The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007235	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 chromosome, complete genome	4856438	334267	354600	4856438	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_044815456.1|334267_334909_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	3.5e-33
WP_010989092.1|335105_335396_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|335644_336100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|336096_336702_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|336706_338452_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|338454_339087_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|339079_340195_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|340185_340545_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|340708_342256_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|342255_343185_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|343181_343544_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|343871_344594_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|344603_345647_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|345634_345844_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|345843_346797_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|346796_349151_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|349247_349376_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|349335_349653_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|349704_350229_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_044815461.1|350228_351656_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.7	1.1e-194
WP_000875314.1|351645_351843_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|351839_352295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|352454_352769_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|352781_353387_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|353389_353677_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|354252_354600_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 2
NZ_CP007235	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 chromosome, complete genome	4856438	1749377	1758109	4856438	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1749377_1750496_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1750492_1752439_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1752568_1752790_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1753113_1753434_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1753464_1755741_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1755932_1756391_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|1756853_1758109_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP007235	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 chromosome, complete genome	4856438	1808202	1907016	4856438	tail,lysis,tRNA,holin,protease,portal,terminase	Salmonella_phage(42.86%)	100	NA	NA
WP_001154025.1|1808202_1809006_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1808998_1810321_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1810301_1811006_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1811005_1815472_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925872.1|1815816_1817658_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1817917_1818466_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1818493_1819141_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_044815569.1|1819202_1820393_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1820577_1821669_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1822275_1823676_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1823876_1824338_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1824654_1825869_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1826113_1827550_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1827631_1828834_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1829028_1830321_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1830365_1830614_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1830654_1830894_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1830936_1832094_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1832056_1834942_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1835068_1835368_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1835389_1835548_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1835540_1835801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1835850_1836261_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1836380_1836620_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1836585_1836960_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1837044_1838028_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1838030_1838780_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1838790_1839138_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1839134_1839446_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_001217665.1|1840106_1840340_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1840451_1840673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1840755_1841358_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1841566_1842178_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1842174_1842321_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1842310_1843108_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1843174_1843492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1843665_1843791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1843926_1844376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1844736_1845423_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1845698_1846028_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1846011_1846464_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1846481_1846961_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1847168_1847702_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1847658_1849797_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1849793_1850000_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|1849996_1851544_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|1851467_1853549_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1853639_1853963_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1853955_1854255_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1854235_1854802_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1854798_1855200_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1855211_1855961_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1856006_1856405_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1856401_1856731_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1856810_1859798_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1859794_1860127_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1860225_1860723_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1860839_1861373_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1861462_1862158_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1862167_1862905_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1862802_1863507_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541993.1|1866053_1866929_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178849.1|1866967_1867210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1867263_1869702_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1869701_1870283_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1870758_1871727_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1872374_1873001_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1873069_1873369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1873353_1874040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1874310_1874502_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1874928_1877541_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1877748_1878759_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1878924_1879467_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1879463_1880573_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1880671_1882780_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1882792_1884700_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1884714_1885968_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1885972_1887613_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1887609_1888173_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1888428_1888596_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1888695_1889214_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1889282_1891043_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1891228_1891681_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1891752_1892805_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1893161_1893671_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1893887_1894493_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1894479_1896633_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1896651_1897098_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1897221_1899276_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1899311_1899770_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1899864_1900527_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1900700_1901114_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1901158_1901476_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1901533_1902745_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1902959_1903508_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1903533_1904313_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1904361_1904643_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1904639_1904969_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1905055_1905715_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1906335_1907016_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP007235	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 chromosome, complete genome	4856438	2695443	2702252	4856438	integrase,tail	Salmonella_phage(33.33%)	11	2690306:2690328	2700021:2700043
2690306:2690328	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|2695443_2696325_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|2696797_2696986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2697050_2697218_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|2697474_2698008_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|2698061_2698292_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|2698481_2698976_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|2699035_2699890_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|2700263_2700617_-	YebY family protein	NA	NA	NA	NA	NA
2700021:2700043	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|2700633_2701509_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|2701509_2701884_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|2702021_2702252_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP007235	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 chromosome, complete genome	4856438	2777543	2856887	4856438	tail,lysis,transposase,integrase,holin,protease,head,capsid,portal,terminase,plate	Salmonella_phage(86.36%)	102	2784081:2784096	2858510:2858525
WP_000502119.1|2777543_2778002_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2778182_2779388_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2779466_2780954_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2781210_2782614_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2782628_2783036_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2783035_2783404_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2783475_2784960_+	alpha-amylase	NA	NA	NA	NA	NA
2784081:2784096	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2784999_2785425_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2785610_2786816_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2786812_2787046_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2787310_2787697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2787816_2788131_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2788347_2790030_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2790022_2791018_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2791010_2791718_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2791717_2793088_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2793109_2793553_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2793549_2794767_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2794871_2795339_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2795343_2796348_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2796344_2796758_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2796757_2797135_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2797134_2797872_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2797881_2798151_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2798159_2798954_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2799235_2799859_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867218.1|2799897_2800092_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2800220_2800448_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2800757_2801573_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2801551_2803264_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_000232161.1|2803428_2803614_-	YodC family protein	NA	NA	NA	NA	NA
WP_085983315.1|2803690_2804608_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2804777_2805698_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2805686_2806157_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2806137_2807568_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2807641_2808337_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2808428_2808728_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2809377_2810574_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2810834_2811023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2811033_2811246_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2811700_2812969_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2812971_2813391_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2813517_2813679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2814309_2814531_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2814743_2815751_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_015701331.1|2816035_2816635_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000554737.1|2816604_2818167_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001207832.1|2818153_2818741_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_014343855.1|2818743_2819265_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_014343856.1|2819299_2819845_-|plate	baseplate J/gp47 family protein	plate	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2819816_2820230_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2820234_2820768_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2820767_2821826_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2821822_2823163_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2823196_2825125_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2825209_2825536_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2825532_2825889_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2825888_2827385_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2827374_2827539_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2827542_2828103_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2828099_2828612_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2828583_2828988_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2828984_2829308_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2829310_2829511_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_044815646.1|2829561_2830767_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	99.8	4.5e-223
WP_001193639.1|2830781_2831432_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2831409_2832651_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2832650_2832833_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2832844_2834578_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2834574_2835069_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2835194_2835545_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2835605_2835908_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2836127_2836547_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2836759_2837245_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2837241_2837856_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2837858_2838203_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2838364_2838799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2838728_2838986_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2839118_2839742_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_071883247.1|2839752_2840742_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.4e-190
WP_001061457.1|2840749_2841610_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2841626_2842016_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2842012_2842906_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2842905_2843388_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2843389_2844208_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2844204_2844429_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2844425_2845583_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2845579_2846134_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2846162_2846387_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2846484_2847180_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2847994_2848366_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2848423_2849251_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2849387_2849927_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2849997_2850228_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2850224_2850740_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2850736_2851354_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2851350_2852184_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2852187_2852757_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_001527041.1|2852796_2853024_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_000532847.1|2853025_2854015_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2854306_2855104_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001219015.1|2856413_2856887_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2858510:2858525	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP007235	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 chromosome, complete genome	4856438	2942881	2953387	4856438		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2942881_2944195_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2944221_2945301_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2945305_2946079_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2946075_2947068_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2947073_2947625_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2947625_2948504_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2948551_2949451_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2949450_2950536_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2950912_2951806_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2951983_2953387_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP007235	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 chromosome, complete genome	4856438	3021694	3030865	4856438	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|3021694_3023728_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|3023968_3024427_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|3024598_3025129_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3025185_3025653_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|3025699_3026419_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|3026415_3028101_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|3028323_3029055_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3029114_3029222_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|3029202_3029934_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3029917_3030865_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
NZ_CP007235	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 chromosome, complete genome	4856438	3050272	3116667	4856438	tail,lysis,holin	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|3050272_3050968_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|3051121_3052006_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|3052182_3052902_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|3052898_3053144_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|3053348_3054590_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|3054583_3055819_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|3055893_3056904_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|3056919_3058440_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|3058573_3059572_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_044815683.1|3060070_3061093_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|3061242_3062385_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|3062399_3063068_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|3063397_3064255_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|3064243_3064633_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|3064637_3066005_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|3066221_3067109_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|3067141_3068464_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|3068507_3070499_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|3070843_3072313_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|3072502_3073366_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|3073486_3074536_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|3074614_3075472_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|3075536_3077225_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|3077241_3078180_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_044815686.1|3078179_3079310_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|3079678_3080860_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|3080924_3081590_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|3081591_3081714_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|3082101_3082356_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|3082679_3083252_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|3083464_3084451_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|3084480_3085200_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|3085613_3086186_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|3086511_3088068_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|3088174_3089980_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|3089989_3091084_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|3091083_3092109_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|3092110_3093700_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|3093703_3094048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|3094438_3095629_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|3095656_3096352_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|3096503_3098264_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|3098388_3098673_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|3098781_3099402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|3099429_3100437_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|3100616_3100844_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|3100875_3102636_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|3102916_3103420_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|3103447_3103738_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|3104085_3105915_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|3105968_3106412_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|3106789_3107317_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|3107319_3108561_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|3109153_3109483_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|3109779_3111111_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|3111139_3111508_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|3111522_3112512_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|3112840_3115207_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|3115375_3115579_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|3115875_3116667_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP007235	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 chromosome, complete genome	4856438	3455557	3562185	4856438	tail,lysis,transposase,integrase,tRNA,holin,protease,head,capsid,portal,terminase	Salmonella_phage(35.0%)	107	3480102:3480118	3570089:3570105
WP_000940032.1|3455557_3456289_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|3456407_3457211_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|3457355_3458234_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|3458415_3459459_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|3459462_3460281_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_044815719.1|3460291_3461305_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|3461305_3462292_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|3462282_3462921_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|3463046_3464324_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|3464318_3465458_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|3465653_3466907_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|3467231_3468422_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|3468603_3470148_+	lysine decarboxylation/transport transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000100008.1|3470508_3471840_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|3471922_3474067_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|3474122_3475583_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|3475631_3475970_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|3476046_3477384_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|3477380_3478145_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|3478146_3479577_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
3480102:3480118	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_044815721.1|3480226_3484114_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|3484135_3484369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|3484369_3485914_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|3485964_3486516_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|3486540_3487176_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|3487179_3488541_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|3488551_3489445_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|3489560_3490409_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|3490447_3491365_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|3491386_3492583_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|3492698_3493625_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|3493662_3493923_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|3494034_3494415_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|3494414_3495146_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|3495157_3495886_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|3495897_3496803_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|3496799_3497480_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|3497753_3498728_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|3498744_3500544_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|3500948_3502442_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|3502926_3503064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|3503776_3503941_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738443.1|3504648_3504861_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|3504967_3505195_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|3505291_3505870_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|3505859_3506684_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|3506680_3509053_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|3509106_3509349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|3509387_3512750_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|3512811_3513459_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|3513356_3514094_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|3514100_3514799_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|3514808_3515138_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|3515140_3518236_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|3518207_3518546_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|3518542_3518938_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|3518988_3519735_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|3519742_3520144_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|3520252_3521383_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|3521431_3522010_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|3522037_3522421_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|3522431_3522791_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522566.1|3522848_3523877_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|3523931_3524279_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|3524291_3525788_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|3525777_3527358_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|3527354_3527558_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|3527541_3529473_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|3529444_3529990_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_044815726.1|3530276_3530678_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_024135675.1|3530913_3531372_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	86.2	2.6e-62
WP_000984581.1|3531389_3531842_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|3531825_3532155_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|3532430_3533117_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_023221874.1|3533334_3533523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024150660.1|3534049_3534475_-	subtilase	NA	NA	NA	NA	NA
WP_022742790.1|3534607_3535333_-	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	66.2	4.0e-81
WP_022742791.1|3535533_3536112_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.1e-49
WP_050196634.1|3536126_3537116_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	3.5e-189
WP_024150661.1|3537123_3537984_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.3	9.2e-162
WP_000767086.1|3538000_3538390_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_001669427.1|3539278_3539761_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	6.0e-86
WP_022742797.1|3539762_3540722_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.2e-117
WP_000620702.1|3540718_3540943_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_031609052.1|3540939_3542082_-	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	98.2	1.0e-208
WP_023139406.1|3542078_3542633_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	1.2e-101
WP_001191666.1|3542661_3542886_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|3542983_3543679_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000917563.1|3544032_3544191_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_022742800.1|3544212_3544563_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_001539618.1|3547579_3548737_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|3548779_3549019_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|3549059_3549344_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_044815735.1|3549321_3550551_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	93.9	1.1e-232
WP_000589087.1|3551048_3551528_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|3551524_3552481_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|3552480_3553131_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|3553162_3553738_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|3553734_3553899_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|3554162_3555785_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|3555769_3556507_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|3556637_3557972_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|3557989_3558889_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|3558991_3559579_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|3559640_3560024_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|3560342_3561032_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|3561147_3562185_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
3570089:3570105	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 10
NZ_CP007235	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 chromosome, complete genome	4856438	3588995	3651915	4856438	tail,lysis,integrase,tRNA,head,capsid,portal,terminase,plate	Salmonella_phage(95.45%)	61	3618001:3618047	3652035:3652081
WP_000469804.1|3588995_3589763_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|3589807_3590356_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|3590374_3590623_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|3590936_3592298_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|3592463_3593255_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|3593274_3594561_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|3594681_3595287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|3595321_3595912_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|3596034_3596913_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|3596998_3598660_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|3598808_3599147_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|3599312_3599603_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|3599592_3600069_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|3600218_3600701_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237669.1|3601314_3612789_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533858.1|3612853_3614263_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|3614259_3616440_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|3616447_3617611_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
3618001:3618047	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_000980500.1|3618162_3618381_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|3618449_3619550_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|3619546_3620032_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001677191.1|3620028_3622836_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	100.0	0.0e+00
WP_000763316.1|3622828_3622948_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280963.1|3622962_3623265_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_001207651.1|3623319_3623835_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046108.1|3623844_3625017_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_000974843.1|3625119_3625344_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|3626213_3626789_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001274649.1|3626788_3628642_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_001086804.1|3628638_3629244_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_000268332.1|3629236_3630145_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000189373.1|3630131_3630491_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|3630487_3631066_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|3631143_3631995_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|3631996_3632443_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|3632435_3632867_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|3632962_3633391_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001069923.1|3633387_3633903_-	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000171565.1|3633883_3634099_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|3634102_3634306_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673537.1|3634305_3634770_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000059173.1|3634863_3635514_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730759.1|3635517_3636579_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000216276.1|3636595_3637429_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|3637571_3639338_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|3639337_3640378_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284991.1|3640481_3642146_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|3642459_3643137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3643250_3643484_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154433.1|3643494_3643683_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000017507.1|3643835_3646250_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_000104187.1|3646246_3647104_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000752613.1|3647100_3647328_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|3647327_3647561_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000963474.1|3647628_3647970_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_000956190.1|3647933_3648134_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|3648141_3648651_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000102105.1|3648684_3648927_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932273.1|3649048_3649681_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_044815737.1|3649683_3650700_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	99.7	1.5e-198
WP_000360326.1|3651252_3651915_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
3652035:3652081	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
