The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	7736	50019	5016623	protease,transposase	Ralstonia_phage(33.33%)	40	NA	NA
WP_011407164.1|7736_8573_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_044756151.1|8759_9566_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9842_11036_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_173425345.1|11303_11858_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11942_12704_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12750_13173_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13176_13590_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257017.1|13885_14653_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14663_14933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257019.1|15007_16468_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_162531722.1|16640_16805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257020.1|17114_18125_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18396_19599_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19740_21879_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22089_22383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22414_22912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23158_24139_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|24186_25353_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_011257026.1|25499_26066_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011257028.1|27540_28758_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29385_30408_-	sugar kinase	NA	NA	NA	NA	NA
WP_080493590.1|30988_32242_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_094187708.1|32315_33113_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157724563.1|33100_34075_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012443571.1|34959_35622_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_044756160.1|35775_36570_-	EcsC family protein	NA	NA	NA	NA	NA
WP_027704023.1|36737_37211_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|39541_40498_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756163.1|40545_41457_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257041.1|41943_42342_-	host attachment protein	NA	NA	NA	NA	NA
WP_044756164.1|42433_43126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|43295_43766_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257044.1|43881_44058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407233.1|45232_45544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756166.1|45798_46746_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	4.3e-43
WP_044756167.1|46886_47945_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011257048.1|48083_48365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|48417_48678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168735.1|48745_48955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445831.1|49038_50019_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
>prophage 2
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	85751	143096	5016623	transposase	Acidithiobacillus_phage(25.0%)	41	NA	NA
WP_044749647.1|85751_87128_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182539.1|87293_88847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257097.1|91060_91402_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_041182843.1|91586_94145_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011407204.1|94163_94424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703735.1|95253_97161_-	ABC transporter substrate-binding protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.9e-34
WP_011257102.1|97218_98160_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_041182540.1|98352_99717_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257104.1|99713_101342_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_027703733.1|101815_103399_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_044756187.1|103395_105630_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_011257107.1|105632_107390_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_094187819.1|107446_109336_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_027703731.1|109332_111942_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|111964_112150_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257110.1|112264_114427_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_027703730.1|114443_115076_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_075244499.1|115239_115737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407197.1|115877_116924_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_041182545.1|118319_119276_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_125168734.1|119328_119607_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_115862254.1|119603_120569_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012443633.1|120663_121677_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_080256644.1|124174_124633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|124632_124965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|124981_125242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173425333.1|126061_126268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|126565_127975_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_011407187.1|128323_128755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443638.1|129029_129365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407184.1|129804_131094_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_012443641.1|131712_132693_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.0	1.0e-87
WP_012443642.1|133158_133482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443643.1|133423_133666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|134041_135007_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756190.1|136678_138055_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_129215536.1|138656_139364_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.6e-05
WP_070344074.1|139360_140632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128415443.1|140746_141652_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_133264932.1|141655_142072_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_044756191.1|142139_143096_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	6.2e-42
>prophage 3
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	177794	448666	5016623	tail,transposase,tRNA	Staphylococcus_prophage(11.76%)	176	NA	NA
WP_115862255.1|177794_178760_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_027703863.1|183159_184218_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_041181912.1|184432_184960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464354.1|185782_187966_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_011407267.1|187977_191328_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011257178.1|191324_194441_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011407587.1|196368_197403_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_094187821.1|200100_200280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080494036.1|200282_200609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443686.1|200678_200792_+	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_044756212.1|200874_202350_+|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	1.4e-101
WP_012443690.1|203958_205479_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|205495_205774_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257186.1|205963_206302_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012443692.1|206914_208900_+	beta-N-acetylglucosaminidase domain-containing protein	NA	NA	NA	NA	NA
WP_041182297.1|209531_210494_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011257188.1|210899_211712_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|211904_212516_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257190.1|212932_213790_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_012443696.1|214027_215914_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_044756215.1|218245_220969_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	6.3e-71
WP_044757283.1|221036_223190_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.6e-27
WP_044756216.1|223186_224878_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_012443704.1|225413_227318_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|227578_227758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756221.1|227891_228359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|228516_229476_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_044756223.1|229460_230078_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|230120_230540_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_012443706.1|230792_231698_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.5	2.6e-37
WP_011257202.1|231946_232831_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|232894_233677_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|233721_234483_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|234646_234976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|235294_236386_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|236454_238053_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|238217_239462_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_044756226.1|239913_240543_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	2.6e-52
WP_011257211.1|240749_242726_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|244113_244779_-	YceH family protein	NA	NA	NA	NA	NA
WP_044756232.1|245065_246076_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|246072_246804_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_044756234.1|247157_248687_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.3e-46
WP_011407300.1|248796_251829_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044756235.1|252127_255166_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|255330_256383_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_075239519.1|256551_256797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|256795_257761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756236.1|257760_260424_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_044756238.1|260620_261601_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_008573820.1|262241_262445_-	YdcH family protein	NA	NA	NA	NA	NA
WP_082322966.1|263905_265090_-|transposase	IS256-like element IS1113 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_082322873.1|265140_265818_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756239.1|265814_266357_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_044756241.1|266353_267172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143690736.1|267168_267393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|267457_268414_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_044756245.1|268677_268857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|269243_270200_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_011409779.1|272299_273337_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011409777.1|275030_275876_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.7	3.7e-06
WP_011260788.1|276035_277241_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_011409775.1|277293_277626_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409774.1|277674_278412_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	1.5e-19
WP_027704185.1|278408_279881_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_044756247.1|280167_281349_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011409772.1|281420_282704_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_012443732.1|282700_283687_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_011260781.1|283731_285009_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011260780.1|285005_285626_-	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	41.9	1.9e-07
WP_012443733.1|285768_289476_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_033013610.1|289670_290033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443735.1|290129_290306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260776.1|290567_291485_+	AEC family transporter	NA	NA	NA	NA	NA
WP_011409768.1|291837_292470_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	36.6	1.6e-09
WP_027704183.1|292485_292962_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011260773.1|292965_293538_+	YceI family protein	NA	NA	NA	NA	NA
WP_011260772.1|293534_295550_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_011260771.1|295834_296263_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_011409766.1|296382_297186_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011260769.1|297245_298235_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_044756250.1|298648_300721_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011409764.1|300915_301527_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011260766.1|302680_303487_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_011260765.1|303623_304421_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_011260764.1|304642_306052_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011409761.1|306323_306668_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_027704182.1|306690_308133_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	2.0e-31
WP_011260761.1|308403_309459_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011409760.1|309451_310879_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_027704181.1|311377_311980_+	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	7.7e-14
WP_027704180.1|312050_312683_+	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
WP_115862256.1|312965_313931_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260755.1|314018_314555_-|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_011260754.1|314613_315141_-|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011409756.1|315209_315755_-|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_044756255.1|322109_323345_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_133260594.1|324572_324875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756261.1|324910_328324_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_044756262.1|328320_332394_+	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_044756263.1|332581_334834_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.7	6.7e-10
WP_011260747.1|334928_335210_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_011260746.1|335227_335518_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_011260745.1|336456_337851_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260743.1|338300_338633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756265.1|338968_339193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260742.1|339330_339765_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011260741.1|339767_340244_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011260740.1|340236_340569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013300.1|340667_341363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013299.1|341359_342118_+	immunity 52 family protein	NA	NA	NA	NA	NA
WP_011260739.1|342326_342575_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042465346.1|342736_343003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260735.1|344819_345683_+	DUF2884 family protein	NA	NA	NA	NA	NA
WP_011409738.1|345931_346360_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_011260733.1|346461_346920_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041182856.1|348386_349343_-|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	6.9e-41
WP_109182069.1|349445_350765_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187713.1|350893_351691_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260727.1|351724_352405_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_012443767.1|352497_353574_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260725.1|353583_354705_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_113090107.1|354770_355760_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010374782.1|357532_357709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187716.1|358584_359383_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260718.1|359799_360834_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409728.1|360865_362353_-	MFS transporter	NA	NA	NA	NA	NA
WP_044756270.1|362451_365385_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012443772.1|365846_367148_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756273.1|368564_369542_+	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_044756275.1|369582_371001_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_012443777.1|371227_372283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260709.1|373260_374733_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_041182521.1|374955_377607_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260707.1|377672_379373_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409724.1|379372_380632_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_041182560.1|380643_382608_-	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409722.1|382604_384800_-	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409721.1|384975_386043_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011259480.1|386268_387606_-	xylose isomerase	NA	NA	NA	NA	NA
WP_012443789.1|388209_389127_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	4.1e-83
WP_011260701.1|389190_390096_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	3.1e-43
WP_011409719.1|390722_391508_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409718.1|391778_392237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409716.1|393170_394136_-	ferrochelatase	NA	NA	NA	NA	NA
WP_011409715.1|394290_395193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003484969.1|395265_395493_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_044756277.1|395508_396150_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_011260694.1|396146_396902_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_012443793.1|397053_397953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409712.1|398012_398765_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_094187718.1|399308_400107_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756280.1|400247_409031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260689.1|409424_411239_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_012443796.1|411328_412237_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011260687.1|412526_414764_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_044756282.1|414763_416365_+	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_171970771.1|416617_419317_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	36.2	4.1e-147
WP_011409702.1|420881_421976_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409701.1|422054_422717_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_044756284.1|422933_423659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260681.1|423757_425071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260680.1|425185_426511_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_011260679.1|426572_426959_+	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_044756287.1|427049_428768_-	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011409699.1|429039_429558_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_075239745.1|430676_430988_+	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_044756291.1|432612_432954_+	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_012443812.1|432996_433185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409694.1|433515_434136_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260670.1|434264_435428_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011260669.1|435438_437049_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260668.1|437291_439319_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260667.1|439418_441503_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_041182545.1|443537_444494_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_115862257.1|447346_448666_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	578852	704741	5016623	transposase,tRNA	Ralstonia_phage(18.75%)	99	NA	NA
WP_011409614.1|578852_579995_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
WP_044756340.1|583218_585057_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011409612.1|585231_585498_+	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011409611.1|585523_586069_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_012443910.1|586540_587848_+	MFS transporter	NA	NA	NA	NA	NA
WP_011409609.1|587986_589246_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_044749647.1|589487_590864_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_027703952.1|591193_591727_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756341.1|591737_593114_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	8.6e-77
WP_011260548.1|593348_593507_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_012443914.1|593571_594582_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.2	4.5e-14
WP_011260546.1|594810_596481_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409606.1|596799_597183_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260544.1|597404_598307_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_082322967.1|598303_600799_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_011260542.1|600806_602438_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_011260541.1|602434_603598_-	Fic family protein	NA	NA	NA	NA	NA
WP_011260540.1|603669_604686_-	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010370565.1|604787_605108_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_044756345.1|605493_605955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756347.1|605981_606458_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011260537.1|606799_608023_-	MFS transporter	NA	NA	NA	NA	NA
WP_011260536.1|608127_608739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409603.1|608840_609590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756348.1|609780_611127_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756350.1|611111_612554_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_173425346.1|612603_614313_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_044756353.1|614689_615286_+	Ax21 family protein	NA	NA	NA	NA	NA
WP_044756355.1|615608_616634_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_044756356.1|616649_617165_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011260528.1|617274_617709_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_044756357.1|617784_618207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703675.1|618235_618706_-	YiiD C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_027703859.1|620877_622245_+	VOC family protein	NA	NA	NA	NA	NA
WP_011409597.1|622534_625675_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011260521.1|625808_629057_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012443931.1|629149_630394_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011409596.1|630653_631970_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011260517.1|632728_633544_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_082322968.1|634011_635196_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	2.9e-41
WP_044756360.1|635337_636573_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407513.1|636641_637031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|637419_638376_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109181928.1|638411_639377_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407516.1|640615_641338_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-16
WP_027703875.1|641348_642785_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_012443983.1|642784_644053_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011407519.1|644142_646284_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011407520.1|646368_647034_-	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_011257531.1|647030_647705_-	OmpA family protein	NA	NA	NA	NA	NA
WP_027703874.1|647701_650359_-	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_012443985.1|650369_651107_-	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
WP_011257534.1|651445_651658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257535.1|652099_652321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862259.1|653105_654425_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260472.1|654676_656425_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_012443989.1|656514_657477_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011409565.1|659058_659430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409564.1|659770_660217_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_002808376.1|660524_660740_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011260469.1|661019_662084_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
WP_011409563.1|662162_662519_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260467.1|662746_664918_+	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|665580_666546_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756360.1|667061_668297_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044756364.1|668712_669675_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182297.1|670454_671417_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182296.1|672412_673591_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_041182719.1|673757_674714_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_011260461.1|674823_675258_+	membrane protein	NA	NA	NA	NA	NA
WP_011260459.1|675818_676100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704068.1|677125_678442_-	amino acid permease	NA	NA	NA	NA	NA
WP_011260456.1|678438_679215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182294.1|679891_680854_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|681073_681871_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703925.1|682026_683124_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_012444005.1|683120_684533_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_044756368.1|684756_685563_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011258802.1|685625_686594_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_012444006.1|686815_687562_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260450.1|687868_688066_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011260449.1|688276_688654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409547.1|688879_689221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182719.1|689333_690290_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_173425347.1|690518_690926_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011260446.1|690963_691716_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011258188.1|691841_692810_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409543.1|693013_693589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465763.1|693713_694331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115862261.1|694373_695171_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260442.1|695179_695989_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_012444011.1|696164_696968_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_027703938.1|697071_698049_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_011260439.1|698045_699311_+	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409538.1|699736_700261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703939.1|700390_701686_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_027703940.1|701775_702660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260435.1|702862_703243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182581.1|703775_704741_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	779713	840220	5016623	protease,transposase	Organic_Lake_phycodnavirus(28.57%)	45	NA	NA
WP_094187781.1|779713_780511_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260378.1|780691_782341_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_033013308.1|784144_786082_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_044756406.1|786233_786902_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260375.1|786906_787959_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011409485.1|787989_788727_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_044756408.1|788757_789672_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011260372.1|790222_791023_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011260371.1|791581_792547_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260370.1|792655_793225_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011409482.1|793612_793924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|793991_796085_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_103073476.1|796158_796599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409479.1|796924_798109_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_027703683.1|798288_800424_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_044757316.1|800767_801166_+	YbaN family protein	NA	NA	NA	NA	NA
WP_044756411.1|801223_801460_+	lipoprotein	NA	NA	NA	NA	NA
WP_011260363.1|801449_802304_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011409476.1|802300_802972_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_044757318.1|803177_804095_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	2.2e-12
WP_011260360.1|804610_805162_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011260359.1|805303_806671_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260358.1|806844_807468_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409473.1|807767_808487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444089.1|808658_810671_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409471.1|810792_811683_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011409470.1|811855_812617_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_011260353.1|814361_815438_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027703680.1|816688_817189_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260350.1|817185_817641_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_094187721.1|818781_819580_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|819635_820604_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044756415.1|820844_821777_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_012444096.1|822053_823100_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	4.6e-06
WP_044756417.1|823272_824619_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_044756419.1|824615_825101_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_012444099.1|825104_827165_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011260340.1|827161_828280_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_012444101.1|829041_830028_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_082322882.1|830087_831572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756423.1|831568_832648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075242513.1|833601_834087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444102.1|834083_835163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260337.1|835138_837295_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_044756425.1|838843_840220_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
>prophage 6
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	871861	926920	5016623	transposase	Herpes_simplex_virus(16.67%)	35	NA	NA
WP_044756431.1|871861_873097_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260307.1|873828_876519_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_076659517.1|876669_877203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076659519.1|877287_879567_+	DUF4982 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	28.6	5.5e-20
WP_011409433.1|882134_883301_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_012444126.1|883560_884283_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703724.1|884327_885605_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_012444129.1|885645_886713_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011260300.1|886719_887748_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_044756434.1|887750_888905_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_044756435.1|889324_889930_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011260297.1|889926_891180_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011409429.1|891181_893080_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011409428.1|893081_895124_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_012444134.1|895749_895980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182013.1|896441_897407_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|903011_904244_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_144408318.1|904808_905153_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187777.1|905890_906688_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187776.1|906742_907495_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044749647.1|907505_908882_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_012444143.1|909991_910258_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041182545.1|910901_911858_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756446.1|912070_914644_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011409419.1|914766_915756_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011409416.1|917684_918422_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260284.1|918471_919287_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409415.1|919378_920029_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_044756449.1|920122_920920_-	cytochrome c4	NA	NA	NA	NA	NA
WP_024712536.1|921064_921688_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_012444150.1|921782_922478_-	VIT family protein	NA	NA	NA	NA	NA
WP_012444151.1|922693_924058_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_075239687.1|924244_924883_-	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	1.9e-10
WP_075239943.1|924887_925151_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_173425349.1|925108_926920_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	1039024	1105339	5016623	transposase,tRNA	Tupanvirus(15.38%)	59	NA	NA
WP_094187728.1|1039024_1039823_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260188.1|1040023_1040377_-	DMT family protein	NA	NA	NA	NA	NA
WP_044756474.1|1041341_1042181_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	2.6e-28
WP_027704204.1|1043272_1044190_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_044756475.1|1044503_1046987_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_044756477.1|1046983_1047583_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-26
WP_011260184.1|1047692_1048361_+	arylesterase	NA	NA	NA	NA	NA
WP_002811889.1|1048452_1049166_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	2.5e-27
WP_011409346.1|1049308_1050580_+	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.2	1.3e-10
WP_044756480.1|1051153_1051855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409344.1|1052037_1052418_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_011409343.1|1052513_1053152_+	LemA family protein	NA	A0A0C5K8T5	Enterococcus_phage	25.4	2.5e-07
WP_044756482.1|1053489_1054380_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_011260174.1|1054379_1054871_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_011260173.1|1054925_1055816_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_011260172.1|1055812_1056607_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	67.8	3.0e-106
WP_027704106.1|1056673_1056961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260171.1|1056957_1057452_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	46.9	3.0e-24
WP_011260170.1|1057505_1058462_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	S4TNS0	Salmonella_phage	25.3	1.3e-07
WP_011260169.1|1058490_1058874_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_011260168.1|1058910_1059699_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011409339.1|1059955_1060927_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_011409338.1|1060947_1062339_-	chaperone SurA	NA	NA	NA	NA	NA
WP_011409337.1|1062335_1064777_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_011409336.1|1064904_1065813_-	histone deacetylase family protein	NA	A0A2K9L2T7	Tupanvirus	30.8	3.4e-37
WP_011260163.1|1065850_1066408_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011409335.1|1066411_1066990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409334.1|1067288_1068497_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_011409333.1|1068493_1069675_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_011409332.1|1069802_1070615_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_109182116.1|1071251_1072217_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409329.1|1073300_1074197_+	gallate dioxygenase	NA	NA	NA	NA	NA
WP_011409327.1|1074633_1075635_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756484.1|1075819_1077298_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	1.4e-40
WP_011409325.1|1077500_1078970_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409324.1|1079053_1079881_-	p-hydroxycinnamoyl CoA hydratase/lyase	NA	NA	NA	NA	NA
WP_011260149.1|1079926_1080400_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409323.1|1080527_1080935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703838.1|1081134_1081857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409321.1|1081939_1082845_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_012444247.1|1083039_1084149_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011409319.1|1084470_1085514_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_011409318.1|1085550_1086111_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011409317.1|1086110_1086521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057260.1|1086878_1087580_-	DMT family transporter	NA	NA	NA	NA	NA
WP_157724585.1|1089035_1089239_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059317428.1|1090918_1091104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260138.1|1091296_1093036_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	54.8	9.9e-179
WP_012444256.1|1093440_1094082_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012444257.1|1094083_1094320_+	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_011409313.1|1094434_1094899_-	response regulator	NA	NA	NA	NA	NA
WP_011260134.1|1094895_1095726_-	response regulator	NA	A0A2K9L5I4	Tupanvirus	38.5	3.4e-12
WP_094187708.1|1095722_1096521_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187801.1|1096574_1097373_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756485.1|1098492_1099200_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_044756487.1|1099720_1100935_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	8.2e-55
WP_011409288.1|1101295_1101946_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_011260092.1|1102361_1102940_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_109182002.1|1104373_1105339_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	1192241	1203068	5016623	transposase	Burkholderia_phage(28.57%)	8	NA	NA
WP_082322974.1|1192241_1193198_+|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	3.1e-41
WP_171970781.1|1194598_1195666_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	38.2	1.3e-61
WP_044756504.1|1195680_1196751_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	9.7e-60
WP_011260011.1|1196758_1197454_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.8e-36
WP_011260010.1|1197450_1197900_-	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_044757335.1|1198229_1201184_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.1	8.1e-258
WP_027703308.1|1201651_1201834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465718.1|1202264_1203068_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
>prophage 9
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	1220367	1299397	5016623	transposase,plate	Microcystis_virus(33.33%)	56	NA	NA
WP_094187731.1|1220367_1221166_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259994.1|1221220_1222417_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010371538.1|1222416_1223058_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011259992.1|1223408_1224590_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_027703302.1|1224671_1225058_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_011259990.1|1225060_1225735_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011259989.1|1225798_1226596_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_011259988.1|1226726_1226906_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_011259987.1|1226902_1227187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409230.1|1227803_1229006_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_011409229.1|1230022_1230763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259982.1|1230962_1231841_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	35.5	1.3e-06
WP_011409228.1|1231950_1232211_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_044756512.1|1232270_1233752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259979.1|1237500_1238484_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_044756514.1|1238480_1239311_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011409224.1|1239363_1240437_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_044756517.1|1244346_1247412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756518.1|1247559_1248519_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_075242163.1|1248586_1249153_+	DNA repair protein	NA	NA	NA	NA	NA
WP_044756521.1|1249209_1250166_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.2e-16
WP_044756522.1|1250351_1253015_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	3.0e-41
WP_011409221.1|1253014_1253911_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075240218.1|1253907_1254372_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011409218.1|1254395_1254875_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075239710.1|1254961_1256704_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011259969.1|1256785_1257331_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_044756523.1|1257317_1260383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409215.1|1260435_1261398_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.2e-16
WP_044756524.1|1261583_1264253_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	5.1e-41
WP_044756525.1|1264249_1265074_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044756527.1|1265066_1265681_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_094187763.1|1266154_1266952_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044757342.1|1267542_1268091_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044756529.1|1268090_1270322_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011259961.1|1270302_1270692_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_094187774.1|1271959_1273062_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-44
WP_041183127.1|1273152_1273716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756533.1|1273877_1276919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756534.1|1276943_1279481_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_173425335.1|1279491_1280283_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_044756538.1|1281145_1282225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322887.1|1282221_1283700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322889.1|1283759_1286219_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_125168764.1|1286227_1286803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242365.1|1286777_1287755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756541.1|1287751_1290469_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_173425336.1|1290479_1291271_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011409207.1|1291267_1292602_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011409206.1|1292753_1293362_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011259945.1|1293622_1294237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259944.1|1294283_1294784_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011259943.1|1294787_1296284_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1296425_1296923_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259942.1|1297070_1297559_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_014502420.1|1297561_1299397_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	1368450	1422351	5016623	transposase	Ralstonia_phage(12.5%)	35	NA	NA
WP_011258802.1|1368450_1369419_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182069.1|1369618_1370938_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082323169.1|1371029_1372010_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044756568.1|1372147_1374988_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_044756570.1|1374984_1376343_+	DUF3999 domain-containing protein	NA	NA	NA	NA	NA
WP_027704219.1|1376676_1377852_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_011259886.1|1377848_1378493_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409145.1|1378749_1380216_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_011259884.1|1380812_1381817_+	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	48.2	3.9e-79
WP_041182225.1|1382018_1382558_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	42.6	9.9e-29
WP_011259882.1|1382753_1383260_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_011259881.1|1383566_1384526_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.0	3.8e-79
WP_075240596.1|1384542_1385748_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_044756573.1|1385915_1386899_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756574.1|1386909_1387191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445617.1|1388260_1389457_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_012445616.1|1389778_1390216_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_041182223.1|1390410_1392414_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012445614.1|1392413_1394006_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_044756578.1|1394141_1394867_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_011409143.1|1394863_1396585_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_011409142.1|1396693_1398541_-	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_011259870.1|1398721_1399630_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_027704223.1|1399692_1401606_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.6	5.4e-29
WP_011409140.1|1402040_1403111_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259867.1|1403107_1406233_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	7.0e-74
WP_041182725.1|1406584_1409254_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	48.3	1.8e-240
WP_109182116.1|1410133_1411099_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|1412446_1413358_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_044756585.1|1415219_1415525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182719.1|1416084_1417041_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_080494023.1|1417034_1418669_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_012445603.1|1419079_1419502_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_011259859.1|1419562_1420276_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_094187763.1|1421553_1422351_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	1427053	1494128	5016623	protease,transposase,tRNA	Ralstonia_phage(50.0%)	49	NA	NA
WP_011259853.1|1427053_1427812_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011409125.1|1428113_1428908_-	thiazole synthase	NA	NA	NA	NA	NA
WP_011259851.1|1429443_1429644_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_012445601.1|1429834_1431619_+	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_027704094.1|1436084_1436477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409118.1|1436567_1436960_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_094187763.1|1436992_1437791_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_048488802.1|1439422_1439755_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011409560.1|1439809_1440772_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115840192.1|1440881_1441847_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|1441991_1442960_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011409116.1|1443510_1445643_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_115862263.1|1446832_1447798_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_012445397.1|1448323_1449292_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
WP_011407913.1|1449628_1450843_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_115862264.1|1450930_1452250_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259831.1|1452340_1452532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409111.1|1452499_1453513_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259829.1|1453546_1453780_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_109181988.1|1456044_1457010_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409108.1|1457309_1457759_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_012445586.1|1458014_1458872_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011259826.1|1459076_1459688_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011259825.1|1459760_1462403_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_044756603.1|1462916_1463552_+	lipoprotein	NA	NA	NA	NA	NA
WP_011259823.1|1463574_1464603_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011409104.1|1464599_1465499_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1465555_1465972_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_011259821.1|1465983_1467099_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_012445580.1|1467424_1467604_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_044756605.1|1468188_1468659_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_012445578.1|1470074_1473188_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_094187763.1|1473486_1474285_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1474569_1475538_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109182069.1|1475750_1477070_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259816.1|1477148_1477883_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_011409098.1|1478021_1478594_+	Maf-like protein	NA	NA	NA	NA	NA
WP_011259814.1|1478593_1480093_+	ribonuclease G	NA	NA	NA	NA	NA
WP_044756607.1|1480240_1484161_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_027704199.1|1484166_1484919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259808.1|1485017_1486463_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_044756609.1|1486719_1487301_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_012445571.1|1487446_1488814_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_069959944.1|1488810_1489131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445570.1|1489103_1489292_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_027704198.1|1489343_1489808_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_044756613.1|1491654_1492530_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011259802.1|1492531_1492792_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_044756614.1|1492823_1494128_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	1625605	1694593	5016623	transposase	Acinetobacter_phage(40.0%)	45	NA	NA
WP_041182468.1|1625605_1626688_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_024743012.1|1629478_1630015_-	lipocalin family protein	NA	A0A2I2L3Z7	Orpheovirus	33.8	4.0e-14
WP_094187768.1|1631528_1632554_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_094187731.1|1632697_1633495_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756654.1|1633482_1633971_-	BrxE family protein	NA	NA	NA	NA	NA
WP_011259682.1|1634002_1634323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409027.1|1634657_1635257_+	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011259680.1|1635253_1636177_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_033013473.1|1636256_1636505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143681140.1|1636710_1637196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259679.1|1637192_1637435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259678.1|1637859_1638369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154215184.1|1640712_1640934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703322.1|1644563_1644842_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_011259671.1|1644865_1645939_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_027703321.1|1646417_1648034_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_011409015.1|1648238_1648955_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409014.1|1649112_1650051_+	proline racemase family protein	NA	NA	NA	NA	NA
WP_011259667.1|1650050_1651313_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259666.1|1651309_1651555_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011259665.1|1651526_1652861_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044756657.1|1652857_1653766_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_044756659.1|1653976_1655593_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_044756660.1|1655589_1656789_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_044756661.1|1656906_1658739_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_044756662.1|1658735_1660601_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_044757373.1|1660663_1662250_+	amino acid permease	NA	NA	NA	NA	NA
WP_044756663.1|1662239_1664579_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_027703320.1|1664575_1664863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756665.1|1664918_1665110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756667.1|1665076_1665316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756671.1|1665952_1666297_+	DUF5597 domain-containg protein	NA	NA	NA	NA	NA
WP_011409006.1|1666293_1666590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756673.1|1666796_1668368_-	S8/S53 family peptidase	NA	A0A1V0SLL0	Klosneuvirus	37.6	2.3e-70
WP_044756675.1|1668831_1671189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182199.1|1671710_1674527_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	2.4e-49
WP_044756677.1|1674765_1679130_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_033013184.1|1679126_1680713_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_044756679.1|1681034_1683380_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011408999.1|1683876_1684308_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_044756681.1|1684304_1684886_+	TonB-dependent receptor plug domain-containing protein	NA	A0A0P0I887	Acinetobacter_phage	33.2	1.7e-10
WP_044756683.1|1688208_1690584_+	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_094187766.1|1690698_1691497_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862265.1|1692336_1693302_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182719.1|1693636_1694593_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
>prophage 13
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	1702288	1765652	5016623	transposase,plate	Ralstonia_phage(42.86%)	50	NA	NA
WP_115862266.1|1702288_1703254_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182195.1|1703618_1703798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296740.1|1703829_1703988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756692.1|1704237_1705200_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408980.1|1705452_1706436_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011408979.1|1706875_1707133_+	stress-induced protein	NA	NA	NA	NA	NA
WP_011257310.1|1708431_1709667_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_173425338.1|1710423_1711077_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_044756695.1|1711563_1712856_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011259625.1|1712839_1714102_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408975.1|1714113_1714545_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408974.1|1714603_1714969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408973.1|1715068_1715830_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012445389.1|1716051_1716699_+	response regulator	NA	NA	NA	NA	NA
WP_173425339.1|1718091_1721802_-	ribonuclease E	NA	NA	NA	NA	NA
WP_011259619.1|1722203_1723190_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_011259618.1|1723222_1725046_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_011408968.1|1725361_1725622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408967.1|1725648_1725882_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_011259617.1|1725897_1726320_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408966.1|1726316_1726673_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011408965.1|1726761_1727361_+	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_041182192.1|1727374_1729198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756697.1|1729855_1732690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|1732720_1733464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756990.1|1735368_1736325_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.6	6.2e-42
WP_044749647.1|1736780_1738157_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_144408321.1|1738149_1738386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409560.1|1738399_1739362_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_042465640.1|1739518_1740265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756701.1|1740282_1742274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|1742326_1743283_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756703.1|1743302_1744538_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1744686_1745655_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109182069.1|1745854_1747174_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_024711387.1|1748490_1748997_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_044756705.1|1748989_1750504_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011259605.1|1750603_1751107_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259604.1|1751142_1751976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259603.1|1751963_1752467_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012444494.1|1752470_1754348_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_044756708.1|1754311_1755322_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_044756710.1|1755354_1758060_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.5e-80
WP_027703476.1|1758248_1758746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|1758811_1759306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408952.1|1759694_1760153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|1760417_1762355_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408951.1|1762363_1762903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756713.1|1762899_1764318_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_044756715.1|1764314_1765652_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 14
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	1875350	1887125	5016623	tRNA	Pseudomonas_phage(22.22%)	12	NA	NA
WP_011408886.1|1875350_1877027_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
WP_011408885.1|1877115_1877757_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408884.1|1877929_1878964_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_012444556.1|1879266_1879755_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_044756742.1|1879856_1882505_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_003481884.1|1882644_1882857_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_103057523.1|1883459_1883987_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	57.4	1.2e-34
WP_012444559.1|1884374_1884674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756743.1|1884859_1885555_+	DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_011259505.1|1885559_1886309_+	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011259504.1|1886552_1886783_+	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259503.1|1886825_1887125_+	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
>prophage 15
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	1912215	1988546	5016623	transposase,tRNA	uncultured_Caudovirales_phage(35.29%)	53	NA	NA
WP_044756746.1|1912215_1913190_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.2	6.0e-32
WP_069960338.1|1913258_1913624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259476.1|1914516_1915083_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_011259475.1|1915204_1915975_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	3.4e-14
WP_011408867.1|1916113_1917010_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	32.7	8.5e-33
WP_011259473.1|1917080_1917470_-	VOC family protein	NA	NA	NA	NA	NA
WP_011259472.1|1917466_1918264_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011408865.1|1918378_1918627_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_011408864.1|1918623_1920483_+	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259469.1|1920484_1920739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408863.1|1920798_1921023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259467.1|1921050_1921359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259466.1|1921592_1922795_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_011259465.1|1922791_1923511_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_044756747.1|1924736_1925453_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_011259464.1|1925692_1926817_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	7.8e-44
WP_012444585.1|1926816_1927260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259463.1|1927268_1930511_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_010367104.1|1930519_1930984_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011259461.1|1931000_1931921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408857.1|1931917_1933657_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.8	1.3e-42
WP_109182069.1|1934203_1935523_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_166473743.1|1936979_1937153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|1937186_1938143_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011408855.1|1938437_1938815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259457.1|1938975_1939677_-|transposase	DDE transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
WP_044756748.1|1942484_1943432_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014503214.1|1943685_1944810_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_044756749.1|1945014_1946532_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	2.3e-86
WP_011408849.1|1946673_1947810_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_011259451.1|1948174_1950352_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
WP_011408848.1|1950363_1951233_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259449.1|1951409_1953092_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	7.1e-33
WP_044756750.1|1953741_1956510_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1956657_1956906_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1956902_1957313_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_012444596.1|1957378_1959970_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_011259442.1|1960323_1961139_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_027703620.1|1961794_1964098_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259440.1|1964146_1965223_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011259439.1|1965219_1965816_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011408845.1|1965812_1966679_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_044756751.1|1966933_1969318_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	7.8e-09
WP_044756752.1|1969402_1969786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187758.1|1969966_1970765_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408841.1|1971612_1972095_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011408840.1|1972230_1973016_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408839.1|1973985_1976247_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_044756753.1|1976640_1978902_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_044757389.1|1979495_1981571_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_044757392.1|1982254_1984366_-	CHASE3 domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	2.5e-14
WP_044756755.1|1985094_1987341_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
WP_115840174.1|1987580_1988546_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	1995660	2062053	5016623	transposase	Staphylococcus_prophage(20.0%)	42	NA	NA
WP_011408830.1|1995660_1995915_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011408829.1|1996082_1998092_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|1998125_1998491_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011259421.1|1998487_1998796_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_042465006.1|1998896_1999919_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259419.1|1999915_2000698_-	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_011408827.1|2000699_2001674_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259417.1|2001680_2002421_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_027703781.1|2002509_2002863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242238.1|2002859_2003375_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011408825.1|2003397_2003790_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_044756757.1|2003941_2004649_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_125168759.1|2004724_2005072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|2005073_2006879_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042465003.1|2007133_2007586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465618.1|2008575_2011677_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082341205.1|2011835_2012834_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	41.4	8.5e-42
WP_011407913.1|2012796_2014011_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_041182545.1|2014192_2015149_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756759.1|2015588_2016032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070344089.1|2016028_2016445_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_115862267.1|2017549_2018869_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2019096_2019411_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_157724569.1|2019343_2020297_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182637.1|2020457_2020847_+	phage late control D family protein	NA	NA	NA	NA	NA
WP_012444637.1|2028501_2029431_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_012444638.1|2029427_2032265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182640.1|2032289_2033024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|2035103_2036060_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_165967681.1|2036305_2037757_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2037893_2038862_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_012444645.1|2039528_2040806_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_011259402.1|2040983_2042726_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011259401.1|2042884_2043841_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_041182172.1|2043837_2046354_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011408798.1|2046514_2047510_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011257851.1|2048216_2049182_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444648.1|2050157_2053328_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012444649.1|2053340_2054645_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027703873.1|2054659_2055319_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756763.1|2055596_2060621_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_044756764.1|2061069_2062053_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.2	1.6e-96
>prophage 17
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	2088795	2151230	5016623	protease,transposase,tRNA	Bacillus_virus(18.18%)	51	NA	NA
WP_115801894.1|2088795_2090115_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408779.1|2090621_2091824_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011408778.1|2091820_2093407_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408777.1|2093411_2094905_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_075240820.1|2095050_2096298_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011259369.1|2096617_2097448_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_041182453.1|2097603_2098014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013286.1|2098268_2099633_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011259367.1|2099784_2100786_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011259366.1|2100801_2102082_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_012444677.1|2102078_2102957_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011408769.1|2103051_2103570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703624.1|2103569_2104055_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011259362.1|2104109_2104772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408767.1|2105183_2106170_-	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_144408322.1|2106342_2106618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756769.1|2106593_2108048_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011259357.1|2109983_2110970_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011259356.1|2111499_2112144_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259355.1|2112143_2113403_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_027703625.1|2113395_2114154_+	cytochrome c1	NA	NA	NA	NA	NA
WP_011259353.1|2114546_2115182_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011259352.1|2115260_2115701_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011408764.1|2115733_2116060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465594.1|2116270_2116615_-	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_109181970.1|2121179_2122145_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2122725_2123910_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_012445118.1|2124313_2125282_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_041182719.1|2125683_2126640_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_027703931.1|2126888_2127089_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408759.1|2127573_2127852_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_027703932.1|2127839_2128130_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_153296741.1|2128390_2128588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015463309.1|2128731_2128911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259345.1|2129774_2130176_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011408756.1|2131268_2132360_-	ribonuclease D	NA	NA	NA	NA	NA
WP_041182165.1|2132631_2134467_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_094187754.1|2134783_2135530_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259340.1|2135747_2137010_+	virulence factor	NA	NA	NA	NA	NA
WP_011408753.1|2137305_2138643_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_011408752.1|2138788_2139856_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011259337.1|2139880_2141368_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_011259336.1|2141364_2141865_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_027703275.1|2141935_2143651_+	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.0e-15
WP_011259334.1|2143788_2145666_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_041182163.1|2145665_2146613_+	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011408749.1|2146646_2147618_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011259331.1|2147791_2148367_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408747.1|2148526_2149267_-	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_044756773.1|2149354_2150254_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011259328.1|2150351_2151230_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 18
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	2183449	2224276	5016623	transposase,tRNA	Streptococcus_phage(25.0%)	35	NA	NA
WP_094187753.1|2183449_2184248_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2185235_2186204_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_115862269.1|2186340_2187660_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444728.1|2187883_2188372_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011259294.1|2188743_2189007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756777.1|2189878_2190718_-	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_011259290.1|2190717_2192067_-	dihydroorotase	NA	NA	NA	NA	NA
WP_033013281.1|2192063_2192351_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075239108.1|2192435_2193464_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011259288.1|2193606_2194668_+	S41 family peptidase	NA	NA	NA	NA	NA
WP_011259287.1|2194735_2195986_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408724.1|2195982_2196420_-	SufE family protein	NA	NA	NA	NA	NA
WP_012444736.1|2196917_2198342_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_027703614.1|2198518_2199013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259283.1|2199325_2200351_+	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_011408723.1|2200422_2201664_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011408722.1|2201905_2202358_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259280.1|2202363_2203464_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_044756778.1|2203503_2204847_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_044756779.1|2205459_2206410_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011408717.1|2206533_2207829_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_011408716.1|2207828_2208194_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011259275.1|2208193_2208454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756780.1|2208467_2209622_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.2	1.0e-46
WP_011408714.1|2209891_2211136_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_044756781.1|2211503_2213417_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_173425350.1|2213397_2214624_-	MFS transporter	NA	NA	NA	NA	NA
WP_011259269.1|2214883_2214994_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_011259267.1|2215372_2215636_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_044756785.1|2215684_2216785_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_075239845.1|2216936_2218673_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_011408708.1|2218669_2220355_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_011408707.1|2220523_2221822_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115801893.1|2221828_2222794_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044749647.1|2222899_2224276_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
>prophage 19
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	2332880	2378697	5016623	protease,transposase,tRNA	uncultured_Mediterranean_phage(11.11%)	33	NA	NA
WP_011408666.1|2332880_2334017_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_011408665.1|2334013_2334472_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005914463.1|2334722_2335043_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408664.1|2335186_2337469_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.5	4.3e-174
WP_002813418.1|2337749_2337968_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_042465566.1|2338048_2338801_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_011408662.1|2340228_2341350_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259181.1|2341407_2342376_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011259180.1|2342659_2345020_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259179.1|2345182_2347111_+	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_027703232.1|2347175_2347847_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259177.1|2347959_2352126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2352362_2353739_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259175.1|2353770_2354097_-	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_011408660.1|2354093_2354501_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011408659.1|2354532_2354883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259173.1|2354879_2356211_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011259172.1|2356531_2357737_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011259171.1|2357894_2360267_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259170.1|2360291_2360924_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002812972.1|2361143_2361569_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_012445041.1|2361611_2362793_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_011408658.1|2362803_2363592_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259167.1|2363588_2364449_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044756799.1|2364519_2365158_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011408657.1|2365157_2366375_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259164.1|2366385_2367783_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011259163.1|2368097_2369318_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_044756800.1|2369514_2370573_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157724571.1|2371169_2371466_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_115862270.1|2374840_2376160_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115862271.1|2376278_2377754_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.6e-76
WP_109181928.1|2377731_2378697_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	2478678	2618002	5016623	transposase,tRNA	Xanthomonas_phage(24.0%)	104	NA	NA
WP_011258918.1|2478678_2479737_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258919.1|2479788_2480355_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011408473.1|2480351_2481578_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011408474.1|2481698_2482964_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_011408475.1|2482944_2483676_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_094187744.1|2483816_2484980_-	MFS transporter	NA	NA	NA	NA	NA
WP_082322979.1|2485142_2486099_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.1	3.7e-42
WP_012444969.1|2486658_2486793_-	aspartate racemase	NA	NA	NA	NA	NA
WP_012444967.1|2486983_2487895_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011408479.1|2487888_2488941_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_011258927.1|2488937_2489993_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_164994133.1|2489998_2490766_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011408481.1|2490768_2491053_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_044756815.1|2491641_2493174_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408482.1|2494476_2496984_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_011258933.1|2496980_2497949_+	homoserine kinase	NA	NA	NA	NA	NA
WP_024710669.1|2500895_2501210_-	EthD family reductase	NA	NA	NA	NA	NA
WP_011258935.1|2501371_2502676_+	threonine synthase	NA	NA	NA	NA	NA
WP_041182115.1|2502778_2503522_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_012444952.1|2504786_2506199_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_094187743.1|2506704_2507503_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258940.1|2507816_2508143_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258941.1|2508152_2509067_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258942.1|2509063_2510359_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_027703958.1|2510355_2511447_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258944.1|2511443_2512571_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011258945.1|2512567_2513170_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258946.1|2513166_2513901_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258947.1|2513894_2514671_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258948.1|2514660_2515281_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_044756818.1|2515866_2519721_-	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_011408491.1|2519944_2520244_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_012444931.1|2520247_2520442_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_144408324.1|2520710_2524205_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_113022320.1|2527538_2528465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057499.1|2529001_2529754_-	Type II secretory pathway, component ExeA	NA	NA	NA	NA	NA
WP_033013458.1|2530031_2531897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444939.1|2531886_2532612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|2532718_2533675_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_144408325.1|2534466_2534766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408511.1|2534887_2535070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239627.1|2535693_2535792_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_044756822.1|2537143_2540440_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_012444931.1|2540708_2540903_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_011408491.1|2540906_2541206_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_044756823.1|2541429_2545185_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_012444931.1|2546268_2546463_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_044756824.1|2546466_2546766_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	90.2	5.5e-45
WP_044756825.1|2546991_2551011_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_012444927.1|2551229_2551406_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2551402_2552074_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_011409560.1|2553252_2554215_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|2555027_2555984_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756826.1|2557035_2557935_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	9.7e-37
WP_012444921.1|2558101_2558608_+	VOC family protein	NA	NA	NA	NA	NA
WP_011258968.1|2559082_2559715_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2559714_2561571_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_012444920.1|2561567_2562986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2563009_2563474_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011258972.1|2563470_2564250_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2564541_2565582_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2565578_2567348_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2567344_2567809_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2567812_2568475_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2568503_2570912_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_115862272.1|2571165_2572131_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2573524_2574259_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2574251_2575493_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2575516_2575969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756828.1|2575919_2576168_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2576278_2577061_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_027703324.1|2577077_2577281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444909.1|2577290_2579081_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2579115_2579502_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2579498_2579894_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2579953_2580220_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011408533.1|2580163_2581036_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2581164_2582262_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2582693_2584124_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2584120_2585128_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2585124_2585844_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2585946_2587863_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2587918_2588578_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_044756829.1|2588798_2590175_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.3e-77
WP_027703995.1|2591014_2591218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239633.1|2591214_2591604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444899.1|2591789_2591966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2592233_2592614_+	response regulator	NA	NA	NA	NA	NA
WP_044756830.1|2592828_2596224_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_012444894.1|2597218_2600179_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_026144156.1|2601174_2601531_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_044756831.1|2601794_2603099_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	58.9	2.0e-128
WP_173425351.1|2603117_2603825_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	2.3e-86
WP_012444890.1|2603839_2604253_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.2	8.6e-41
WP_012444889.1|2604263_2604794_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	1.8e-27
WP_027703900.1|2604790_2605138_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027703901.1|2606348_2607929_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012444885.1|2608212_2609232_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_044756832.1|2609282_2610758_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	65.7	4.3e-98
WP_044756833.1|2611008_2612223_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_012444882.1|2612304_2614533_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_033013508.1|2614529_2615693_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	32.3	2.7e-15
WP_128415445.1|2616125_2616632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115862273.1|2616682_2618002_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	2736618	2877188	5016623	integrase,transposase,tRNA	uncultured_Mediterranean_phage(26.09%)	98	2757819:2757837	2790742:2790760
WP_011259079.1|2736618_2738013_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	4.5e-81
WP_011259080.1|2738014_2738272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2738268_2738574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259081.1|2738570_2738897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2739617_2740280_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2740368_2740899_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408604.1|2740962_2741559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162531723.1|2741684_2741897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259087.1|2743099_2744371_+	kynureninase	NA	NA	NA	NA	NA
WP_011259088.1|2744542_2745910_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_012444800.1|2746213_2747659_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_044756855.1|2747655_2748342_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2748314_2749334_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2749375_2749936_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2749956_2750913_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2751080_2751857_-	NAD kinase	NA	NA	NA	NA	NA
WP_011408610.1|2752340_2754476_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2754472_2754664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2756437_2756944_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2756984_2757512_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2757508_2758000_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
2757819:2757837	attL	CGCTTGCCGCTGCCGCCCT	NA	NA	NA	NA
WP_012444795.1|2758023_2758599_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2758675_2759629_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_012444794.1|2759717_2760590_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_027703371.1|2760586_2761426_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2761538_2762237_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_044756856.1|2762400_2763183_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011408619.1|2763191_2763572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2763568_2764279_+	endonuclease III	NA	NA	NA	NA	NA
WP_012444789.1|2765590_2766139_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_012444787.1|2767862_2769113_+	OprO/OprP family phosphate-selective porin	NA	NA	NA	NA	NA
WP_012444786.1|2769301_2770321_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	2.1e-48
WP_012444785.1|2770506_2771598_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_011259112.1|2771710_2772685_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_011259113.1|2772684_2773554_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2773576_2774407_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2774535_2775246_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_012444782.1|2775378_2775774_+	RcnB family protein	NA	NA	NA	NA	NA
WP_011259117.1|2776057_2776693_+	ribonuclease T	NA	NA	NA	NA	NA
WP_115862274.1|2776763_2778083_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044756859.1|2778319_2779381_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082341214.1|2779431_2780616_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_165967678.1|2780802_2782254_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408636.1|2784871_2785234_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_011259122.1|2785314_2786283_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
WP_011259123.1|2786377_2788222_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011259124.1|2788418_2788772_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_011259125.1|2788903_2790049_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2790118_2791189_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
2790742:2790760	attR	AGGGCGGCAGCGGCAAGCG	NA	NA	NA	NA
WP_011259127.1|2791354_2791786_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259128.1|2791909_2793406_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011408639.1|2793365_2793680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259129.1|2793750_2794458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258529.1|2796625_2797594_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_044749647.1|2798197_2799574_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182545.1|2799733_2800690_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756862.1|2801303_2803646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2803670_2804399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756864.1|2804427_2807262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259405.1|2807258_2808188_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044756866.1|2808196_2810959_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	3.3e-43
WP_082341208.1|2812524_2815116_-	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_041182637.1|2815155_2815545_-	phage late control D family protein	NA	NA	NA	NA	NA
WP_157724569.1|2815705_2816659_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|2816591_2816906_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_082356336.1|2818420_2819377_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	1.4e-41
WP_011408645.1|2820825_2821947_-	phytase	NA	NA	NA	NA	NA
WP_041182147.1|2824213_2824681_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2824831_2825464_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011259143.1|2826903_2827935_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2827941_2829735_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2829731_2830016_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_027703974.1|2830247_2830745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2830791_2831298_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_012444764.1|2831294_2831981_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2832155_2834060_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_115862276.1|2835304_2836624_+|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
WP_144408326.1|2836828_2840227_+	avirulence protein	NA	NA	NA	NA	NA
WP_082356333.1|2843419_2847022_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_041182100.1|2847290_2847485_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_044756872.1|2847488_2847788_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	90.2	2.5e-45
WP_044756873.1|2848011_2851317_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_153296745.1|2851723_2851996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258825.1|2852686_2853700_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258824.1|2853799_2854384_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259046.1|2854447_2855416_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011258822.1|2855969_2857319_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_012445101.1|2857430_2858090_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027704061.1|2858450_2858918_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_094187738.1|2859104_2860206_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.6e-36
WP_044756878.1|2863992_2865207_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	6.2e-55
WP_044756879.1|2865553_2866753_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258799.1|2866901_2867084_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|2869097_2870054_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109181957.1|2872249_2873215_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187737.1|2873215_2873969_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445118.1|2874799_2875768_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_011258442.1|2875952_2877188_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	2953337	3020301	5016623	protease,coat,transposase	Bacillus_virus(22.22%)	48	NA	NA
WP_115862278.1|2953337_2954303_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011258724.1|2955748_2955997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703878.1|2956951_2957686_-	serine hydrolase	NA	NA	NA	NA	NA
WP_011258722.1|2957736_2959317_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_027703877.1|2959323_2960517_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_171970799.1|2960527_2962000_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012445167.1|2962041_2962482_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258718.1|2962603_2963455_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011258717.1|2963515_2965759_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.7	1.1e-81
WP_033013399.1|2966214_2966751_-	bacterioferritin	NA	NA	NA	NA	NA
WP_012445169.1|2966846_2969264_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_011258714.1|2970643_2972770_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_027703366.1|2973200_2974253_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_011258712.1|2974321_2976016_-	asparagine synthase B	NA	E5ERH5	Ostreococcus_lucimarinus_virus	38.6	2.5e-86
WP_044756901.1|2976310_2977441_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_011408335.1|2977445_2977946_-	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	41.7	2.3e-27
WP_011408334.1|2977942_2978299_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_012445174.1|2978761_2979958_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_011408332.1|2979974_2982584_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_011258707.1|2982580_2983357_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_024744143.1|2983649_2984201_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_044756902.1|2984209_2984980_+	molecular chaperone	NA	NA	NA	NA	NA
WP_044756903.1|2984996_2987348_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011258703.1|2987344_2988379_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_044756904.1|2988425_2988758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408326.1|2988760_2989486_+	molecular chaperone	NA	NA	NA	NA	NA
WP_044756905.1|2989861_2990665_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011258700.1|2990834_2991713_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_011408325.1|2991840_2992218_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258698.1|2992274_2992997_+	UMP kinase	NA	NA	NA	NA	NA
WP_011258697.1|2993177_2993735_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_027703358.1|2993752_2994514_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258695.1|2994510_2995338_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258694.1|2995340_2996531_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_044756906.1|2996557_2997904_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_012445188.1|2997987_3000354_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_044756907.1|3000722_3001736_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|3001732_3002194_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011258689.1|3002217_3003009_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027703356.1|3003047_3004304_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011408322.1|3004300_3005041_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_011408321.1|3005498_3009089_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011258685.1|3009264_3010224_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_044756908.1|3011063_3013244_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044756909.1|3013243_3013981_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_044756910.1|3013977_3015390_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_044749647.1|3017405_3018782_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_044749647.1|3018924_3020301_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
>prophage 23
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	3029616	3087817	5016623	protease,transposase,tRNA	Acidithiobacillus_phage(22.22%)	48	NA	NA
WP_044756912.1|3029616_3031092_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.8	3.7e-102
WP_011408311.1|3031134_3031530_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_044756913.1|3031569_3032946_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	6.6e-77
WP_011258670.1|3034581_3035256_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_011258669.1|3035260_3036037_+	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258668.1|3037309_3039247_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258667.1|3039428_3040406_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_044756914.1|3040402_3041800_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_044756915.1|3042071_3043130_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012445211.1|3043893_3044343_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011258663.1|3044567_3046652_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_041182084.1|3046894_3047491_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_012445213.1|3047492_3047921_+	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_011258660.1|3048539_3049322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445216.1|3049407_3049776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258659.1|3049834_3050398_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012445217.1|3050394_3051228_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_011408297.1|3051453_3052452_+	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
WP_027704227.1|3052448_3053699_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044756917.1|3053698_3054583_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_011258655.1|3054579_3055875_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
WP_011258654.1|3055871_3056417_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_044756918.1|3056413_3057196_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011258652.1|3057213_3058284_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408290.1|3058446_3058794_-	RidA family protein	NA	NA	NA	NA	NA
WP_011258648.1|3059774_3062339_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_011258647.1|3062962_3064333_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_011258646.1|3064402_3064597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258645.1|3064656_3065265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408284.1|3065300_3065903_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258643.1|3066176_3066632_-	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011258642.1|3067194_3068406_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408282.1|3068626_3069745_+	alkene reductase	NA	NA	NA	NA	NA
WP_075239156.1|3070635_3070926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408280.1|3071214_3071550_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_011408279.1|3071664_3072714_+	cation transporter	NA	NA	NA	NA	NA
WP_012445231.1|3074385_3074859_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_012445232.1|3074998_3076375_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011258635.1|3076564_3076750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187731.1|3077728_3078527_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862279.1|3078643_3079963_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259046.1|3080175_3081144_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011258631.1|3081400_3081667_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_011258630.1|3081841_3082096_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258629.1|3082256_3082430_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_012445235.1|3082831_3083359_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258627.1|3083827_3084928_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_011258626.1|3084988_3087817_-|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
>prophage 24
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	3107353	3170227	5016623	protease,transposase	Hokovirus(27.27%)	43	NA	NA
WP_109182069.1|3107353_3108673_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|3108773_3109730_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756425.1|3109824_3111201_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_044756924.1|3111429_3112665_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258607.1|3112760_3113258_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_027703339.1|3113432_3114767_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	26.8	1.7e-29
WP_011408250.1|3114925_3115648_+	response regulator	NA	NA	NA	NA	NA
WP_011258604.1|3115796_3116519_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011258603.1|3116742_3117642_-	GTPase Era	NA	NA	NA	NA	NA
WP_012445253.1|3117638_3118319_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	9.9e-18
WP_011258601.1|3118308_3118686_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011258600.1|3118716_3119517_-	signal peptidase I	NA	NA	NA	NA	NA
WP_041182078.1|3119623_3121414_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011408249.1|3121594_3123181_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_011258597.1|3123290_3124190_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_041182077.1|3124186_3124807_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_011258595.1|3125043_3127125_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_044757447.1|3127341_3128307_-	cation transporter	NA	NA	NA	NA	NA
WP_027703337.1|3128545_3129448_-	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_011408245.1|3129607_3130780_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011258591.1|3130779_3131577_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408244.1|3131573_3132755_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408243.1|3132765_3134271_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408242.1|3134409_3135795_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011408239.1|3137827_3138634_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_011408237.1|3139654_3140008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258585.1|3140174_3142106_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_011258581.1|3143438_3143612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703331.1|3144452_3147953_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.9	9.9e-45
WP_012445273.1|3148099_3151657_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	2.2e-39
WP_012445274.1|3151952_3155528_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	7.8e-37
WP_011258575.1|3155624_3156287_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011258574.1|3156283_3156847_+	cytochrome b	NA	NA	NA	NA	NA
WP_011258573.1|3156856_3157426_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_011258572.1|3157750_3158140_+	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011408231.1|3158225_3158459_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_011258570.1|3158546_3159929_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_044756926.1|3161696_3162914_-	O-succinylhomoserine (thiol)-lyase	NA	NA	NA	NA	NA
WP_044756927.1|3162910_3163942_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_044756928.1|3164260_3165160_+	M23 family metallopeptidase	NA	A0A142F145	Bacillus_phage	37.9	3.2e-08
WP_011408227.1|3165292_3166897_+	peptide chain release factor 3	NA	NA	NA	NA	NA
WP_011258564.1|3166972_3167617_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_044749647.1|3168850_3170227_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
>prophage 25
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	3216703	3298743	5016623	transposase,tRNA	Staphylococcus_prophage(16.67%)	54	NA	NA
WP_011407237.1|3216703_3217660_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_059317522.1|3217811_3218195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756939.1|3219100_3220345_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012445311.1|3220341_3220620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075242902.1|3220697_3221099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408199.1|3221381_3221753_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_041183382.1|3221749_3222016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|3222317_3223274_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011258527.1|3223640_3225104_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_011408197.1|3225239_3227582_+	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_011408196.1|3227861_3229703_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_027703763.1|3229752_3232284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408193.1|3232901_3233102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445314.1|3233159_3233480_-	RebB family R body protein	NA	NA	NA	NA	NA
WP_011258521.1|3233859_3234963_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_027703764.1|3235375_3237064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703765.1|3237173_3237905_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_027703766.1|3237901_3238966_-	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_115862280.1|3243614_3244934_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044757453.1|3245066_3246149_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044756940.1|3246160_3246784_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_044756941.1|3247034_3247511_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011408184.1|3247544_3248747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756942.1|3248754_3255681_-	Hpt domain-containing protein	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011258510.1|3255794_3257831_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_003482487.1|3257870_3258401_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011258508.1|3258400_3258763_-	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_005913706.1|3258780_3259182_-	twitching motility response regulator PilG	NA	NA	NA	NA	NA
WP_044756943.1|3259431_3260382_+	glutathione synthase	NA	NA	NA	NA	NA
WP_011258506.1|3260378_3261254_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_044757457.1|3261548_3262499_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.8	1.4e-65
WP_012445327.1|3262461_3263181_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_044756945.1|3263194_3265222_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	2.7e-95
WP_044756946.1|3265423_3265948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756947.1|3265960_3268405_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_044756949.1|3268646_3270749_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_044757459.1|3271081_3272524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756951.1|3272813_3275000_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002812057.1|3275289_3275370_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_044756952.1|3275453_3276353_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_011408174.1|3276349_3277102_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_012445334.1|3277098_3277377_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_012445335.1|3277373_3278492_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408171.1|3278554_3279067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703396.1|3279495_3281010_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_044756953.1|3282451_3285106_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044756954.1|3285326_3289448_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408166.1|3289549_3290095_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_011258487.1|3290651_3292448_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	1.5e-81
WP_011408165.1|3292586_3293084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703393.1|3293162_3293567_+	response regulator	NA	NA	NA	NA	NA
WP_008578058.1|3294197_3294872_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_044756955.1|3295250_3296627_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	1.4e-58
WP_012443979.1|3297507_3298743_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	3312794	3376720	5016623	transposase,tRNA	Ralstonia_phage(36.36%)	31	NA	NA
WP_011408113.1|3312794_3314561_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011258426.1|3314718_3315495_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_012445361.1|3315992_3316286_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_044756958.1|3316726_3317965_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756961.1|3320548_3322105_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011258418.1|3323493_3324885_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_041182545.1|3326255_3327212_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011258414.1|3328847_3331469_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.4e-30
WP_094187728.1|3333348_3334147_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|3337284_3338241_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044756968.1|3338316_3339285_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.1e-99
WP_082322985.1|3339199_3339898_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.8	8.6e-25
WP_011258802.1|3339949_3340918_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_144408327.1|3341028_3341409_+	AHH domain-containing protein	NA	NA	NA	NA	NA
WP_109182069.1|3341475_3342795_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3342994_3343963_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862281.1|3344099_3345419_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|3348038_3348995_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_157724567.1|3354191_3354464_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041182622.1|3356043_3356619_-	SUKH-4 family immunity protein	NA	NA	NA	NA	NA
WP_044756972.1|3356622_3361317_-	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	48.6	1.5e-24
WP_044756973.1|3361460_3363080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444470.1|3363103_3365350_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_012444469.1|3365574_3367455_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_010365831.1|3367621_3367957_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_012444468.1|3367956_3368589_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_011408097.1|3368585_3370586_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011258402.1|3370585_3371521_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011258401.1|3372034_3372985_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011408096.1|3373073_3373574_-	signal peptidase II	NA	NA	NA	NA	NA
WP_011258399.1|3373888_3376720_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
>prophage 27
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	3427352	3489195	5016623	transposase	Staphylococcus_prophage(12.5%)	42	NA	NA
WP_115862282.1|3427352_3428672_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_162531724.1|3428738_3429278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322932.1|3429232_3429403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756487.1|3429523_3430738_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	8.2e-55
WP_011257031.1|3430909_3431878_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_125168746.1|3431929_3432421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756978.1|3432417_3435180_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_041182545.1|3435203_3436160_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_115862283.1|3437675_3438995_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258344.1|3440045_3441878_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_011258343.1|3442009_3442600_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_044756980.1|3442665_3445722_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_044756981.1|3445718_3446822_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011258340.1|3446847_3447684_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_033013597.1|3447703_3449173_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012444424.1|3449278_3449968_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_011258337.1|3449964_3451158_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.3	4.0e-22
WP_011258336.1|3451216_3452482_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_075241746.1|3452628_3454305_-	serine hydrolase	NA	NA	NA	NA	NA
WP_011258334.1|3454246_3454747_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_011408053.1|3457666_3458389_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_012444418.1|3458538_3460935_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011258329.1|3461198_3463103_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_044757481.1|3463778_3464426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183663.1|3464462_3464705_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_014502654.1|3465048_3465450_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_027704130.1|3465475_3466009_-	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_044756983.1|3466411_3466666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258319.1|3469589_3470135_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_044756984.1|3470391_3471690_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_011258317.1|3471816_3473262_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_044756986.1|3473334_3474375_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408042.1|3474507_3474690_-	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258314.1|3474989_3475400_-	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_044756988.1|3478028_3480410_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_059317479.1|3480636_3481608_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.5	1.2e-32
WP_094187725.1|3481659_3482070_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011258309.1|3482168_3482894_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_012444398.1|3483310_3484729_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.3e-47
WP_011408037.1|3484831_3486262_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258306.1|3486483_3487038_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011258305.1|3487254_3489195_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
>prophage 28
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	3495544	3520933	5016623	transposase,tRNA	Ralstonia_phage(40.0%)	23	NA	NA
WP_011258297.1|3495544_3496375_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027704135.1|3496447_3496876_+	cytochrome c	NA	NA	NA	NA	NA
WP_011408030.1|3497007_3497487_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|3497737_3497953_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011258293.1|3498180_3498666_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|3500227_3500431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408025.1|3501208_3501667_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408024.1|3502072_3502579_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_011258289.1|3502592_3503996_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075242217.1|3505181_3505913_-	nitrilase	NA	NA	NA	NA	NA
WP_044756990.1|3505986_3506943_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.6	6.2e-42
WP_011408020.1|3507416_3508229_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_011258802.1|3508291_3509260_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862284.1|3509459_3510779_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_161795362.1|3512100_3512226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408018.1|3512261_3512645_-	inner membrane CreD family protein	NA	NA	NA	NA	NA
WP_011258280.1|3513160_3513973_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_044756991.1|3514033_3515092_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	7.6e-73
WP_044756992.1|3515086_3516256_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	8.3e-97
WP_011408014.1|3516432_3516816_-	inner membrane CreD family protein	NA	NA	NA	NA	NA
WP_012444370.1|3517550_3518363_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_115862285.1|3518433_3519753_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044756993.1|3519874_3520933_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	3575516	3644089	5016623	transposase	Bacillus_phage(12.5%)	55	NA	NA
WP_115862286.1|3575516_3576482_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_173425342.1|3578928_3580476_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.9	1.2e-13
WP_011258239.1|3580758_3581295_-	single-stranded DNA-binding protein	NA	A0A1B1W281	Salmonella_phage	58.5	3.6e-31
WP_044757016.1|3581570_3582569_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_044757017.1|3582753_3583548_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011258236.1|3583864_3585271_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011258235.1|3585251_3586607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258234.1|3586603_3587062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757019.1|3587045_3589655_-	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_012445697.1|3590754_3591636_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_027703692.1|3592734_3593334_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258228.1|3593486_3593921_-	OsmC family protein	NA	NA	NA	NA	NA
WP_011258227.1|3594423_3595371_-	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_011407969.1|3595384_3595852_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_011258225.1|3595844_3596411_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_011407966.1|3597675_3598248_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_041182545.1|3598315_3599272_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044757021.1|3599890_3601021_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_011258220.1|3601134_3602172_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011407962.1|3602535_3603228_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011407961.1|3603271_3604132_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011258216.1|3606166_3606592_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_044757022.1|3606697_3607339_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_027703896.1|3607396_3607738_+	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_027703897.1|3607981_3608338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258212.1|3608393_3608990_+	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_099051294.1|3609107_3609488_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_011407955.1|3609594_3609813_-	peptidase	NA	NA	NA	NA	NA
WP_003487757.1|3609917_3610385_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_011407954.1|3610556_3611015_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_044757023.1|3611030_3612488_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_011407952.1|3612745_3613510_+	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.9	1.6e-11
WP_011258208.1|3613509_3614772_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011258207.1|3614768_3616013_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.9	2.3e-92
WP_153296749.1|3616090_3616246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258206.1|3616256_3616796_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258205.1|3616792_3617122_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_011258203.1|3619006_3620023_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_125168743.1|3620743_3621010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239693.1|3621287_3622442_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_011258200.1|3622441_3623764_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_011407948.1|3623790_3624831_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_011407947.1|3624848_3625709_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_011407946.1|3625743_3626343_+	LysE family translocator	NA	NA	NA	NA	NA
WP_082322940.1|3626409_3627345_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_075239694.1|3627410_3628763_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_082322987.1|3628854_3630039_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	6.5e-41
WP_011257310.1|3631727_3632963_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044757028.1|3634148_3636473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757029.1|3636497_3638366_-	ATP-binding protein	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	4.4e-15
WP_173340392.1|3638578_3639934_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012445725.1|3640144_3640315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407938.1|3640770_3641562_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_125168742.1|3641779_3642061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757030.1|3642613_3644089_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.4	2.9e-99
>prophage 30
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	3650714	3718440	5016623	transposase,tRNA	Acinetobacter_phage(42.86%)	45	NA	NA
WP_082322988.1|3650714_3651671_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_011258179.1|3653672_3654113_+	VOC family protein	NA	NA	NA	NA	NA
WP_011258178.1|3654386_3656774_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.9	9.2e-10
WP_012445735.1|3657106_3659506_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.3	4.9e-11
WP_012445737.1|3660604_3662314_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_162531725.1|3662477_3663579_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.3	5.0e-43
WP_011258173.1|3663723_3664485_+	4-hydroxy-2-oxovalerate aldolase	NA	NA	NA	NA	NA
WP_044757032.1|3664485_3666627_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011258171.1|3666862_3668089_+	siderophore biosynthesis protein PvsA	NA	NA	NA	NA	NA
WP_011258170.1|3668085_3669888_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_011258169.1|3669884_3671081_+	MFS transporter	NA	NA	NA	NA	NA
WP_027703817.1|3671058_3672828_+	iron transporter	NA	NA	NA	NA	NA
WP_027703818.1|3672824_3674021_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011258166.1|3674195_3674930_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_011258165.1|3674926_3675517_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011407923.1|3675513_3676560_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258163.1|3676556_3677078_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_011258162.1|3677591_3678203_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_027703819.1|3678199_3678799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258160.1|3678798_3679392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258158.1|3681164_3683042_-	TonB-dependent vitamin B12 receptor	NA	A0A0P0I887	Acinetobacter_phage	29.5	4.9e-06
WP_109181892.1|3686099_3686249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757036.1|3686279_3687191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407916.1|3687315_3689901_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_011258151.1|3690346_3690652_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_012445759.1|3690681_3690957_+	glutathione transferase	NA	NA	NA	NA	NA
WP_094187788.1|3691642_3692440_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|3693134_3694349_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011407912.1|3694768_3695176_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_044757505.1|3695516_3697007_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_044757038.1|3697632_3698040_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_044757039.1|3698163_3698943_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_011407909.1|3699043_3699556_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011258141.1|3699599_3699857_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011407908.1|3699966_3700764_-	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_044757040.1|3700754_3701825_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_011407905.1|3703397_3704774_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407903.1|3706333_3707125_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_027704032.1|3707412_3708462_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_044757042.1|3708709_3710293_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
WP_115862287.1|3710790_3711756_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_144408330.1|3712446_3713544_-	HutD family protein	NA	NA	NA	NA	NA
WP_011258127.1|3715036_3715444_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407897.1|3715568_3717062_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_044757045.1|3717381_3718440_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	3747597	3901429	5016623	transposase	Xanthomonas_phage(36.36%)	114	NA	NA
WP_011257570.1|3747597_3748833_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258091.1|3749254_3750643_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258090.1|3751398_3752340_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_011407882.1|3752653_3753418_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407881.1|3753610_3754993_+	APC family permease	NA	NA	NA	NA	NA
WP_011258087.1|3755432_3756830_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_012445797.1|3757392_3757791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258085.1|3757935_3758940_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011258084.1|3758977_3760495_-	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
WP_044757048.1|3760535_3761582_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407875.1|3761592_3762345_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407874.1|3762676_3765835_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044757049.1|3766881_3768888_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258079.1|3769107_3769554_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_011258077.1|3771581_3772748_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
WP_011407870.1|3772749_3773322_-	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
WP_011407869.1|3773334_3773739_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_027703609.1|3773776_3774454_-	YjfK family protein	NA	NA	NA	NA	NA
WP_027703610.1|3774450_3775533_-	potassium channel protein	NA	NA	NA	NA	NA
WP_011258072.1|3775558_3776332_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_012445807.1|3776344_3776761_-	YjfI family protein	NA	NA	NA	NA	NA
WP_011258070.1|3776941_3777541_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_011258069.1|3777707_3778250_+	shikimate kinase	NA	NA	NA	NA	NA
WP_011258068.1|3778246_3779359_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_011407864.1|3779660_3779912_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_011258066.1|3779926_3780991_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_044757050.1|3782462_3786179_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_041182100.1|3786447_3786642_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_011408408.1|3786645_3786945_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_044757051.1|3787168_3791617_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_042464821.1|3791885_3792080_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011407858.1|3792083_3792383_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	1.4e-45
WP_082322945.1|3792522_3796017_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_041182763.1|3796285_3796480_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	92.2	2.5e-19
WP_011407856.1|3796483_3796783_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_011407855.1|3797006_3800015_+	TAL effector repeat-containing protein	NA	NA	NA	NA	NA
WP_041182763.1|3800283_3800478_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	92.2	2.5e-19
WP_011407856.1|3800481_3800781_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_044757053.1|3801004_3805132_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444927.1|3805350_3805527_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012445821.1|3805523_3806195_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	36.8	3.1e-24
WP_012445822.1|3806216_3807086_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	1.2e-28
WP_044757054.1|3807582_3810762_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703881.1|3811047_3812337_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407850.1|3815727_3816177_-	azurin	NA	NA	NA	NA	NA
WP_011407846.1|3817619_3818123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258050.1|3818147_3818573_-	cytochrome c	NA	NA	NA	NA	NA
WP_044757055.1|3818569_3820177_-	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011407844.1|3820246_3820591_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407842.1|3821713_3822331_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_011258048.1|3822577_3823804_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011258047.1|3823876_3824749_+	ion transporter	NA	NA	NA	NA	NA
WP_094187758.1|3826009_3826808_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407839.1|3826888_3827548_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_011407838.1|3827699_3829787_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_012445831.1|3829963_3830944_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
WP_012445833.1|3831347_3832265_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.3e-31
WP_094187728.1|3832307_3833105_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704066.1|3833330_3833720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407833.1|3833799_3834477_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704076.1|3834939_3836259_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_115801876.1|3836368_3837334_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407830.1|3838573_3839575_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_153296750.1|3840231_3840372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445035.1|3841449_3842685_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_153296751.1|3842865_3843015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445839.1|3844765_3845539_+	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_011258028.1|3845552_3846383_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011407824.1|3846453_3847230_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027703578.1|3847246_3847933_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011407823.1|3847932_3848547_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011407822.1|3848889_3849474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703579.1|3849470_3850793_-	TonB family protein	NA	NA	NA	NA	NA
WP_011407820.1|3850782_3851148_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703580.1|3851247_3852609_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_044757056.1|3852626_3853325_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_044757057.1|3853347_3854010_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407815.1|3853990_3854830_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407814.1|3854829_3855504_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_044757058.1|3855500_3857000_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_069960293.1|3856996_3857644_-	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011258012.1|3860150_3861326_+	phosphatidylinositol-specific phospholipase C1-like protein	NA	NA	NA	NA	NA
WP_027703583.1|3861455_3864170_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_133264561.1|3864230_3864470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464572.1|3864552_3865482_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011258009.1|3865484_3866201_+	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_011258007.1|3867019_3869020_-	transketolase	NA	NA	NA	NA	NA
WP_027703585.1|3869246_3870527_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_033013273.1|3870724_3871042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407804.1|3871337_3873095_-	BatD family protein	NA	NA	NA	NA	NA
WP_027703586.1|3873091_3874909_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011258003.1|3874905_3875913_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011258002.1|3875909_3876371_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011258001.1|3876373_3877336_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_012445859.1|3877356_3878376_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_115862288.1|3878998_3880033_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258092.1|3880103_3881339_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|3881481_3882279_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407796.1|3882350_3884300_-	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_011257996.1|3884319_3884853_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011257995.1|3884849_3885515_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_044757059.1|3885511_3886270_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027703769.1|3886269_3887352_-	type IV pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257992.1|3887543_3889973_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_041182719.1|3890040_3890997_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_011407794.1|3891341_3891992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407793.1|3892368_3893658_-	citrate synthase	NA	NA	NA	NA	NA
WP_005911911.1|3893871_3894114_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_044757060.1|3894185_3895124_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011257988.1|3895249_3897403_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011257987.1|3897423_3897804_-	RidA family protein	NA	NA	NA	NA	NA
WP_011257986.1|3897883_3900055_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011407791.1|3900183_3900483_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_094187796.1|3900630_3901429_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	3960623	4028983	5016623	protease,integrase,transposase	Ralstonia_phage(23.53%)	54	3960061:3960120	4027106:4027170
3960061:3960120	attL	CCTAAGAACCTGTTCACGATCTCCTGAGCAGCAGTGCCAGGAACGCCAGGTGGATGAACT	NA	NA	NA	NA
WP_044757070.1|3960623_3961859_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_044757071.1|3962847_3964449_+	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_041182379.1|3965065_3965812_-	cellulase	NA	NA	NA	NA	NA
WP_113195645.1|3966284_3967043_-	cellulase	NA	NA	NA	NA	NA
WP_011407749.1|3967559_3968075_-	peptide deformylase	NA	NA	NA	NA	NA
WP_044757517.1|3968396_3968819_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	61.9	5.2e-41
WP_012445908.1|3969590_3971459_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011407746.1|3971497_3972451_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_011257917.1|3972456_3973413_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011257916.1|3973405_3975358_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257915.1|3975354_3975888_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011407744.1|3976007_3976358_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257913.1|3976459_3977053_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_011257912.1|3977150_3977471_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_044757072.1|3977477_3979574_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_044757073.1|3980135_3980582_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257909.1|3980578_3980824_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011407742.1|3980820_3981318_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257907.1|3981342_3981702_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_044757074.1|3981719_3982751_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257905.1|3982750_3983500_-	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257904.1|3983499_3984249_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257903.1|3984269_3985319_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257902.1|3985529_3985934_-	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407739.1|3986044_3986731_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_115862289.1|3986829_3987795_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257899.1|3987877_3988435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239641.1|3988496_3988760_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_044757075.1|3988756_3990451_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_044757076.1|3990447_3992655_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-19
WP_075239641.1|3992716_3992980_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_044757077.1|3992976_3994671_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257897.1|3994667_3996872_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_044757078.1|3997191_3998889_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_044757519.1|3998885_4001036_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.6e-27
WP_044757079.1|4001103_4003827_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.3	9.7e-72
WP_012445927.1|4004222_4004423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407730.1|4005315_4005945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445930.1|4006771_4007476_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011257889.1|4007911_4008646_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257888.1|4008654_4009107_-	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257887.1|4009134_4009791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257886.1|4009803_4010571_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_044757080.1|4010567_4011746_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011407728.1|4012444_4014415_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002806049.1|4015246_4015519_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_012445937.1|4015732_4018204_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_011257881.1|4018347_4019634_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_002806026.1|4019758_4020385_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_012445939.1|4020477_4021770_-	trigger factor	NA	NA	NA	NA	NA
WP_011257875.1|4025087_4025849_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_011257874.1|4025992_4027000_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_115862290.1|4027263_4028229_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
4027106:4027170	attR	CCTAAGAACCTGTTCACGATCTCCTGAGCAGCAGTGCCAGGAACGCCAGGTGGATGAACTGCAAG	NA	NA	NA	NA
WP_094187737.1|4028229_4028983_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	4078351	4117423	5016623	protease,transposase	Ralstonia_phage(25.0%)	22	NA	NA
WP_011409560.1|4078351_4079314_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_012445975.1|4080175_4080418_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_011407721.1|4080966_4081428_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011258802.1|4081688_4082657_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187763.1|4084053_4084852_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257834.1|4085093_4085708_+	glutathione S-transferase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011257835.1|4085790_4086777_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|4086892_4087387_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|4087631_4089461_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011257838.1|4089530_4089950_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|4090872_4092000_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|4092100_4093483_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_044757084.1|4093730_4095854_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407706.1|4096382_4096901_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_011257570.1|4099224_4100460_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044757085.1|4101073_4101964_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_115862291.1|4104563_4105883_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187858.1|4106627_4107551_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	5.8e-37
WP_094187763.1|4107738_4108536_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445996.1|4111592_4113143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757086.1|4114040_4115255_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187798.1|4116625_4117423_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	4126353	4182895	5016623	protease,transposase	Acinetobacter_phage(20.0%)	40	NA	NA
WP_041182780.1|4126353_4127319_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407697.1|4129560_4130043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257818.1|4130239_4130776_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011257817.1|4130889_4132038_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|4132564_4133521_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011407696.1|4133710_4136677_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011407695.1|4136725_4137619_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407693.1|4140506_4142384_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011257812.1|4143660_4144662_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011257811.1|4144705_4146427_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257810.1|4146410_4146668_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_044757088.1|4146743_4147868_+	threonine dehydratase	NA	NA	NA	NA	NA
WP_011407690.1|4147864_4149427_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011257808.1|4149757_4150831_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011257807.1|4151647_4152295_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257806.1|4152362_4153811_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_027703665.1|4153931_4154816_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_115862292.1|4155807_4156773_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407687.1|4156941_4157403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257800.1|4157672_4158326_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407686.1|4158454_4159111_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257798.1|4159131_4160511_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011257797.1|4160783_4162100_-	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257796.1|4162176_4163097_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|4163330_4164665_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011407685.1|4164645_4165758_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257793.1|4165767_4165965_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_103057263.1|4166090_4166624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257791.1|4167250_4167886_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033013340.1|4170120_4170399_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_044757089.1|4170592_4173265_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	7.5e-77
WP_044757090.1|4173591_4174884_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.7	4.9e-74
WP_011257785.1|4175221_4175407_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_027703756.1|4175700_4176564_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011407680.1|4176563_4177691_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257782.1|4178320_4178707_-	twitching motility response regulator PilH	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011257781.1|4178946_4179846_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011407679.1|4180256_4180733_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257779.1|4180895_4181378_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_094187801.1|4182096_4182895_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	4215127	4289526	5016623	transposase,tRNA	Ralstonia_phage(16.67%)	50	NA	NA
WP_059317495.1|4215127_4216093_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757098.1|4216204_4218496_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_011257746.1|4218623_4219298_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_044757099.1|4219294_4221139_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_011257744.1|4221135_4222002_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_011257743.1|4222021_4222654_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_011407655.1|4222656_4223691_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011257741.1|4223705_4223996_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011407652.1|4231286_4232126_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407650.1|4232736_4233894_+	phosphotransferase	NA	NA	NA	NA	NA
WP_044757100.1|4233929_4236092_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407648.1|4236467_4237043_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_011257733.1|4237148_4237877_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_011257732.1|4238307_4239147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257731.1|4239143_4241456_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	23.5	5.2e-10
WP_011407647.1|4241452_4242262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407646.1|4242251_4242905_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_011407645.1|4242888_4244010_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|4244006_4244858_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_011257726.1|4244854_4245490_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_012446066.1|4245486_4245903_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011257724.1|4245899_4246409_-	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_011407642.1|4246418_4246850_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_044757101.1|4247117_4248335_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_041181968.1|4248334_4248514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446069.1|4248510_4250238_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_075240544.1|4250367_4250913_-	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012446071.1|4250930_4251443_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	38.8	5.7e-10
WP_011407636.1|4252470_4256268_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_044757102.1|4257245_4261298_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.1	3.4e-121
WP_011257718.1|4261696_4262494_-	DsbC family protein	NA	NA	NA	NA	NA
WP_011257717.1|4262946_4263918_-	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
WP_011257716.1|4264344_4264812_+	RDD family protein	NA	NA	NA	NA	NA
WP_011407635.1|4265226_4266333_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_044757103.1|4266329_4267412_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011257713.1|4267519_4268992_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
WP_011257711.1|4269337_4269763_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_044757104.1|4269970_4272913_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	8.4e-130
WP_027704099.1|4272920_4273223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187802.1|4273849_4274950_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	2.1e-41
WP_075244150.1|4275136_4275451_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_115862293.1|4275517_4276837_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|4276973_4277942_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_115862294.1|4278141_4279461_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044757108.1|4279780_4280821_+	pectate lyase	NA	NA	NA	NA	NA
WP_044757535.1|4281087_4283061_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	7.9e-15
WP_115862295.1|4283360_4284680_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4284829_4285798_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182545.1|4285874_4286831_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011407913.1|4288311_4289526_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
>prophage 36
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	4306643	4317271	5016623		Enterobacteria_phage(42.86%)	10	NA	NA
WP_011407616.1|4306643_4307990_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011257680.1|4308036_4309440_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011257679.1|4309556_4310465_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	2.4e-27
WP_011257678.1|4310461_4311019_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.0e-44
WP_011407613.1|4311015_4311903_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|4311958_4313014_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011257675.1|4313239_4313986_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011257674.1|4313985_4314927_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011407611.1|4315149_4315968_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407610.1|4315957_4317271_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
>prophage 37
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	4445286	4479225	5016623	transposase	Staphylococcus_prophage(33.33%)	30	NA	NA
WP_094187763.1|4445286_4446084_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703947.1|4447949_4448222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757130.1|4448209_4450024_-	methyltransferase	NA	NA	NA	NA	NA
WP_011407528.1|4450144_4450525_+	response regulator	NA	NA	NA	NA	NA
WP_011257545.1|4450493_4450760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407527.1|4450759_4452040_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407526.1|4453156_4454566_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_044757134.1|4454556_4455573_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027703945.1|4455601_4455931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165967674.1|4456942_4458394_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|4458691_4459648_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_012443955.1|4459723_4460692_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.5e-99
WP_115862298.1|4460841_4462161_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_153296753.1|4462231_4462396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059317500.1|4462395_4462662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4462886_4463933_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_044757138.1|4464116_4465697_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4466085_4466982_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4466984_4468148_-	COX15/CtaA family protein	NA	NA	NA	NA	NA
WP_011260478.1|4468158_4468734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443950.1|4468761_4469481_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4469541_4469760_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4469859_4470735_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012443948.1|4470773_4471370_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011409573.1|4471366_4471540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260484.1|4471520_4473125_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011260485.1|4473163_4474117_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_044757542.1|4474133_4474610_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4474886_4478087_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_094187805.1|4478246_4479225_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
>prophage 38
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	4492506	4633614	5016623	integrase,transposase,tRNA	Staphylococcus_prophage(13.04%)	100	4502707:4502723	4551079:4551095
WP_094187806.1|4492506_4493608_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409585.1|4494212_4496444_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_027704002.1|4496633_4498346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757142.1|4498494_4499871_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.9e-79
WP_041182574.1|4500165_4501122_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	4.5e-40
4502707:4502723	attL	GCGTAGTGCTGCGTCAT	NA	NA	NA	NA
WP_011407508.1|4504427_4504673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|4504669_4504942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257520.1|4504938_4505145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407507.1|4505365_4506553_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.0e-110
WP_044757143.1|4506812_4507610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181951.1|4507606_4508881_-	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	37.4	8.3e-58
WP_011257516.1|4508961_4509372_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	52.0	7.0e-35
WP_011257515.1|4510684_4510843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181950.1|4510839_4511142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757144.1|4511148_4512234_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_044757145.1|4512235_4512496_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_044757146.1|4512492_4512972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757147.1|4512985_4513705_-	P-type DNA transfer protein VirB5	NA	NA	NA	NA	NA
WP_165967658.1|4513919_4514075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757149.1|4514336_4515176_-	helix-turn-helix domain-containing protein	NA	R9TPU9	Vibrio_phage	40.0	8.0e-09
WP_041181948.1|4515644_4516739_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.9	2.6e-52
WP_011407506.1|4517488_4517809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407505.1|4518001_4519876_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011257505.1|4519984_4520425_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011257504.1|4520423_4521440_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011407503.1|4521639_4522161_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257502.1|4522403_4523537_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_042465436.1|4523646_4524150_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_044757151.1|4524146_4525652_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_094187807.1|4525817_4526876_-	UDP-N-acetylglucosamine 2-epimerase	NA	NA	NA	NA	NA
WP_011257498.1|4526876_4527701_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_044757153.1|4527898_4529176_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257496.1|4529340_4531062_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011407500.1|4531112_4532426_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257494.1|4532425_4533349_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011257493.1|4533742_4534255_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011407499.1|4534387_4535524_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257491.1|4535595_4536738_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011257490.1|4536780_4537254_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_041181947.1|4537294_4538017_+	pilin	NA	NA	NA	NA	NA
WP_011257488.1|4538058_4539333_+	RDD family protein	NA	NA	NA	NA	NA
WP_011257487.1|4539515_4542008_+	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257486.1|4542018_4542582_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011407497.1|4542805_4543579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173425352.1|4543602_4544250_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407495.1|4544411_4545188_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011257482.1|4545294_4545510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181946.1|4545695_4547597_-	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_041181945.1|4547681_4549058_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011257479.1|4549566_4550412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443959.1|4550742_4551345_-	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
4551079:4551095	attR	ATGACGCAGCACTACGC	NA	NA	NA	NA
WP_011257477.1|4551328_4552354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757158.1|4552819_4555042_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257475.1|4555444_4555960_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_115862299.1|4557415_4558381_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407487.1|4558565_4558898_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_041182799.1|4558903_4561228_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_044757162.1|4562061_4562508_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257470.1|4562606_4563092_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_011407484.1|4563124_4563532_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_010368143.1|4563567_4564935_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_011257468.1|4565073_4565439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187861.1|4565435_4565828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407482.1|4565896_4566361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257466.1|4567306_4568248_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_027703754.1|4568394_4568910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257464.1|4569053_4569431_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011257463.1|4569754_4570987_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_011257462.1|4571093_4571366_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_109181928.1|4572050_4573016_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012446211.1|4573012_4573207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756425.1|4573361_4574738_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_041182545.1|4574748_4575705_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_041182545.1|4576073_4577030_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_143690749.1|4579084_4579495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082322957.1|4579506_4590231_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.6	3.6e-37
WP_027704272.1|4590252_4591995_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.7	4.3e-33
WP_115862300.1|4592231_4593551_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242920.1|4593780_4594185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407477.1|4596065_4597064_-	class I SAM-dependent methyltransferase family protein	NA	NA	NA	NA	NA
WP_011407476.1|4597384_4597786_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_044757167.1|4598603_4600187_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.6	2.0e-61
WP_011257455.1|4600236_4601472_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	25.9	1.3e-20
WP_011407473.1|4601471_4602086_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_011257454.1|4602106_4603396_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_011257453.1|4603548_4604742_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011407472.1|4604738_4605320_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_011257452.1|4605545_4607759_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_044757169.1|4610150_4612073_+	MFS transporter	NA	NA	NA	NA	NA
WP_011257450.1|4612533_4612914_+	CD225/dispanin family protein	NA	NA	NA	NA	NA
WP_075242191.1|4612916_4613324_+	DUF2752 domain-containing protein	NA	NA	NA	NA	NA
WP_011257449.1|4613645_4614536_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_011257448.1|4614609_4615500_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_011407465.1|4615806_4617087_-	lipase	NA	NA	NA	NA	NA
WP_011407463.1|4618013_4618400_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.9	1.1e-24
WP_052658702.1|4618908_4619697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407461.1|4619804_4620431_+	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
WP_044757175.1|4620469_4622440_+	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011257440.1|4622440_4624750_+	response regulator	NA	A0A1V0SGX0	Hokovirus	40.8	7.7e-46
WP_011407458.1|4632402_4633614_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 39
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	4736577	4793281	5016623	transposase,tRNA	Tupanvirus(11.11%)	44	NA	NA
WP_011257354.1|4736577_4737582_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_012446316.1|4738044_4738269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113160272.1|4738519_4738705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257351.1|4738989_4739565_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027704120.1|4739623_4741129_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	1.6e-97
WP_011257349.1|4741837_4742308_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011407399.1|4743518_4743785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4743865_4744834_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044757197.1|4745218_4747351_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_011257344.1|4747628_4747778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257343.1|4747812_4748211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257342.1|4748200_4749052_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_041181934.1|4749104_4749986_+	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_011257339.1|4750608_4753143_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_011407395.1|4753376_4754129_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
WP_011407394.1|4754256_4755171_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407393.1|4756443_4757436_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_011257333.1|4758100_4758559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181932.1|4758658_4760449_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_027703506.1|4760657_4762895_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011257330.1|4763319_4764009_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_044757561.1|4764398_4767413_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407388.1|4767596_4768298_+	SapC family protein	NA	NA	NA	NA	NA
WP_011257326.1|4768287_4769301_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_041181930.1|4769311_4770877_+	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_044757199.1|4771016_4772027_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257323.1|4772436_4773630_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446337.1|4773626_4774373_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.5e-19
WP_027703503.1|4774404_4776006_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4776066_4776267_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027703502.1|4776263_4776851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153296754.1|4777054_4777216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407380.1|4777336_4777609_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_027703501.1|4777674_4778664_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_027703500.1|4778748_4779576_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011257314.1|4779612_4780608_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_011257313.1|4780604_4781417_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257312.1|4781380_4782169_+	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.5e-54
WP_012446345.1|4782287_4783226_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011257310.1|4783652_4784888_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_082322992.1|4784940_4786107_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187862.1|4788740_4789842_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	4.7e-41
WP_041182545.1|4789964_4790921_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_094187814.1|4792483_4793281_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 40
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	4802133	4890655	5016623	holin,transposase,tRNA	Bacillus_phage(22.22%)	49	NA	NA
WP_011407360.1|4802133_4802565_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011407359.1|4802567_4803197_+|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_044757206.1|4803226_4803427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464365.1|4803833_4806002_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257286.1|4806128_4808291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|4809117_4810083_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257284.1|4810275_4811757_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_011257283.1|4812193_4812553_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011407355.1|4812555_4813857_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011407354.1|4814037_4814814_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407353.1|4816106_4816691_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407352.1|4816883_4820336_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_044757210.1|4821080_4823723_+	glycosyl hydrolase 115 family protein	NA	NA	NA	NA	NA
WP_044757567.1|4823826_4826226_-	NdvB protein	NA	NA	NA	NA	NA
WP_027703801.1|4826228_4827611_-	MFS transporter	NA	NA	NA	NA	NA
WP_027703800.1|4827768_4828353_+	gluconokinase	NA	NA	NA	NA	NA
WP_044757212.1|4829245_4831000_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_011257273.1|4831307_4831535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|4831515_4831965_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257271.1|4831975_4832404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862301.1|4833898_4835218_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258188.1|4838089_4839058_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115862302.1|4840340_4841660_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012445230.1|4841952_4843188_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_059317507.1|4844869_4845826_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	1.0e-39
WP_115862304.1|4846670_4847636_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757224.1|4847653_4848211_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257259.1|4848229_4848517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407332.1|4848901_4849696_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257257.1|4849695_4850445_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446379.1|4850456_4851008_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257255.1|4851004_4851667_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011257254.1|4851656_4851947_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257253.1|4851957_4853016_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_044757229.1|4855682_4856645_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407325.1|4856991_4857807_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_044757236.1|4867152_4869057_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407319.1|4869053_4869656_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011407318.1|4869715_4871020_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011257243.1|4871567_4873730_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407316.1|4874023_4874230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257241.1|4874437_4874827_-	YchJ family protein	NA	NA	NA	NA	NA
WP_011257239.1|4876185_4877316_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|4877963_4879016_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257237.1|4879778_4880852_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011407313.1|4881159_4882218_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011407913.1|4883448_4884663_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_041182826.1|4886391_4886925_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_094187728.1|4889856_4890655_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 41
NZ_CP007166	Xanthomonas oryzae pv. oryzae PXO86 chromosome, complete genome	5016623	4944023	4989385	5016623	protease,transposase	Acidithiobacillus_phage(25.0%)	31	NA	NA
WP_115862307.1|4944023_4944989_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260840.1|4945164_4946580_-	amino acid permease	NA	NA	NA	NA	NA
WP_027704005.1|4947898_4949395_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_044757575.1|4949752_4950163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757577.1|4950540_4951086_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_044757259.1|4951181_4952558_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.1e-76
WP_011260845.1|4953594_4954722_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_011409820.1|4955577_4956918_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_011409821.1|4957134_4957827_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409822.1|4957950_4958271_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_011260850.1|4958270_4959263_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.4	8.5e-10
WP_011409823.1|4959569_4961093_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.7e-25
WP_027703885.1|4961197_4962496_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_011260853.1|4962593_4963250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757261.1|4963400_4965212_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_011409826.1|4965359_4965710_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_115862308.1|4965888_4967208_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042465377.1|4968620_4969802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409829.1|4969899_4973331_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_011409830.1|4973478_4974177_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_011409831.1|4974160_4975633_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_044757264.1|4975629_4976217_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_044757265.1|4976216_4977413_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_041182832.1|4977486_4978089_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.9	2.0e-46
WP_103057218.1|4978796_4979324_+	TolC family protein	NA	NA	NA	NA	NA
WP_011409837.1|4979320_4979887_+	FUSC family protein	NA	NA	NA	NA	NA
WP_011409838.1|4980162_4981524_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.9	8.3e-32
WP_082322996.1|4981785_4982742_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	2.4e-41
WP_011409842.1|4984831_4985038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409843.1|4985024_4986137_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_044749647.1|4988008_4989385_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
