022780_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_023993343.1|2022853_2023549_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	3.6e-07
WP_000107435.1|2023628_2023940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023993344.1|2024588_2025785_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.6	4.3e-109
WP_024131109.1|2026043_2026232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2026242_2026455_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_023993345.1|2026909_2028178_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	9.3e-227
WP_000394197.1|2028180_2028600_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 4
NZ_LN649235	Salmonella enterica subsp. enterica serovar Infantis strain 1326/28 chromosome 1	4710675	2187006	2196177	4710675	tRNA	Enterobacteria_phage(71.43%)	10	NA	NA
WP_000195340.1|2187006_2189040_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|2189280_2189739_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023993390.1|2189910_2190441_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	31.7	2.8e-15
WP_000950413.1|2190497_2190965_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2191011_2191731_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2191727_2193413_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2193635_2194367_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023993392.1|2194426_2194534_+	protein YohO	NA	NA	NA	NA	NA
WP_045159972.1|2194514_2195246_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2195229_2196177_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 5
NZ_LN649235	Salmonella enterica subsp. enterica serovar Infantis strain 1326/28 chromosome 1	4710675	2725401	2734377	4710675	integrase	Enterobacteria_phage(85.71%)	10	2722772:2722787	2729594:2729609
2722772:2722787	attL	GCAGCAGGTGAAAGCG	NA	NA	NA	NA
WP_001604633.1|2725401_2726598_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.0	4.1e-107
WP_045160149.1|2726634_2728044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023993984.1|2728576_2729143_-	bacteriophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	1.2e-56
WP_000984209.1|2729159_2729402_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_000149860.1|2729398_2730136_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
2729594:2729609	attR	CGCTTTCACCTGCTGC	NA	NA	NA	NA
WP_000556594.1|2730673_2730940_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	69.3	3.7e-29
WP_015701354.1|2730936_2731488_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_001216603.1|2731484_2731712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023993983.1|2731708_2732029_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_023993982.1|2732043_2734377_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
>prophage 6
NZ_LN649235	Salmonella enterica subsp. enterica serovar Infantis strain 1326/28 chromosome 1	4710675	3208996	3281408	4710675	tail,integrase,head,capsid,terminase,tRNA,transposase,portal,holin,plate	Cronobacter_phage(56.82%)	75	3231563:3231580	3262825:3262842
WP_086016038.1|3208996_3210251_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	4.8e-18
WP_001076978.1|3210268_3210922_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
WP_000566824.1|3211358_3211655_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_000928927.1|3211729_3211939_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_000171739.1|3212196_3212817_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_000342879.1|3212835_3214515_+	flotillin family protein	NA	NA	NA	NA	NA
WP_000502754.1|3214616_3214814_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_000867682.1|3214973_3216407_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	8.8e-40
WP_045160243.1|3216454_3219298_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_021000792.1|3219415_3220717_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_001125344.1|3220958_3221573_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000708447.1|3221635_3222877_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
WP_023993920.1|3222981_3223803_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000355776.1|3223900_3224260_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272784.1|3224366_3224978_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_001264391.1|3225227_3226241_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3226468_3226684_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3226919_3228665_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3228814_3230662_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3230785_3231292_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3231563:3231580	attL	TGTCGCAAAAGTGTCGCA	NA	NA	NA	NA
WP_045160247.1|3231604_3232228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088493120.1|3232877_3234581_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	4.9e-223
WP_045160248.1|3234580_3235126_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.6	3.9e-65
WP_000267951.1|3235097_3235823_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_045160249.1|3235812_3236367_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	96.7	3.0e-97
WP_045160250.1|3236379_3238536_-|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	65.4	7.4e-192
WP_045160251.1|3238545_3239133_-	protein phage	NA	F1BUK5	Cronobacter_phage	82.6	1.7e-90
WP_045160253.1|3239125_3240310_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.6	2.3e-179
WP_001002797.1|3240306_3240636_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_045160255.1|3240632_3242603_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.1	1.9e-271
WP_000411337.1|3242790_3243048_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_033567000.1|3243194_3243527_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	72.7	1.8e-36
WP_000175560.1|3243526_3243868_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3243864_3244158_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3244167_3244623_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_033567001.1|3244619_3245747_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.5	1.2e-174
WP_033567002.1|3245743_3246451_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	2.6e-101
WP_000084220.1|3246447_3246954_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_001680743.1|3246950_3247403_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_001218537.1|3247499_3248201_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550496.1|3248204_3249227_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_033567003.1|3249288_3250092_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.8	4.8e-80
WP_045160258.1|3250252_3252028_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	86.1	2.1e-293
WP_000038208.1|3252024_3253086_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
WP_001552031.1|3253082_3253406_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3253379_3253586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045160260.1|3253705_3255727_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.1	1.7e-299
WP_045160261.1|3255723_3256584_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.4	1.1e-130
WP_000551169.1|3256574_3256808_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3256875_3257277_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3257276_3257702_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3257691_3257919_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460878.1|3257928_3258432_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247711.1|3258462_3258684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514631.1|3258827_3259409_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_000568372.1|3259425_3259992_+	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_001145219.1|3259995_3261033_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_045160264.1|3261022_3262804_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	1.1e-07
WP_023993921.1|3263061_3263829_-	siderophore-interacting protein	NA	NA	NA	NA	NA
3262825:3262842	attR	TGTCGCAAAAGTGTCGCA	NA	NA	NA	NA
WP_000983434.1|3264060_3264708_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023993922.1|3264704_3266273_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.4	4.2e-11
WP_001582503.1|3266660_3268181_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_072100844.1|3268610_3269990_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.8	3.8e-32
WP_023993924.1|3270160_3272179_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_000019989.1|3272259_3273396_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_000202966.1|3273481_3273979_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000951045.1|3274130_3274823_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000617682.1|3274911_3275910_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098833.1|3276180_3277149_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_023993925.1|3277403_3278648_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_000422141.1|3279097_3279760_+	DedA family protein	NA	NA	NA	NA	NA
WP_000917512.1|3279763_3280147_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000877297.1|3280291_3280660_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000031219.1|3280701_3281007_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000785626.1|3281009_3281408_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 7
NZ_LN649235	Salmonella enterica subsp. enterica serovar Infantis strain 1326/28 chromosome 1	4710675	4102634	4196343	4710675	tail,integrase,head,capsid,terminase,tRNA,lysis,portal,holin,plate,protease	Salmonella_phage(48.89%)	104	4135443:4135489	4166433:4166479
WP_023993693.1|4102634_4103072_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|4103116_4104058_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259011.1|4104072_4104519_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558166.1|4104515_4104827_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_021294279.1|4104912_4105842_-	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	44.4	1.3e-07
WP_001159630.1|4106059_4106371_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|4106371_4106662_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|4106708_4107638_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|4107634_4108270_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|4108266_4109169_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077248424.1|4109181_4112232_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_001059746.1|4112426_4113263_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710967.1|4113538_4114570_-	YiiG family protein	NA	NA	NA	NA	NA
WP_023994499.1|4114751_4115852_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_045160421.1|4116206_4116530_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|4116529_4117189_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010989088.1|4117271_4117838_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619478.1|4117926_4118241_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009249.1|4118237_4119386_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179690.1|4119512_4120340_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_023993690.1|4120482_4121742_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_023993689.1|4121738_4123208_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|4123495_4124332_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013290.1|4124484_4125333_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063533.1|4125329_4126364_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|4126982_4127666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023993688.1|4127823_4129131_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|4129123_4129639_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_023993687.1|4129657_4130641_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000122632.1|4130969_4131590_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_000133440.1|4132254_4132650_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|4132700_4134074_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|4134070_4134769_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|4134919_4135420_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4135443:4135489	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|4135605_4136586_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|4136655_4136949_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|4137085_4137358_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|4137527_4138028_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_045160429.1|4138091_4138316_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.0e-32
WP_045160431.1|4138315_4138618_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	97.0	2.7e-44
WP_001113264.1|4138617_4138842_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|4138838_4139114_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_045160434.1|4139103_4141371_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	96.4	0.0e+00
WP_045160436.1|4141618_4143838_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000517958.1|4144364_4145411_-|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
WP_045160441.1|4145410_4147180_-|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.8	0.0e+00
WP_045160443.1|4147345_4148200_+|capsid	capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	99.6	4.7e-158
WP_001247243.1|4148276_4149344_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
WP_045160446.1|4149347_4150097_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	96.4	1.4e-126
WP_052680834.1|4150190_4150697_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	99.4	5.0e-91
WP_000868400.1|4150696_4150900_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
WP_000134660.1|4150903_4151200_+|holin	holin	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
WP_045160452.1|4151186_4151684_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	98.8	7.6e-92
WP_000866102.1|4151680_4152094_+|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	100.0	2.6e-45
WP_001394645.1|4152065_4152239_+	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_001169074.1|4152201_4152669_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_045160454.1|4152661_4153114_+	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	91.9	1.9e-65
WP_052680835.1|4153243_4154041_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_045160457.1|4154265_4154907_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	97.7	4.5e-113
WP_045160460.1|4154903_4155251_+	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	99.1	4.2e-57
WP_001728621.1|4155257_4156166_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	99.0	7.7e-159
WP_001000070.1|4156158_4156689_+|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_045160468.1|4156699_4158442_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	93.8	3.4e-256
WP_023171841.1|4158441_4159011_+|tail	tail fiber assembly protein	tail	A0A0M4QWM3	Salmonella_phage	98.9	1.2e-104
WP_001279033.1|4159145_4160333_+|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.5	9.9e-223
WP_001207675.1|4160348_4160867_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_045160472.1|4160929_4161265_+|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	97.3	2.6e-51
WP_085984508.1|4161261_4161417_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_023253866.1|4161409_4163851_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	92.4	0.0e+00
WP_000978862.1|4163865_4164351_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	100.0	3.6e-86
WP_023253865.1|4164347_4165517_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	97.2	1.5e-210
WP_000468311.1|4165594_4165813_+	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000468356.1|4165863_4166271_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	100.0	1.6e-71
WP_001077320.1|4166557_4167460_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4166433:4166479	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|4167644_4168607_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758711.1|4168810_4169800_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750762.1|4169900_4170656_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777314.1|4170920_4172255_+	MFS transporter	NA	NA	NA	NA	NA
WP_021294116.1|4172265_4173225_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557881.1|4173234_4174275_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001528882.1|4174337_4175060_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000060995.1|4175157_4175328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173080.1|4175564_4175915_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_023993656.1|4175928_4177521_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001283049.1|4177607_4178567_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167248.1|4178822_4180358_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_000911133.1|4180351_4181395_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_072100810.1|4181391_4182393_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090737.1|4182421_4183444_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774146.1|4183472_4184348_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001543603.1|4184430_4184721_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_023993654.1|4184730_4185495_+	epimerase	NA	NA	NA	NA	NA
WP_001216339.1|4185586_4186354_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802241.1|4186466_4187063_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|4187163_4187592_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_023993653.1|4187698_4188445_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250624.1|4188541_4189552_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136811.1|4189663_4191172_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|4191192_4192038_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|4192436_4192676_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|4192897_4193383_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139639.1|4193475_4194405_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|4194471_4195803_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|4195812_4196343_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 8
NZ_LN649235	Salmonella enterica subsp. enterica serovar Infantis strain 1326/28 chromosome 1	4710675	4308801	4326705	4710675	tail,plate	Burkholderia_phage(42.11%)	22	NA	NA
WP_023994534.1|4308801_4310556_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	4.2e-52
WP_023993553.1|4310558_4311191_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_023993552.1|4311183_4312299_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|4312289_4312649_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632048.1|4312812_4314360_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_000703634.1|4314359_4315289_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_045160524.1|4315285_4315648_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.0	3.6e-43
WP_000679393.1|4315975_4316698_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000818147.1|4316707_4317751_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	1.9e-76
WP_023993551.1|4317738_4317948_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	2.2e-16
WP_000271425.1|4317947_4318901_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_023993550.1|4318900_4321255_-|tail	tail protein	tail	A4JWL0	Burkholderia_virus	30.4	4.4e-65
WP_001728452.1|4321351_4321480_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001600578.1|4321439_4321757_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4321808_4322333_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_023993549.1|4322332_4323760_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	3.1e-194
WP_023993548.1|4323749_4323947_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	50.0	1.3e-07
WP_023994533.1|4323943_4324399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4324558_4324873_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_023993546.1|4324885_4325491_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	5.5e-60
WP_001226439.1|4325493_4325781_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615248.1|4326357_4326705_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
