The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LM995446	Escherichia coli strain K-12 substr. RV308 chromosome 1	4585620	247636	296320	4585620	transposase,integrase	Streptococcus_phage(20.0%)	49	262122:262181	296430:296489
WP_000006255.1|247636_248134_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|248357_250097_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|250041_250827_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|250897_251953_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|252004_252298_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|252300_252699_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|252708_253161_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|253466_253733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352051.1|253644_254202_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|254258_255716_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|255976_256435_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|256526_257771_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|257828_258230_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|258268_259324_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|259611_260715_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|260726_261980_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
262122:262181	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|262551_262893_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|262913_263231_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|263249_263471_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|263479_263956_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|263971_264430_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|264527_264767_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|264843_265311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|265333_265777_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|265776_266004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|266407_267229_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|267320_268184_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|268512_269406_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|269826_270978_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|273324_274341_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|274548_275952_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|275938_276871_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|276979_278026_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|279247_279586_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|279608_279959_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|280052_281207_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|281501_282410_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|282424_284392_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|284618_286001_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|286012_287623_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|287627_288386_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|288524_289529_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|290723_291455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|291545_292172_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|292443_293142_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|293168_294023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|294141_294366_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|294362_294803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|294919_296320_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
296430:296489	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_LM995446	Escherichia coli strain K-12 substr. RV308 chromosome 1	4585620	482143	545880	4585620	lysis,protease,tRNA,terminase,transposase,integrase	Enterobacteria_phage(51.85%)	64	528538:528584	549840:549886
WP_001295836.1|482143_482767_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|482737_483424_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|483420_485835_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000877768.1|490586_490955_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|491645_491906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297301.1|491962_492136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|493137_494232_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|494300_495227_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|495456_495939_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|496016_496832_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|496921_498703_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|498715_499492_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|499591_500470_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|500638_502093_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|502152_503514_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|503570_504872_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|504893_506039_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|506266_507052_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|507062_508298_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|508319_509369_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|509685_511353_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|511362_512622_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|512632_513448_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|513444_514338_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|514532_515600_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|515596_516106_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|516223_516946_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|516948_517443_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|517616_519002_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|519037_519559_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|519666_519879_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|519880_520747_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|521217_521760_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|521979_522672_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001350487.1|526061_527102_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|527112_527628_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|527630_528263_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
528538:528584	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|528597_529761_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|529880_530144_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|530466_530562_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|530624_531786_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|532097_532430_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|532477_532627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|532684_534211_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|534675_535227_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|535236_536034_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|536150_536252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|536248_536704_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|536703_536874_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|536866_537157_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|537153_537516_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|537512_537653_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|537738_538122_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|538519_539536_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|539540_540608_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|541180_541396_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|541395_541893_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|542109_542292_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|542382_542676_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|542966_543377_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|543662_543869_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|544033_544228_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|544616_545162_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|545136_545880_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
549840:549886	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_LM995446	Escherichia coli strain K-12 substr. RV308 chromosome 1	4585620	1355459	1419406	4585620	lysis,tail,tRNA,transposase	Escherichia_phage(40.62%)	60	NA	NA
WP_000628058.1|1355459_1356692_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1356946_1357930_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1358407_1359781_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1359909_1360845_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1360896_1362132_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1362133_1362349_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1362427_1362637_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1362629_1362824_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1362880_1363690_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1363682_1366283_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1366384_1366660_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1366734_1366905_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1366904_1367126_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1367567_1368056_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1368052_1368208_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1368661_1369138_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1369261_1369558_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1369580_1370003_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1370015_1370873_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1370879_1371626_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1371648_1372209_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1372296_1372482_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1372678_1374136_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1374273_1374537_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1374517_1374877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1376642_1377623_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_000279097.1|1377945_1381308_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1381307_1381883_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1381980_1382571_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1382887_1383121_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1383189_1383303_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1384081_1384516_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1384656_1385790_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_000628244.1|1386156_1389681_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1389954_1390221_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|1390217_1390640_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|1390750_1391740_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_000900941.1|1391947_1394587_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|1394583_1394769_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|1394776_1395103_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|1395274_1396180_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|1396415_1397915_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|1397972_1400246_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|1400493_1402539_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|1402823_1403753_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|1403764_1404052_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|1404060_1404807_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|1404821_1405319_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|1405326_1406397_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|1406393_1407161_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|1407160_1407949_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|1407950_1409378_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|1409367_1409790_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|1409789_1410995_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|1411021_1412335_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|1412435_1413386_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|1413367_1413958_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|1414061_1414127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|1416817_1418046_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001254932.1|1418254_1419406_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 4
NZ_LM995446	Escherichia coli strain K-12 substr. RV308 chromosome 1	4585620	1578349	1597560	4585620	lysis,tail	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1578349_1579810_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1579898_1581182_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1581786_1581900_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1581968_1582202_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1582518_1583109_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1583206_1583782_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1583781_1584744_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1584694_1585264_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1585652_1585886_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1585943_1586354_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1586505_1586679_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1586850_1587006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1587084_1587150_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1587152_1587341_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1587351_1587564_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1587926_1588424_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1588420_1588954_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1588950_1589262_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1589266_1589482_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1590235_1590451_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1590751_1590964_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1591018_1591108_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1591385_1592138_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1592151_1593201_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1593202_1593481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1593547_1593799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1594015_1594171_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1594242_1594530_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1594529_1594769_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1594793_1595099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1595301_1595634_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1596070_1596220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1596516_1596747_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1596830_1597238_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1597404_1597560_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 5
NZ_LM995446	Escherichia coli strain K-12 substr. RV308 chromosome 1	4585620	2413357	2425828	4585620	tail,transposase,integrase	Enterobacteria_phage(46.67%)	16	2411332:2411348	2429503:2429519
2411332:2411348	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2413357_2414290_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2414601_2415759_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2415911_2416274_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_085947771.1|2416422_2417584_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001030215.1|2418448_2419780_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2419814_2420096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2420394_2420835_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2420861_2421380_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2421429_2421705_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2421704_2422199_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2422921_2423284_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2423349_2424174_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2424301_2424838_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2424828_2425191_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2425190_2425496_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2425627_2425828_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2429503:2429519	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 6
NZ_LM995446	Escherichia coli strain K-12 substr. RV308 chromosome 1	4585620	2799617	2806756	4585620		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2799617_2802179_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2802284_2802941_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2802991_2803759_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2803954_2804863_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2804859_2806026_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2806117_2806756_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
