The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010947	Aeromonas hydrophila strain AL06-06 isolate Goldfish chromosome, complete genome	4884823	41222	114911	4884823	portal,tail,capsid,plate,tRNA,head,lysis,terminase,integrase,holin	Salmonella_phage(20.51%)	86	80115:80135	114975:114995
WP_026080420.1|41222_41954_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_011704079.1|42178_44296_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	37.6	6.1e-13
WP_005307060.1|44433_44709_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016348898.1|44788_45415_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	37.4	1.1e-23
WP_044801127.1|45686_46769_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_044798708.1|46923_47637_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_044798709.1|47707_48571_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_011704084.1|48578_49433_-	DMT family transporter	NA	NA	NA	NA	NA
WP_044798710.1|49476_49935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016348905.1|50219_51119_-	EamA family transporter	NA	NA	NA	NA	NA
WP_011704088.1|51210_52185_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044798711.1|52163_53177_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_044798712.1|53368_53809_-	universal stress protein	NA	NA	NA	NA	NA
WP_044798716.1|54275_55463_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_044798717.1|55478_57269_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.8	1.1e-15
WP_016348910.1|57478_58003_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_162484572.1|58086_59271_+	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
WP_044798720.1|59457_60678_-	MFS transporter	NA	NA	NA	NA	NA
WP_044798721.1|60953_61592_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_044798722.1|61635_62322_-	molecular chaperone	NA	NA	NA	NA	NA
WP_162484562.1|62324_63950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052508915.1|63949_66427_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_044798724.1|66478_67144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798725.1|67203_67782_-	fimbrial protein	NA	NA	NA	NA	NA
WP_044798726.1|68382_69006_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_044798727.1|69008_72596_+	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	32.5	7.8e-37
WP_024945882.1|72631_73072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798728.1|73244_74918_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_044798729.1|74964_75696_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_044798730.1|75805_76996_+	MFS transporter	NA	NA	NA	NA	NA
WP_044798731.1|77070_78195_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_011704108.1|78191_78701_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.0	2.6e-18
WP_005306985.1|78763_79066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798732.1|79070_79997_-	sodium-dependent bicarbonate transport family permease	NA	NA	NA	NA	NA
80115:80135	attL	AACTACAAACAGCTCTATTAC	NA	NA	NA	NA
WP_144406105.1|80230_81343_-	phage late control D family protein	NA	E5E3P7	Burkholderia_phage	56.0	7.9e-97
WP_044798736.1|81378_81873_-|tail	tail assembly protein	tail	E5G6Q2	Salmonella_phage	57.1	2.7e-33
WP_044798737.1|81885_84345_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	40.3	7.0e-162
WP_044798738.1|84341_84473_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_039214151.1|84481_84766_-|tail	phage tail assembly protein	tail	E5FFG6	Burkholderia_phage	45.3	1.4e-10
WP_044798739.1|84845_85364_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	57.0	4.2e-53
WP_044798740.1|85373_86552_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	62.0	2.7e-135
WP_044798741.1|86735_87143_-|tail	tail fiber assembly protein	tail	B0VK51	Azospirillum_phage	50.0	5.4e-11
WP_044798742.1|87153_88182_-	DNA inversion product	NA	A0A1I9KF43	Aeromonas_phage	62.5	1.1e-60
WP_044798743.1|88178_88811_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	60.6	1.6e-65
WP_044798744.1|88807_89707_-|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	57.5	8.4e-89
WP_044798745.1|89703_90063_-|plate	baseplate assembly protein	plate	A4PE42	Ralstonia_virus	57.1	1.2e-22
WP_044798746.1|90059_90632_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	40.2	6.0e-24
WP_080891176.1|90773_91415_-	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	40.5	8.0e-09
WP_044798748.1|91396_91867_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	46.6	1.7e-32
WP_044798749.1|91977_92445_-|lysis	phage lysis regulatory protein LysB	lysis	E5G6N2	Salmonella_phage	34.5	5.4e-07
WP_044798751.1|92595_93414_-	DUF3380 domain-containing protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	53.3	2.2e-67
WP_044798752.1|93410_93719_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	38.0	7.9e-07
WP_044798753.1|93720_93981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798755.1|93982_94348_-	membrane protein	NA	A0A1S5NRL1	Burkholderia_phage	43.4	1.6e-14
WP_049828121.1|94363_94606_-	conjugal transfer protein TraR	NA	A0A1S6L007	Salmonella_phage	38.0	3.4e-05
WP_017765313.1|94596_94800_-|tail	tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	59.1	2.8e-16
WP_005308743.1|94799_95270_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	49.0	1.2e-30
WP_044798756.1|95379_96063_-|terminase	terminase	terminase	A4PE31	Ralstonia_virus	45.3	6.6e-46
WP_044798757.1|96072_97125_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	56.8	2.0e-110
WP_044798758.1|97137_97968_-|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	46.1	3.1e-53
WP_044798759.1|98116_99886_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	67.7	4.4e-235
WP_080891177.1|99882_100947_+|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	57.4	1.2e-115
WP_052508916.1|101793_102159_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044798761.1|102677_102866_-	DUF3283 family protein	NA	NA	NA	NA	NA
WP_044798762.1|103354_103696_-	hypothetical protein	NA	A0A219YA08	Aeromonas_phage	43.8	1.8e-15
WP_044798763.1|103692_104043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798764.1|104035_104440_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	54.8	6.1e-15
WP_044801131.1|104424_105081_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	35.2	6.2e-25
WP_044798765.1|105128_105356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798767.1|105366_107769_-	replication endonuclease	NA	A5X9G4	Aeromonas_virus	35.4	4.6e-102
WP_044798768.1|107750_108122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798769.1|108199_108445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798770.1|108441_108663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798771.1|108962_109145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798772.1|109141_109432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798774.1|109512_109812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139726060.1|109953_110115_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_044798775.1|110107_110542_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	61.5	2.8e-42
WP_044798776.1|110578_111022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798777.1|111037_111256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080891178.1|111252_111570_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_044798778.1|111582_112095_-	phage protein	NA	A5X9F7	Aeromonas_virus	44.5	1.1e-29
WP_044798779.1|112122_112332_-	regulator for prophage	NA	NA	NA	NA	NA
WP_044798781.1|112514_113294_+	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	47.4	9.5e-57
WP_044798782.1|113304_113844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044798783.1|113840_114911_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	56.4	7.6e-105
114975:114995	attR	AACTACAAACAGCTCTATTAC	NA	NA	NA	NA
>prophage 2
NZ_CP010947	Aeromonas hydrophila strain AL06-06 isolate Goldfish chromosome, complete genome	4884823	958901	968838	4884823	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_044799243.1|958901_959648_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.1	2.1e-69
WP_011704775.1|959652_960270_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	4.0e-34
WP_016349540.1|960266_960848_+	DedA family protein	NA	NA	NA	NA	NA
WP_044799244.1|960858_961899_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	35.1	4.3e-12
WP_044799245.1|961946_962930_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	1.7e-34
WP_024946180.1|963015_964029_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	9.1e-108
WP_005309452.1|964208_964424_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_044799246.1|964439_964883_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	2.9e-26
WP_024946181.1|964971_966759_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	5.2e-74
WP_073348937.1|966972_968838_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 3
NZ_CP010947	Aeromonas hydrophila strain AL06-06 isolate Goldfish chromosome, complete genome	4884823	1643019	1679052	4884823		Aeromonas_phage(66.67%)	52	NA	NA
WP_044799561.1|1643019_1646553_-	type I restriction-modification system endonuclease	NA	A0A2I7QZ21	Vibrio_phage	22.0	1.2e-05
WP_044799562.1|1646555_1647494_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_080891284.1|1647764_1648910_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	60.5	5.4e-125
WP_017411491.1|1648906_1649104_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	57.4	3.3e-14
WP_044799564.1|1649096_1649537_-	hypothetical protein	NA	A0A1I9KG69	Aeromonas_phage	85.4	5.8e-51
WP_044799565.1|1649593_1649842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044799566.1|1649944_1650559_-	hypothetical protein	NA	H2BD40	Pseudomonas_phage	37.6	8.7e-05
WP_044799567.1|1650555_1650861_-	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	91.3	6.4e-41
WP_144406123.1|1650864_1651578_-	hypothetical protein	NA	A0A1I9KF90	Aeromonas_phage	91.6	2.0e-125
WP_044799569.1|1651651_1651879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044799570.1|1651950_1652169_-	hypothetical protein	NA	A0A1I9KF77	Aeromonas_phage	97.2	7.0e-34
WP_080891285.1|1652132_1653308_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	61.1	5.5e-16
WP_052508935.1|1653304_1653883_-	hypothetical protein	NA	A0A1I9KF82	Aeromonas_phage	45.2	5.8e-27
WP_052508936.1|1653879_1654152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044799571.1|1654148_1655060_-	recombination-associated protein RdgC	NA	A0A1I9KF67	Aeromonas_phage	51.5	8.2e-84
WP_044799572.1|1655315_1655894_-	phage N-6-adenine-methyltransferase	NA	A0A1I9KF87	Aeromonas_phage	95.3	1.8e-105
WP_044799573.1|1655886_1656501_-	hypothetical protein	NA	A0A076G7C3	Sinorhizobium_phage	37.9	1.3e-29
WP_044799574.1|1656497_1657715_-	hypothetical protein	NA	A0A1I9KG78	Aeromonas_phage	79.2	8.7e-174
WP_080891286.1|1657765_1658881_-	hypothetical protein	NA	A0A1I9KFA0	Aeromonas_phage	92.6	2.9e-99
WP_052508937.1|1658926_1659904_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	90.9	2.6e-168
WP_044799576.1|1659900_1660746_-	exodeoxyribonuclease VIII	NA	A0A1I9KFF5	Aeromonas_phage	94.0	2.2e-160
WP_044799577.1|1660742_1661105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044799578.1|1661101_1661467_-	hypothetical protein	NA	A0A1I9KFC9	Aeromonas_phage	63.6	1.4e-34
WP_044799579.1|1661469_1661661_-	hypothetical protein	NA	A0A1I9KG01	Aeromonas_phage	93.5	3.4e-24
WP_052508938.1|1661736_1662423_-	hypothetical protein	NA	A0A0P0ZGC2	Escherichia_phage	50.0	3.8e-25
WP_144406124.1|1662753_1663029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044799580.1|1663300_1663546_-	hypothetical protein	NA	A0A1I9KF98	Aeromonas_phage	85.2	2.4e-30
WP_044799581.1|1663845_1664025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052508955.1|1664660_1665245_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044799583.1|1665411_1665618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034283244.1|1665659_1666049_+	hypothetical protein	NA	A0A1I9KF96	Aeromonas_phage	81.4	1.2e-47
WP_017411466.1|1666053_1666272_+	hypothetical protein	NA	A0A1I9KFG0	Aeromonas_phage	90.3	9.8e-28
WP_044799585.1|1667429_1668842_+	AAA family ATPase	NA	Q716D2	Shigella_phage	44.4	1.8e-101
WP_044799586.1|1668834_1669146_+	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	80.8	1.4e-38
WP_044799587.1|1669223_1669517_+	hypothetical protein	NA	A0A1I9KG94	Aeromonas_phage	91.8	3.4e-47
WP_158319750.1|1669525_1669687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044799588.1|1669689_1670133_+	recombination protein NinB	NA	A0A1I9KFA6	Aeromonas_phage	91.7	6.0e-72
WP_044799589.1|1670129_1670789_+	hypothetical protein	NA	A0A1I9KFG5	Aeromonas_phage	93.6	1.9e-119
WP_044799590.1|1670785_1671103_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	91.4	1.2e-50
WP_044799591.1|1671099_1671339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044799592.1|1671335_1671758_+	hypothetical protein	NA	A0A1I9KG18	Aeromonas_phage	80.7	2.4e-62
WP_044799593.1|1671754_1672366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044799594.1|1672483_1672828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044799595.1|1672824_1673019_+	DUF3283 family protein	NA	NA	NA	NA	NA
WP_044799596.1|1673042_1673264_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_044801180.1|1673408_1673615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044799597.1|1673611_1674160_+	hypothetical protein	NA	A2I317	Vibrio_virus	56.8	1.4e-49
WP_044799598.1|1674167_1674392_+	hypothetical protein	NA	A0A1I9KFG6	Aeromonas_phage	65.8	4.5e-20
WP_044799599.1|1674388_1674571_+	hypothetical protein	NA	A0A1I9KFC5	Aeromonas_phage	54.5	7.2e-08
WP_044799600.1|1674697_1675285_+	hypothetical protein	NA	A0A2L1IV66	Escherichia_phage	32.0	4.7e-08
WP_044799601.1|1675274_1676843_+	hypothetical protein	NA	A0A096XUU0	Cronobacter_phage	35.3	5.4e-75
WP_052508939.1|1676847_1679052_+	hypothetical protein	NA	W8FP98	Vibrio_phage	28.8	8.7e-39
>prophage 4
NZ_CP010947	Aeromonas hydrophila strain AL06-06 isolate Goldfish chromosome, complete genome	4884823	3823776	3831285	4884823	protease	Staphylococcus_phage(50.0%)	8	NA	NA
WP_016351731.1|3823776_3824247_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	3.5e-30
WP_044800624.1|3824444_3825656_+|protease	serine protease	protease	V5LS29	Emiliania_huxleyi_virus	26.9	5.2e-09
WP_016351734.1|3825719_3826829_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.0	7.9e-65
WP_044800625.1|3826970_3827624_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.1	1.6e-20
WP_044800626.1|3827678_3828788_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	1.6e-49
WP_010675395.1|3828884_3829334_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_080891423.1|3829468_3829948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011707102.1|3830031_3831285_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.5	2.3e-100
>prophage 5
NZ_CP010947	Aeromonas hydrophila strain AL06-06 isolate Goldfish chromosome, complete genome	4884823	4167094	4257994	4884823	portal,tail,capsid,tRNA,head,terminase,transposase,integrase,holin	Aeromonas_virus(62.5%)	89	4192638:4192655	4236714:4236731
WP_044800793.1|4167094_4167805_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_080891590.1|4167995_4169303_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_080891591.1|4169639_4170974_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_029304812.1|4171044_4171275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016351979.1|4171279_4171741_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_011707398.1|4171730_4172189_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_044800797.1|4172327_4173314_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_010636148.1|4173541_4173967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005305063.1|4174068_4174341_-	DNA-binding protein HU-alpha	NA	A0A249Y2G7	Serratia_phage	44.2	3.6e-11
WP_011707403.1|4174681_4175164_+	Rsd/AlgQ family anti-sigma factor	NA	NA	NA	NA	NA
WP_011707404.1|4175265_4175646_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011707405.1|4175717_4177082_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_044800798.1|4177182_4179561_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_044800799.1|4179687_4180593_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_044800800.1|4180642_4181653_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_044800801.1|4181773_4182382_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_044800802.1|4182435_4184682_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	32.1	2.3e-18
WP_011707410.1|4184751_4185468_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_044800803.1|4185545_4186754_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_011707412.1|4186768_4188100_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.2e-78
WP_044800804.1|4188210_4188984_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_005305103.1|4189375_4189546_-	DUF1427 family protein	NA	R4TMJ4	Halovirus	60.0	6.3e-06
WP_044800805.1|4189669_4190944_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_044800806.1|4191157_4191946_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_044800807.1|4191986_4192604_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_080891444.1|4192572_4192755_-	hypothetical protein	NA	NA	NA	NA	NA
4192638:4192655	attL	GCGCGTCATCCTGCTCGC	NA	NA	NA	NA
WP_044800808.1|4192958_4194311_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	43.1	9.0e-95
WP_016351995.1|4194647_4196084_-	ammonium transporter	NA	NA	NA	NA	NA
WP_044801234.1|4196663_4197704_-|integrase	site-specific integrase	integrase	A5X9F3	Aeromonas_virus	78.5	2.4e-156
WP_044800809.1|4197958_4198741_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_144406155.1|4198752_4199403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044800810.1|4199399_4200233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024943320.1|4200292_4200967_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	43.4	3.4e-42
WP_044800811.1|4201100_4201286_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_044800812.1|4201297_4201585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080891445.1|4201520_4202096_+	hypothetical protein	NA	A5X9F7	Aeromonas_virus	55.7	2.5e-38
WP_044800813.1|4202109_4202538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044800814.1|4202576_4202762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044801236.1|4202785_4203052_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044800815.1|4203765_4204050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080891446.1|4204049_4206815_+	replication endonuclease	NA	A5X9G4	Aeromonas_virus	36.7	1.9e-123
WP_044800816.1|4206952_4207333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144406156.1|4207640_4208174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080741289.1|4208208_4208463_-	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	66.2	2.4e-25
WP_080891447.1|4208520_4209336_-|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	76.2	8.0e-115
WP_080891448.1|4209253_4211383_-|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	66.9	9.1e-243
WP_080891449.1|4211560_4212478_+|capsid	capsid protein	capsid	A5X9H4	Aeromonas_virus	48.3	1.5e-69
WP_044800819.1|4212488_4213568_+|capsid	phage major capsid protein, P2 family	capsid	A5X9H5	Aeromonas_virus	69.6	2.5e-140
WP_044800820.1|4213570_4214296_+|terminase	terminase	terminase	A5X9H6	Aeromonas_virus	74.1	1.0e-97
WP_044801242.1|4214401_4214863_+|head	head completion/stabilization protein	head	A5X9H7	Aeromonas_virus	68.0	7.4e-49
WP_044800821.1|4214859_4215375_+	phage protein	NA	A5X9H8	Aeromonas_virus	57.0	3.8e-54
WP_044800822.1|4215400_4216537_+	DUF2586 family protein	NA	A5X9I0	Aeromonas_virus	87.8	1.3e-190
WP_044800823.1|4216540_4216996_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	86.0	3.4e-70
WP_042064911.1|4217006_4217216_+	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	88.4	1.0e-29
WP_044800824.1|4217239_4217551_+|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	56.4	4.5e-26
WP_044800825.1|4217552_4218032_+	TIGR02594 family protein	NA	A0A1I9KGA3	Aeromonas_phage	70.7	2.6e-65
WP_044800826.1|4218028_4218463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043122797.1|4218586_4218853_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	2.6e-22
WP_044800828.1|4219041_4221099_+|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	59.1	1.8e-203
WP_044800829.1|4221095_4221419_+	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	93.5	7.2e-51
WP_044800830.1|4221415_4222603_+	phage protein	NA	A5X9J1	Aeromonas_virus	90.4	3.9e-203
WP_044800831.1|4222595_4223198_+	phage protein	NA	A5X9J2	Aeromonas_virus	92.4	1.7e-106
WP_044800832.1|4223194_4225285_+|tail	phage tail protein	tail	A5X9J3	Aeromonas_virus	73.7	1.1e-298
WP_044800833.1|4225300_4225726_+|tail	tail protein	tail	A5X9J5	Aeromonas_virus	49.6	8.3e-31
WP_044800834.1|4225722_4226604_+	hypothetical protein	NA	A5X9J6	Aeromonas_virus	79.2	8.4e-126
WP_044800835.1|4226600_4227152_+	hypothetical protein	NA	A5X9J7	Aeromonas_virus	77.0	2.1e-66
WP_044800836.1|4227148_4228762_+	hypothetical protein	NA	A5X9J8	Aeromonas_virus	81.9	6.6e-262
WP_052508950.1|4228772_4229471_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_044800837.1|4230085_4231456_+	Fic family protein	NA	NA	NA	NA	NA
WP_016352039.1|4231838_4232360_+	RDD family protein	NA	NA	NA	NA	NA
WP_011707420.1|4232517_4233588_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_005305138.1|4233729_4234842_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011707422.1|4235014_4236523_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.6	4.4e-50
WP_044800838.1|4236685_4237141_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
4236714:4236731	attR	GCGAGCAGGATGACGCGC	NA	NA	NA	NA
WP_044800839.1|4237206_4240059_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.2	2.4e-137
WP_029302168.1|4240245_4241538_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016352045.1|4241556_4242222_+	DedA family protein	NA	NA	NA	NA	NA
WP_011707427.1|4242361_4243189_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_005305164.1|4244426_4244615_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	2.9e-12
WP_011707428.1|4244708_4245956_-	aspartate kinase	NA	NA	NA	NA	NA
WP_043127213.1|4245972_4248597_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	6.2e-76
WP_044800840.1|4249069_4249570_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_011707431.1|4249611_4250676_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	64.4	1.5e-116
WP_044800841.1|4250755_4251247_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.6	1.1e-29
WP_044800842.1|4251481_4254064_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.9	3.2e-32
WP_044800843.1|4254157_4255756_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.2	1.4e-25
WP_011707435.1|4255765_4256293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011707436.1|4256456_4256936_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044798965.1|4257031_4257994_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
