The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007211	Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 chromosome, complete genome	4667713	1153084	1158888	4667713		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|1153084_1155418_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|1155432_1155753_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|1155749_1155977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|1155973_1156525_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|1156521_1156788_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_024155472.1|1157325_1158063_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.0	8.4e-79
WP_000984211.1|1158059_1158305_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|1158321_1158888_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 2
NZ_CP007211	Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 chromosome, complete genome	4667713	1681419	1690590	4667713	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1681419_1682367_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1682350_1683082_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1683062_1683170_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1683229_1683961_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1684183_1685869_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1685865_1686585_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1686631_1687099_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1687155_1687686_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1687857_1688316_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1688556_1690590_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP007211	Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 chromosome, complete genome	4667713	1758682	1764979	4667713		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1758682_1760086_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1760263_1761157_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1761533_1762619_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1762618_1763518_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1763565_1764444_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1764448_1764979_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 4
NZ_CP007211	Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 chromosome, complete genome	4667713	1875269	1882518	4667713		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|1875269_1875689_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1875691_1876960_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1877414_1877627_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1877637_1877826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1878085_1879279_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1879927_1880239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|1880318_1881014_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1881087_1882518_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP007211	Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 chromosome, complete genome	4667713	1985772	1993535	4667713	integrase	Enterobacteria_phage(28.57%)	12	1987982:1988004	2000105:2000127
WP_000856224.1|1985772_1986003_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1986140_1986515_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|1986515_1987391_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1987407_1987761_+	YebY family protein	NA	NA	NA	NA	NA
1987982:1988004	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|1988132_1989212_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|1989208_1990315_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|1990345_1990576_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|1990629_1991163_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|1991419_1991587_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|1991651_1991840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|1991894_1992386_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|1992938_1993535_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
2000105:2000127	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP007211	Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 chromosome, complete genome	4667713	2905604	2914686	4667713	protease,integrase	Ralstonia_phage(16.67%)	8	2903997:2904009	2923182:2923194
2903997:2904009	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|2905604_2906846_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|2907373_2907751_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|2907912_2908110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2908322_2910599_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2910629_2910950_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2911273_2911495_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|2911624_2913571_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|2913567_2914686_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
2923182:2923194	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 7
NZ_CP007211	Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 chromosome, complete genome	4667713	3272025	3311937	4667713	portal,coat,tail,integrase,terminase,protease,lysis,holin	Salmonella_phage(63.33%)	60	3271446:3271492	3311951:3311997
3271446:3271492	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_024155479.1|3272025_3273948_+	acyltransferase	NA	C6ZR20	Salmonella_phage	99.2	0.0e+00
WP_023972031.1|3274289_3276407_-|tail	tail protein	tail	C6ZR19	Salmonella_phage	97.0	0.0e+00
WP_024155480.1|3276562_3278473_-	hypothetical protein	NA	I1TEJ6	Salmonella_phage	89.7	0.0e+00
WP_000190215.1|3278472_3279843_-	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	97.4	3.1e-244
WP_000964903.1|3279852_3280542_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	91.3	8.9e-91
WP_000627698.1|3280544_3281000_-	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	98.7	4.4e-86
WP_000774925.1|3280999_3281701_-	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	98.7	7.5e-77
WP_023972029.1|3281704_3283123_-	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	98.3	3.0e-274
WP_001166096.1|3283082_3283583_-	packaged DNA stabilization protein p27	NA	I6RSF6	Salmonella_phage	100.0	2.5e-90
WP_023972028.1|3283566_3284127_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.9	1.1e-102
WP_024155481.1|3284167_3285460_-|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	99.8	1.2e-242
WP_000433852.1|3285459_3286371_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_024155482.1|3286384_3288562_-|portal	portal protein	portal	A0A0M4RCZ3	Salmonella_phage	98.5	0.0e+00
WP_000736482.1|3288610_3289111_+	HNH endonuclease	NA	A0A0M4R2Z1	Salmonella_phage	100.0	2.5e-95
WP_024155483.1|3289114_3290575_-	hypothetical protein	NA	W6MW26	Pseudomonas_phage	76.0	8.2e-219
WP_038805832.1|3290574_3291033_-|terminase	terminase	terminase	A0A2P1MXF5	Escherichia_phage	65.5	4.7e-48
WP_024155485.1|3291045_3291450_-	hypothetical protein	NA	C6ZR73	Salmonella_phage	97.8	2.6e-66
WP_044783375.1|3291449_3291839_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	96.9	2.8e-73
WP_024155486.1|3291842_3292085_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	3.0e-33
WP_001028469.1|3292408_3292930_-	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_011233123.1|3293142_3293592_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001167374.1|3293609_3294047_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_000738703.1|3294030_3294357_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001235452.1|3294791_3295415_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
WP_000994515.1|3295411_3295600_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_023210747.1|3295596_3295959_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	97.5	5.0e-61
WP_000002244.1|3295955_3296246_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_001286918.1|3296238_3296451_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	4.7e-35
WP_000950962.1|3296443_3296620_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001532927.1|3296612_3296954_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_023210746.1|3296956_3297133_-	NinE family protein	NA	C6ZR57	Salmonella_phage	98.3	3.0e-27
WP_024150884.1|3297114_3297273_-	hypothetical protein	NA	Q8HAF7	Salmonella_phage	94.2	6.0e-27
WP_023210745.1|3297269_3297716_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	99.3	1.2e-80
WP_024150883.1|3297672_3297969_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	2.6e-47
WP_023210744.1|3297971_3298220_-	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	98.8	1.5e-40
WP_006819448.1|3298450_3298723_-	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	100.0	4.2e-44
WP_023210742.1|3298797_3300234_-	AAA family ATPase	NA	E7C9R5	Salmonella_phage	98.5	1.7e-272
WP_006789497.1|3300223_3301123_-	hypothetical protein	NA	A0A220NQX5	Salmonella_phage	99.3	1.5e-154
WP_001125981.1|3301115_3301262_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_023210741.1|3301296_3301575_-	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	92.4	3.8e-40
WP_000276884.1|3301681_3301867_-	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_017441421.1|3301947_3302598_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	99.5	2.1e-121
WP_023216151.1|3302936_3303239_+	hypothetical protein	NA	I6S5Z3	Salmonella_phage	95.0	1.6e-47
WP_044783368.1|3303317_3304301_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	82.6	1.7e-74
WP_001670815.1|3304495_3304669_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	100.0	8.9e-24
WP_000156731.1|3304649_3304838_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902091.1|3304827_3304971_+	hypothetical protein	NA	I6S1M5	Salmonella_phage	100.0	4.2e-19
WP_024155544.1|3304967_3305675_+	recombinase	NA	Q716E7	Shigella_phage	97.0	1.1e-133
WP_024155543.1|3305675_3306182_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	97.0	2.1e-89
WP_024155542.1|3306190_3306739_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	98.4	1.2e-103
WP_001111322.1|3306754_3307048_+	DUF2856 family protein	NA	I6R984	Salmonella_phage	96.9	2.7e-49
WP_071604629.1|3307058_3307226_+	DUF2737 family protein	NA	A0A1V0E5L8	Salmonella_phage	96.4	5.0e-24
WP_024155541.1|3307222_3307468_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	96.2	1.7e-36
WP_024155540.1|3307464_3307866_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	97.7	3.2e-72
WP_024155539.1|3307862_3308258_+	ead/Ea22-like family protein	NA	B9UDM4	Salmonella_phage	50.3	5.4e-32
WP_024155538.1|3308259_3308730_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.5e-68
WP_024155537.1|3308733_3309402_+	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	93.5	2.9e-78
WP_024155536.1|3309398_3309749_+	DUF551 domain-containing protein	NA	Q5G8V3	Enterobacteria_phage	66.9	6.6e-34
WP_024155534.1|3310064_3310331_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	96.6	2.4e-44
WP_024155532.1|3310773_3311937_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	97.7	8.8e-224
3311951:3311997	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 8
NZ_CP007211	Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 chromosome, complete genome	4667713	4299350	4344128	4667713	plate,tRNA,tail	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4299350_4300349_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|4300436_4301747_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4301993_4302509_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4302608_4302818_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4302839_4302953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4302949_4304275_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4304453_4305062_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4305170_4305539_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4305709_4308130_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4308228_4309101_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4309114_4309612_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|4309792_4310710_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4310873_4312232_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4312320_4313430_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4313791_4314982_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|4315113_4316658_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|4316672_4317563_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4317728_4318139_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4318281_4320378_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4320377_4321115_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4321111_4321780_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4321813_4322056_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4322499_4324149_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4324493_4325843_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4325973_4326321_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4326896_4327184_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4327186_4327792_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4327804_4328119_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4328278_4328734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|4328730_4328928_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|4328917_4330345_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|4330344_4330869_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4330920_4331238_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4331197_4331326_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4331422_4333777_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4333776_4334730_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4334729_4334939_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4334926_4335970_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4335979_4336702_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4337029_4337392_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_024155426.1|4337388_4338318_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	3.0e-150
WP_000632053.1|4338317_4339865_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4340028_4340388_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4340378_4341494_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4341486_4342119_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4342121_4343603_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_001177097.1|4343612_4344128_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
