The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	3526	80100	5080102	transposase,protease	Acidithiobacillus_phage(14.29%)	53	NA	NA
WP_044749546.1|3526_4903_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_044749547.1|5345_6452_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_014501260.1|6566_9011_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.7	2.7e-113
WP_024711641.1|9078_9915_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014501262.1|10101_10908_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_014501263.1|11184_12378_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_044749548.1|12531_13203_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014501265.1|13287_14049_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|14095_14518_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|14521_14935_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_044749549.1|15230_15998_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_024712593.1|16008_16278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749550.1|16352_17813_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_144406620.1|19022_20125_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_144406530.1|20991_21957_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_014501290.1|22090_23149_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
WP_014501292.1|23458_24532_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033005790.1|25285_26338_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_144406620.1|26978_28080_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_044749553.1|28099_29428_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.2e-78
WP_044749554.1|29845_30976_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_024712392.1|31502_31853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712393.1|32000_33812_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_044749555.1|33974_34631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033005598.1|34790_36026_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_024712396.1|36130_37660_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.9	2.9e-25
WP_024712397.1|37826_38819_-	D-2-hydroxyacid dehydrogenase family protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	30.1	1.5e-09
WP_008572943.1|38818_39139_-	DUF1820 family protein	NA	NA	NA	NA	NA
WP_010364746.1|39255_39948_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_014501304.1|40166_41516_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_144406531.1|41849_42644_+	2OG-Fe(II) oxygenase	NA	A0A0E3ESN0	Synechococcus_phage	42.9	6.6e-13
WP_014501306.1|42660_43788_+	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_033005952.1|46814_47630_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	3.7e-19
WP_044749558.1|47703_48660_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	2.4e-41
WP_144406532.1|48910_50230_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_144406533.1|50325_51124_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_076342587.1|51250_52342_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_024712473.1|52410_54009_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_014505344.1|54173_55418_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|55869_56499_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_024712471.1|56705_58682_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	4.1e-112
WP_044749561.1|61017_62028_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_044749562.1|62024_62756_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_044749563.1|63109_64639_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	2.3e-46
WP_044749564.1|64748_67781_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044749565.1|68079_71118_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014505331.1|71284_72337_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_044749566.1|72751_73726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712202.1|73725_76392_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_024712201.1|76587_77568_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_008573820.1|78184_78388_-	YdcH family protein	NA	NA	NA	NA	NA
WP_024712199.1|78541_79114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749568.1|79137_80100_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	240500	330841	5080102	transposase	Staphylococcus_prophage(33.33%)	60	NA	NA
WP_161795282.1|240500_241532_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.1e-72
WP_024711391.1|243169_245134_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_014505169.1|245145_246405_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	25.5	2.2e-39
WP_044749618.1|246404_248105_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_024711389.1|248107_250822_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_014505166.1|251044_252508_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	31.6	1.7e-46
WP_082351864.1|252630_253587_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	2.4e-41
WP_024712591.1|254075_255704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712590.1|256596_259005_-	serine kinase	NA	NA	NA	NA	NA
WP_024712589.1|259133_259376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014505161.1|259813_260260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749622.1|260256_262203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749624.1|262975_263446_-	4-hydroxyphenylacetate 3-monooxygenase	NA	NA	NA	NA	NA
WP_014505158.1|263500_263782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014505157.1|263862_264105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712173.1|264114_265053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749625.1|265049_265877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014505154.1|265873_266134_-	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_014505153.1|266138_266783_-	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_024712172.1|266769_267723_-	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_024712171.1|267815_268457_-	type III secretion system protein SctP	NA	NA	NA	NA	NA
WP_014505150.1|268456_270379_-	hypersensitivity response secretion protein hrcV	NA	NA	NA	NA	NA
WP_024712169.1|270387_271461_-	type III secretion system export apparatus subunit SctU	NA	NA	NA	NA	NA
WP_024712168.1|271675_272131_+	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_014505147.1|272164_272557_+	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_014505146.1|272558_273323_+	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_024712167.1|273330_273960_+	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_014505144.1|273944_274646_+	type III secretion system stator protein SctL	NA	NA	NA	NA	NA
WP_014505143.1|274635_275964_+	type III secretion system ATPase SctN	NA	NA	NA	NA	NA
WP_044749626.1|275956_276466_+	serine kinase	NA	NA	NA	NA	NA
WP_024712165.1|276462_277293_+	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_024712164.1|277375_279199_+	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_024712781.1|279937_280342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014502919.1|280537_281494_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_014505137.1|281775_282339_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	38.5	3.3e-11
WP_044749628.1|282801_284355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257097.1|286139_286481_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_044751403.1|286665_289224_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011407204.1|289242_289503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014505132.1|291196_291403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712034.1|291606_293331_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRP3	Ostreococcus_lucimarinus_virus	28.7	6.0e-35
WP_014505130.1|293571_294513_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_024712033.1|294705_296070_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_024712032.1|296066_297695_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_041183519.1|298186_299770_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_044749631.1|299766_301998_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_044749632.1|302000_303758_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_082348549.1|303814_305704_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_044749633.1|305700_308310_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|308332_308518_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_014505120.1|308632_310795_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_044751404.1|310811_311444_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_144406534.1|311607_312105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749634.1|312245_313292_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_161795283.1|313507_317770_+	glutamate synthase	NA	NA	NA	NA	NA
WP_131083297.1|323072_323480_+	DUF4279 domain-containing protein	NA	NA	NA	NA	NA
WP_161795284.1|326755_327025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749644.1|327362_328319_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	3.1e-41
WP_044749645.1|328354_329317_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044749647.1|329464_330841_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
>prophage 3
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	335864	410190	5080102	integrase,transposase,tRNA	Leptospira_phage(23.08%)	48	386885:386909	416141:416165
WP_144406537.1|335864_337009_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.8	1.2e-87
WP_044749649.1|337600_341095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406623.1|342093_343195_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.3e-38
WP_044749652.1|343287_346473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711878.1|350921_353429_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_014505093.1|353606_354065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014505092.1|354505_355318_+	preprotein translocase subunit TatD	NA	NA	NA	NA	NA
WP_044749656.1|355912_356881_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_044749647.1|358332_359709_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_024711880.1|359852_361133_+	MFS transporter	NA	NA	NA	NA	NA
WP_024711882.1|362026_362908_+	NAD-dependent protein deacetylase	NA	A0A068EPD4	Bacillus_phage	22.7	1.1e-13
WP_044749660.1|362966_364085_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_014505083.1|364122_365001_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014505082.1|365354_365747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014505081.1|365965_366817_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_044749662.1|366868_367603_-	response regulator	NA	W8CYM9	Bacillus_phage	32.3	3.3e-27
WP_087770666.1|368301_369186_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_011260641.1|369453_370119_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_014505076.1|370118_371033_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409673.1|371222_371816_+	FMN reductase	NA	NA	NA	NA	NA
WP_024711886.1|371958_372942_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_014505074.1|372969_374001_+	methionine synthase	NA	NA	NA	NA	NA
WP_108744432.1|374269_374461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014505072.1|374678_375110_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044749666.1|375246_376125_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024711535.1|378861_379332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014505063.1|379970_380963_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_024711534.1|382235_383150_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044749671.1|383277_384030_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.8	8.7e-23
WP_044749674.1|384262_386797_+	iron-uptake factor	NA	NA	NA	NA	NA
386885:386909	attL	AGCGCGGCTGACAAAACGACTGCGC	NA	NA	NA	NA
WP_024711531.1|387461_388343_-	TolB-like protein	NA	NA	NA	NA	NA
WP_024711530.1|388395_389247_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_080344439.1|389248_389635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711528.1|390096_392229_+	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_044749676.1|393686_395210_+	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
WP_044749678.1|395268_395844_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010374918.1|396565_396790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406538.1|396752_397529_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.3	6.2e-32
WP_144406539.1|397530_397830_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144406620.1|397972_399075_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_044749684.1|399762_402486_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.6	7.7e-69
WP_044749686.1|402551_404723_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.1	1.3e-26
WP_044749687.1|404719_406399_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_044749688.1|406395_406659_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_044751414.1|406745_407195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082351867.1|407402_407657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082351868.1|407999_409028_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GMX8	Marinobacter_phage	40.3	6.0e-59
WP_044749689.1|409179_410190_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
416141:416165	attR	GCGCAGTCGTTTTGTCAGCCGCGCT	NA	NA	NA	NA
>prophage 4
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	425706	561661	5080102	capsid,transposase,terminase,protease,portal,tail,head,tRNA	Burkholderia_phage(14.29%)	113	NA	NA
WP_044749696.1|425706_426996_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_044749698.1|427126_428071_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_144406541.1|428184_429216_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	1.8e-74
WP_044749700.1|429547_431275_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_024711514.1|431640_432093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749701.1|432209_433178_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
WP_014505023.1|434236_435145_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_024712094.1|435224_436340_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_044749702.1|437035_437569_-	cytochrome b	NA	NA	NA	NA	NA
WP_044749703.1|437565_438657_-	catalase family peroxidase	NA	NA	NA	NA	NA
WP_076342565.1|439561_440065_+	transmembrane regulator protein PrtR	NA	NA	NA	NA	NA
WP_014505016.1|440120_441491_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	31.2	2.4e-26
WP_014505015.1|441531_442269_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_044751417.1|442400_443507_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_014505011.1|444250_444634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014505010.1|444630_445116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014505009.1|445119_445482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749705.1|445598_447035_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.7	1.5e-10
WP_024712098.1|447278_448130_+	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
WP_024712099.1|448579_448906_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014505005.1|449211_450099_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_024712100.1|450304_450898_-	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_014505003.1|450974_451250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712101.1|451293_451575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144406620.1|452966_454069_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_044749706.1|454093_455092_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	6.5e-42
WP_014504998.1|455453_456101_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_024712428.1|456193_457270_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_014504996.1|457279_458401_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_044749707.1|458466_460017_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_044749708.1|460729_461239_-	lipocalin family protein	NA	A0A167RLA9	Powai_lake_megavirus	35.4	5.3e-16
WP_024712425.1|461713_463234_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_014504991.1|463250_463529_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_033005621.1|463718_464057_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_024712424.1|464670_466656_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011258802.1|467521_468490_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_144406624.1|470982_471345_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_044749711.1|471403_475195_+	avirulence protein	NA	NA	NA	NA	NA
WP_044749712.1|475327_478312_+	avirulence protein	NA	NA	NA	NA	NA
WP_024712585.1|481400_482012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749713.1|482450_483308_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	32.0	1.5e-15
WP_044749714.1|483546_485433_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_011407237.1|485903_486860_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_144406620.1|486902_488005_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_024711921.1|488509_489028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143706923.1|489042_490110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143706924.1|490112_491006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751422.1|491539_491758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744301.1|491859_492210_-	hypothetical protein	NA	G9FHI3	Rhodococcus_phage	50.4	1.5e-22
WP_044751424.1|492213_492666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749718.1|492731_493067_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_024711928.1|493063_493465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711929.1|493457_493790_-|head	phage head closure protein	head	C7BGH2	Burkholderia_phage	38.9	2.5e-06
WP_044749720.1|493786_494203_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	37.7	4.5e-05
WP_024711931.1|494206_494431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749721.1|494490_495735_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	46.1	1.3e-92
WP_044749722.1|495800_496529_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	54.4	8.9e-49
WP_044749723.1|496494_497811_-|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	36.8	8.3e-61
WP_044749724.1|497810_499487_-|terminase	terminase large subunit	terminase	A0A0U4B0C7	Pseudomonas_phage	71.3	4.6e-234
WP_044749725.1|499489_499870_-	hypothetical protein	NA	A0A0U4JIP6	Pseudomonas_phage	54.0	1.4e-32
WP_044751425.1|499970_500381_-	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	50.6	1.2e-10
WP_024711938.1|500403_500679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749726.1|500675_501092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749728.1|501174_501396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749729.1|501392_501737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749733.1|503100_504477_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	6.0e-62
WP_044749734.1|505983_507360_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.2e-78
WP_024711291.1|508359_508680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504870.1|508872_510747_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011257505.1|510856_511297_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_041183493.1|511397_512312_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_014504872.1|512511_513033_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014504873.1|513279_514413_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	7.9e-28
WP_044751426.1|514524_515034_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_044749735.1|515030_516536_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_014504876.1|516701_517757_-	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_024711285.1|517760_518585_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024711284.1|518782_520060_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_024711283.1|520224_521946_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_044749737.1|521996_523310_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_014504881.1|523309_524233_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_014504882.1|524626_525139_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_044749739.1|525271_526408_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_044749740.1|526479_527622_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003484452.1|527664_528138_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_024711279.1|528226_528901_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_044749742.1|528942_530202_+	RDD family protein	NA	NA	NA	NA	NA
WP_024711277.1|530384_532877_+	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.1e-114
WP_024711276.1|532887_533451_+|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_024711275.1|533674_534448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711274.1|534444_535119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711273.1|535280_536057_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024711272.1|536163_536379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749743.1|536564_538466_-	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	27.4	3.6e-09
WP_024711270.1|538550_539927_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_082351981.1|540347_541391_+	DUF3667 domain-containing protein	NA	NA	NA	NA	NA
WP_014504896.1|541547_542150_-	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_044749744.1|542133_543159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749745.1|543624_545847_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_011407487.1|546360_546693_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_012446202.1|549341_549536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711265.1|549855_550302_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_014504903.1|550400_550886_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_024711264.1|550918_551365_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_010368143.1|551354_552722_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_044749747.1|552860_553226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504906.1|553222_554152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711262.1|555208_556150_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_044749748.1|556296_556812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504910.1|556955_557333_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082351982.1|558042_558888_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_011257462.1|558994_559267_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_143703629.1|560898_561661_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	613818	761905	5080102	transposase,tRNA	Staphylococcus_prophage(17.24%)	105	NA	NA
WP_044749770.1|613818_615507_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_044751434.1|615594_616272_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_044749771.1|616368_617643_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.7	4.0e-36
WP_011407449.1|617639_618107_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	96.7	1.1e-79
WP_044749772.1|618120_620469_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	29.7	5.3e-50
WP_014504964.1|620576_621125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749773.1|621494_622451_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	6.2e-42
WP_010374733.1|622600_622942_-	membrane protein	NA	NA	NA	NA	NA
WP_024712015.1|622941_623664_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014504962.1|624030_624996_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	29.9	2.7e-29
WP_143703588.1|624992_625190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712016.1|625200_625509_-	mitomycin resistance protein	NA	NA	NA	NA	NA
WP_014504959.1|625544_626474_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	34.9	2.2e-12
WP_014504958.1|626473_627271_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	31.0	4.3e-20
WP_044751435.1|627384_628044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749775.1|628087_628747_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_033005321.1|630208_630439_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_024712020.1|630642_630831_-	carbon storage regulator	NA	NA	NA	NA	NA
WP_044751436.1|630897_631275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712022.1|631539_632232_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024712023.1|632323_632611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749778.1|633008_633290_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019300766.1|633856_634156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052806806.1|634152_635508_+	AAA family ATPase	NA	O80281	Escherichia_phage	35.8	1.5e-52
WP_044751437.1|635611_635800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749779.1|635792_636347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161795285.1|636939_637236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406627.1|637943_639045_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.8	8.5e-43
WP_044749787.1|639284_642122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749790.1|642146_642881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749791.1|642907_645250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749792.1|645270_646008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749794.1|646172_647102_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044749796.1|647098_649933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082351874.1|649954_650707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749802.1|650733_653076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749805.1|653103_653808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406620.1|653821_654924_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_076342545.1|655352_655535_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	48.4	1.9e-08
WP_044749546.1|656650_658027_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_044749809.1|659632_661870_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_024712047.1|662292_662982_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_082351875.1|663365_664352_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_014504858.1|667962_668973_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_024712050.1|669371_670565_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024712051.1|670561_671308_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_024712052.1|671339_672941_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|673001_673202_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024712053.1|673198_673786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407380.1|674271_674544_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_044749813.1|674609_675605_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_076342635.1|675688_676516_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_044749815.1|676552_677548_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	5.5e-25
WP_014504849.1|677565_678357_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024743135.1|678358_678943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033003181.1|679061_680000_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_144406543.1|682413_683733_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044751441.1|683882_684866_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	2.0e-96
WP_024712745.1|685069_685411_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024712744.1|685561_685858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712639.1|685899_686211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143706939.1|686284_686554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406628.1|687158_688260_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	6.5e-43
WP_024712719.1|688403_689681_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_014501268.1|690026_690983_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_012444053.1|691323_691608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406544.1|692041_693361_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044749823.1|695712_697473_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_144406620.1|708854_709957_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_044749656.1|710162_711131_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_161795286.1|711612_711999_+	SseB family protein	NA	NA	NA	NA	NA
WP_044749826.1|712166_713123_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_044749644.1|714100_715057_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	3.1e-41
WP_044749828.1|715838_716135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749546.1|716989_718366_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_144406546.1|718709_719810_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.4	1.0e-40
WP_082351878.1|720403_721147_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_014504809.1|721357_721948_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_044751449.1|722087_723035_+	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_044749831.1|723943_724453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749832.1|724752_726630_-	S8/S53 family peptidase	NA	NA	NA	NA	NA
WP_024712401.1|727746_728307_+	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	30.2	6.7e-12
WP_044749833.1|728402_731228_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_024712399.1|731389_731908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749826.1|732192_733149_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_044749837.1|734217_738018_-	avirulence protein	NA	NA	NA	NA	NA
WP_014504794.1|738230_738953_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	5.2e-17
WP_044749840.1|738963_740400_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_014504792.1|740399_741668_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_044749841.1|741757_743899_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_024712309.1|743983_744649_-	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_024712308.1|744645_745320_-	OmpA family protein	NA	NA	NA	NA	NA
WP_024712307.1|745316_747974_-	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_033005512.1|747984_748722_-	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
WP_014504786.1|749059_749272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712304.1|749693_749915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082348175.1|749924_750239_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_024712302.1|750879_752043_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.7	8.5e-09
WP_044749842.1|753187_754156_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_044749843.1|754998_756015_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_044749844.1|756005_757415_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_024710466.1|757716_757998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504774.1|758531_759812_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_044749845.1|759811_760093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749842.1|760936_761905_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
>prophage 6
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	899671	906043	5080102		Enterobacteria_phage(50.0%)	6	NA	NA
WP_014504632.1|899671_900727_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.7	1.2e-83
WP_024710811.1|900782_901670_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.5	2.6e-95
WP_014504630.1|901666_902224_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	6.6e-44
WP_014504629.1|902220_903129_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	1.8e-27
WP_024710812.1|903245_904649_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	1.5e-47
WP_014504627.1|904696_906043_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.0e-33
>prophage 7
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	918305	1065329	5080102	transposase,tRNA	Leptospira_phage(18.18%)	109	NA	NA
WP_024710817.1|918305_920000_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024710818.1|920111_920516_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_024710819.1|920647_921421_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_024710820.1|921431_921899_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_014504613.1|921895_922378_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_082351882.1|922521_923538_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.1e-48
WP_076342622.1|924197_925214_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	2.1e-48
WP_024711467.1|925360_926494_+	pectate lyase	NA	NA	NA	NA	NA
WP_044751461.1|926761_928735_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	37.3	5.5e-16
WP_044749896.1|929457_932472_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	32.3	9.5e-129
WP_003490202.1|932679_933105_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_024711462.1|933460_934933_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.9	3.1e-48
WP_024711461.1|935040_936123_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_024711460.1|936119_937226_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_024711459.1|937230_937530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711458.1|937640_938108_-	RDD family protein	NA	NA	NA	NA	NA
WP_024711457.1|938534_939506_+	site-specific tyrosine recombinase XerD	NA	A0A0K0N6I5	Gordonia_phage	31.6	6.6e-15
WP_014504600.1|939989_940787_+	DsbC family protein	NA	NA	NA	NA	NA
WP_044749898.1|941255_945308_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.1	1.5e-121
WP_044749899.1|946286_952640_+	membrane protein	NA	NA	NA	NA	NA
WP_044749901.1|952860_954744_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	32.6	5.7e-23
WP_161795299.1|954918_956601_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_048484666.1|956597_956777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711451.1|956776_957994_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_014504591.1|958261_958693_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_014504590.1|958702_959212_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_014504589.1|959208_959625_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_024745204.1|959621_960257_+	type II secretion system protein J	NA	NA	NA	NA	NA
WP_044749902.1|960253_961105_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_014504586.1|961101_962223_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_024711447.1|962206_962860_+	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_024711446.1|962849_963716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749903.1|963712_966022_+	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	23.5	6.8e-10
WP_044749904.1|966018_966858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749905.1|967241_968300_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	40.8	1.4e-66
WP_044749906.1|968320_969079_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_044749907.1|969184_969760_-	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_044749909.1|970134_972297_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044749911.1|972332_973490_-	phosphotransferase	NA	NA	NA	NA	NA
WP_014504575.1|974101_974941_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_041183455.1|975068_976091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014504573.1|976103_978011_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_024712377.1|978060_979359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749912.1|979523_980453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749913.1|980839_982018_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	4.5e-50
WP_144406547.1|982343_983309_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044749915.1|983551_984511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014504567.1|984812_985235_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.4e-41
WP_014504566.1|985557_986073_+	peptide deformylase	NA	NA	NA	NA	NA
WP_144406548.1|986826_988110_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_144406549.1|988154_989255_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.4	2.6e-39
WP_144406550.1|990435_991497_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.3	1.4e-71
WP_044749917.1|991474_991906_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_014504357.1|991966_992680_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_014504356.1|993422_993698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712530.1|993956_994298_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_024712531.1|994355_996218_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_024712532.1|996293_997052_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_019303101.1|997353_998148_-	thiazole synthase	NA	NA	NA	NA	NA
WP_014504350.1|998510_998711_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_044749918.1|998898_1000683_+	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_014502919.1|1002384_1003341_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_044749921.1|1003916_1004528_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_011409118.1|1005121_1005514_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_144406551.1|1005546_1006345_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044749546.1|1006565_1007942_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_144406552.1|1008320_1009286_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044749924.1|1009471_1010323_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_014504336.1|1010419_1012552_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_024712565.1|1013056_1013944_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	31.7	6.6e-30
WP_014504334.1|1014156_1014546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003490678.1|1014623_1015301_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_044749925.1|1015293_1016628_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014504332.1|1016726_1017122_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_154219727.1|1017514_1018000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161795287.1|1017999_1018131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144406628.1|1018199_1019302_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	6.5e-43
WP_044749926.1|1019435_1019831_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_131084414.1|1020446_1020905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143706916.1|1025472_1026441_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.5e-72
WP_014504326.1|1026504_1027113_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_014504325.1|1027126_1027990_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_014504324.1|1027996_1029256_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_044749928.1|1029609_1030035_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_044749929.1|1030170_1031760_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_033005055.1|1031740_1032400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749930.1|1032369_1033896_+	membrane protein	NA	NA	NA	NA	NA
WP_024711610.1|1033930_1035664_+	type IV-A pilus assembly ATPase PilB	NA	NA	NA	NA	NA
WP_082351984.1|1035673_1036135_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_082348324.1|1036244_1036451_-	DUF2559 domain-containing protein	NA	NA	NA	NA	NA
WP_041183413.1|1036523_1037915_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_014504316.1|1038245_1039859_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014504315.1|1040092_1041262_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_014504314.1|1041286_1042162_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_014504313.1|1042631_1043003_+	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_044749931.1|1043025_1044666_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.4	5.4e-94
WP_014504310.1|1044823_1045705_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_024711613.1|1045825_1046821_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_024711614.1|1046822_1047635_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_044749933.1|1050104_1052582_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_014504300.1|1053184_1054552_-	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_014504299.1|1054548_1056327_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_024711618.1|1056371_1057130_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_041183765.1|1057352_1057892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712571.1|1058435_1060871_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	21.7	7.7e-12
WP_014504295.1|1061106_1061580_+	DUF3574 domain-containing protein	NA	NA	NA	NA	NA
WP_044749934.1|1061782_1062616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749935.1|1062752_1064354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406554.1|1064554_1065329_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	1081782	1150669	5080102	transposase,tRNA	Leptospira_phage(41.67%)	45	NA	NA
WP_044749946.1|1081782_1084614_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	3.7e-42
WP_024711667.1|1084928_1085447_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_014504272.1|1085514_1086465_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_024711668.1|1086981_1087917_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_024711669.1|1087916_1089917_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_033005079.1|1089919_1090546_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_014504267.1|1090545_1090881_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_161795288.1|1091049_1092930_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_044749948.1|1093154_1095401_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	2.6e-54
WP_044749950.1|1095424_1097044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749951.1|1097187_1101927_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.2	4.6e-21
WP_033004327.1|1101928_1102318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082356539.1|1102713_1103226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749953.1|1103581_1103944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406620.1|1103988_1105090_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_161795289.1|1106311_1110640_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	50.5	1.2e-23
WP_082351886.1|1110655_1111018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749955.1|1111207_1111576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749546.1|1111783_1113160_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_144406628.1|1114460_1115563_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	6.5e-43
WP_144406620.1|1115958_1117060_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_024712707.1|1117313_1118705_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_144406555.1|1118842_1119808_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_144406631.1|1120959_1122062_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_143703539.1|1122946_1123228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183402.1|1123445_1124237_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_162484708.1|1124721_1124862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033005504.1|1124997_1126428_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044749960.1|1126660_1128535_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	3.4e-15
WP_044749962.1|1128559_1130884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712290.1|1131558_1132401_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_014504248.1|1132402_1132765_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_010365857.1|1132761_1133157_+	anti-sigma regulatory factor	NA	NA	NA	NA	NA
WP_014504246.1|1133147_1134158_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_014504245.1|1134154_1135042_+	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.0	7.1e-24
WP_033005506.1|1135025_1136987_+	response regulator	NA	NA	NA	NA	NA
WP_053502200.1|1139192_1140224_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	1.0e-74
WP_044749969.1|1141616_1142666_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_011407903.1|1142954_1143746_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_024711812.1|1144114_1145491_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_044749970.1|1147064_1148135_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_024711814.1|1148125_1148923_+	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_011258141.1|1149032_1149290_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_024711815.1|1149333_1149846_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_024711816.1|1149910_1150669_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	1208171	1272240	5080102	capsid,transposase,terminase,portal,tail,tRNA,head,integrase,holin,plate	Stenotrophomonas_phage(46.51%)	76	1229857:1229902	1268972:1269017
WP_014504188.1|1208171_1210325_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_044749997.1|1210495_1211734_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408112.1|1212174_1212468_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_044749998.1|1212965_1213742_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_014504185.1|1213899_1215666_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014504183.1|1216176_1216704_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_044749999.1|1216803_1217472_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_044750000.1|1217561_1218290_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014504180.1|1218403_1218928_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_010363969.1|1219085_1219670_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_044750003.1|1219868_1221776_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	1.5e-79
WP_024711164.1|1221904_1222942_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_024711163.1|1222994_1223453_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014504177.1|1223464_1224244_+	protein TolQ	NA	NA	NA	NA	NA
WP_024711162.1|1224400_1224850_+	protein TolR	NA	NA	NA	NA	NA
WP_014504175.1|1224839_1225880_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_014504174.1|1226157_1227477_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_014504173.1|1227534_1228053_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_024711160.1|1228059_1228878_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_044750004.1|1228920_1229604_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.2	1.1e-37
1229857:1229902	attL	TGGTGGGCCGTGATGGATTCGAACCATCGACCAAAAGATTAAAAGT	NA	NA	NA	NA
WP_144406556.1|1230272_1231022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161795290.1|1231123_1231702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750007.1|1231716_1232658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750008.1|1232889_1233369_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	44.7	1.2e-14
WP_052806809.1|1235467_1235869_+	PAAR domain-containing protein	NA	A4PE23	Ralstonia_virus	38.2	2.2e-09
WP_044750010.1|1235865_1236375_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	32.8	1.1e-05
WP_044750011.1|1236355_1236697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082351890.1|1236710_1237421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082351891.1|1237428_1238190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750012.1|1238258_1238969_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.9	1.3e-108
WP_082351892.1|1238901_1239132_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	53.4	1.7e-14
WP_044750014.1|1239152_1240172_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.2	9.0e-140
WP_044750015.1|1240171_1241956_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.8	1.4e-268
WP_044750017.1|1242077_1242920_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.9	2.0e-68
WP_044750019.1|1242966_1243983_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.1	1.9e-137
WP_044750020.1|1243986_1244706_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	62.5	8.5e-68
WP_012445486.1|1244805_1245273_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
WP_044750022.1|1245272_1245482_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	2.4e-15
WP_024745971.1|1245486_1245843_+	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
WP_024745970.1|1245835_1246111_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
WP_011408146.1|1246110_1246749_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.8e-49
WP_033004406.1|1246748_1247237_+	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	52.8	4.2e-26
WP_044750023.1|1247233_1247653_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	64.4	5.7e-40
WP_044750025.1|1247640_1248090_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	4.1e-36
WP_071162366.1|1248171_1249062_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.4	2.8e-84
WP_044750026.1|1249054_1249600_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	2.7e-50
WP_044750028.1|1249609_1251115_+|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
WP_044750030.1|1251122_1251701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750031.1|1251761_1252325_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	44.6	2.8e-26
WP_044750032.1|1252321_1252681_+|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	65.3	2.1e-35
WP_011258459.1|1252692_1253859_+|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_011258458.1|1253889_1254399_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_044750033.1|1254443_1254746_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	66.3	1.4e-24
WP_011258456.1|1254754_1254868_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_044750034.1|1254900_1257771_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	48.6	3.1e-201
WP_044750035.1|1257783_1258185_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.1	3.5e-39
WP_044750036.1|1258181_1259171_+	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	49.1	2.8e-85
WP_144406558.1|1259211_1260324_-	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	29.8	1.3e-30
WP_044750038.1|1260563_1261001_-	helix-turn-helix transcriptional regulator	NA	E5E3P4	Burkholderia_phage	34.0	4.9e-10
WP_044750040.1|1261072_1261330_+	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	44.6	6.6e-07
WP_044750042.1|1261332_1261653_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	54.9	2.2e-23
WP_044750043.1|1261663_1261942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750045.1|1261938_1262151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750047.1|1262159_1264856_+	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.9	0.0e+00
WP_044750048.1|1265167_1265386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750049.1|1265382_1265661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750050.1|1265886_1266297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161795300.1|1266488_1266734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750051.1|1266730_1266976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408131.1|1266972_1267245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750053.1|1267241_1267448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010364117.1|1267444_1267666_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	56.9	4.2e-18
WP_044750054.1|1267665_1268850_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	57.5	3.4e-122
WP_014504170.1|1269094_1269769_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	8.3e-25
1268972:1269017	attR	TGGTGGGCCGTGATGGATTCGAACCATCGACCAAAAGATTAAAAGT	NA	NA	NA	NA
WP_044750056.1|1270118_1271114_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	5.0e-42
WP_144406633.1|1271138_1272240_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	3.8e-43
>prophage 10
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	1346627	1424407	5080102	transposase,protease,bacteriocin	Hokovirus(21.43%)	55	NA	NA
WP_044750084.1|1346627_1348004_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_044750085.1|1348510_1349755_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_153296814.1|1349881_1350061_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_017122133.1|1350104_1350251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082351896.1|1350340_1351168_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_044750087.1|1351171_1353286_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	1.4e-33
WP_044750088.1|1353430_1356100_-	glycoside hydrolase family 3	NA	NA	NA	NA	NA
WP_044750089.1|1356306_1358988_-	glycoside hydrolase family 2 protein	NA	NA	NA	NA	NA
WP_044750090.1|1359009_1361460_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_044750091.1|1361857_1362925_-	glycosyl hydrolase	NA	A0A2P1CFB9	Microbacterium_phage	23.8	3.9e-08
WP_044750092.1|1362928_1364614_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
WP_044750093.1|1364821_1367548_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033004702.1|1368251_1369268_+	glucokinase	NA	NA	NA	NA	NA
WP_024710870.1|1369569_1370304_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_041183378.1|1370294_1371713_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_011408213.1|1371754_1372303_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_024710867.1|1372299_1373100_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_044750094.1|1373342_1374362_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_024710865.1|1374358_1374694_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	58.8	1.5e-27
WP_044750095.1|1374991_1375957_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	32.9	4.2e-22
WP_024710863.1|1375960_1376395_+	NfeD family protein	NA	NA	NA	NA	NA
WP_024710862.1|1376567_1377677_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_024710861.1|1377813_1378209_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_153296815.1|1378598_1378811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750096.1|1379216_1379639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004699.1|1380325_1381705_-	serine hydrolase	NA	NA	NA	NA	NA
WP_014504069.1|1383646_1384000_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_014504068.1|1384394_1386869_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_024710859.1|1386865_1387789_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014504066.1|1387925_1388534_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044750098.1|1388642_1391552_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	23.4	1.9e-25
WP_024710857.1|1391799_1392636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750100.1|1392789_1393680_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_024710854.1|1393754_1394498_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_044750101.1|1394494_1395541_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	42.9	6.3e-72
WP_014504059.1|1395500_1395929_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_144406559.1|1397636_1398668_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	6.7e-74
WP_153296816.1|1398707_1398881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504056.1|1398881_1399040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014504055.1|1399068_1399713_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_044750105.1|1399788_1401393_-	peptide chain release factor 3	NA	NA	NA	NA	NA
WP_082351985.1|1401525_1402419_-	M23 family metallopeptidase	NA	S5M424	Bacillus_phage	30.6	3.9e-06
WP_044750106.1|1402750_1403782_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_024711969.1|1403778_1404996_+	O-succinylhomoserine (thiol)-lyase	NA	NA	NA	NA	NA
WP_011258570.1|1406754_1408137_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_011408231.1|1408224_1408458_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_082351897.1|1408543_1409119_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_014504047.1|1409251_1409821_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_019302333.1|1409830_1410394_-	cytochrome b	NA	NA	NA	NA	NA
WP_044750107.1|1410390_1411053_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_024711974.1|1411149_1414725_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	7.8e-37
WP_044750108.1|1415020_1418578_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.3	2.8e-39
WP_082351898.1|1418643_1422210_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	33.3	3.5e-45
WP_044749656.1|1422322_1423291_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_044750110.1|1423450_1424407_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	5.6e-43
>prophage 11
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	1548865	1600602	5080102	coat,transposase,protease	Flavobacterium_phage(16.67%)	40	NA	NA
WP_044750133.1|1548865_1550212_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_012445186.1|1550238_1551429_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_014503921.1|1551431_1552259_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_024710300.1|1552255_1553017_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	1.0e-15
WP_011258697.1|1553034_1553592_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_014503919.1|1553772_1554495_-	UMP kinase	NA	NA	NA	NA	NA
WP_024710301.1|1554601_1556125_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.0	5.3e-19
WP_044750134.1|1556400_1557279_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|1557448_1558252_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_044750135.1|1558643_1559369_-	molecular chaperone	NA	NA	NA	NA	NA
WP_044750136.1|1559371_1559704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750137.1|1559750_1560785_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_044750138.1|1560781_1563133_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_024710305.1|1563149_1563920_-	molecular chaperone	NA	NA	NA	NA	NA
WP_033004529.1|1563928_1564453_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_014503910.1|1564771_1565548_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_041183360.1|1565544_1568154_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_014503908.1|1568170_1569367_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_024710308.1|1569363_1569834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503906.1|1569830_1570187_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_082348444.1|1570326_1570689_+	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	39.0	1.2e-14
WP_044750139.1|1570693_1571824_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_014503903.1|1572120_1573815_+	asparagine synthase B	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	39.0	1.6e-88
WP_014503902.1|1573883_1574936_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_014503900.1|1575366_1577493_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_024710310.1|1578041_1580462_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_024710311.1|1580557_1581094_+	bacterioferritin	NA	NA	NA	NA	NA
WP_014503897.1|1581577_1583821_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.6	5.5e-81
WP_044750140.1|1583881_1584733_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044750142.1|1584855_1585296_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033004534.1|1585292_1586810_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_044750143.1|1586820_1588014_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_014503892.1|1588020_1589598_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_044750144.1|1590108_1591065_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.3	3.3e-43
WP_144406560.1|1591132_1592077_+	serine hydrolase	NA	NA	NA	NA	NA
WP_144406561.1|1592058_1593090_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080344398.1|1593456_1594119_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_044751500.1|1594696_1596886_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_024710320.1|1597014_1598793_-	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_014503886.1|1599993_1600602_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 12
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	1604438	1708402	5080102	capsid,transposase,terminase,portal,tail,tRNA,head,holin,plate	Stenotrophomonas_phage(31.03%)	102	NA	NA
WP_144406551.1|1604438_1605237_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044751502.1|1605654_1606755_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_024711414.1|1606857_1607571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711415.1|1607821_1608061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711416.1|1610519_1611005_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	3.6e-14
WP_024711417.1|1611155_1611935_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_024711418.1|1612137_1614018_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.5	8.0e-25
WP_024711419.1|1614355_1615873_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_044751503.1|1616191_1616644_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_024711420.1|1617076_1618210_-	phospholipase A	NA	NA	NA	NA	NA
WP_044750149.1|1619867_1620353_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_014503862.1|1620580_1620796_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_014503861.1|1621045_1621525_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_014503860.1|1621656_1622085_-	cytochrome c	NA	NA	NA	NA	NA
WP_044750150.1|1622157_1622988_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_014503858.1|1623049_1623817_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_012444391.1|1623816_1624032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750151.1|1624177_1624969_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024711424.1|1625114_1626290_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_044750152.1|1629035_1629674_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_044750154.1|1629849_1631790_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	2.0e-26
WP_024711428.1|1632006_1632561_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.6e-18
WP_014503850.1|1632781_1634212_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_044750155.1|1634314_1635733_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	3.0e-48
WP_014503846.1|1636149_1636875_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_082348227.1|1636972_1637359_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024711432.1|1638759_1639734_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.4	2.9e-18
WP_024711433.1|1639900_1640134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711434.1|1640330_1641986_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.1	4.6e-16
WP_024711435.1|1642184_1642433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750158.1|1643025_1643877_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259784.1|1643972_1644542_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_024711437.1|1644576_1644762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750160.1|1645528_1645963_-	HIT family protein	NA	NA	NA	NA	NA
WP_014503834.1|1645959_1646622_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_144406562.1|1646939_1647744_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.0	3.4e-09
WP_044750164.1|1647931_1649710_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_044749546.1|1650904_1652281_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_044750166.1|1652373_1652649_-	hypothetical protein	NA	A8YQQ5	Burkholderia_virus	53.4	3.2e-15
WP_044750167.1|1652914_1653139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750168.1|1653135_1653408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750169.1|1653569_1653977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750170.1|1654055_1654322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750171.1|1654318_1654597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750172.1|1654593_1654812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750173.1|1655135_1657832_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	70.0	0.0e+00
WP_011258450.1|1657841_1658054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|1658050_1658329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408136.1|1658339_1658660_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.6	7.4e-24
WP_053503015.1|1658662_1658920_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|1658991_1659429_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_044750175.1|1660088_1661075_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.5	9.5e-94
WP_011258454.1|1661071_1661473_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_044750176.1|1661485_1664356_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.5	1.1e-193
WP_011258456.1|1664388_1664502_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|1664510_1664813_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|1664858_1665368_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_044750177.1|1665398_1666565_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	1.6e-132
WP_044750178.1|1666576_1666936_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	65.3	7.3e-36
WP_024745962.1|1666932_1667496_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	43.7	3.1e-25
WP_044750179.1|1667556_1668135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750028.1|1668142_1669648_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
WP_044750180.1|1669657_1670203_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.1	1.8e-49
WP_044750181.1|1670195_1671086_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	52.7	2.8e-81
WP_144406563.1|1671166_1672291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750182.1|1672379_1672832_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	61.6	1.8e-39
WP_024745968.1|1672819_1673239_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
WP_011258469.1|1673235_1673724_-	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	52.8	3.2e-26
WP_011408146.1|1673723_1674362_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.8e-49
WP_024745970.1|1674361_1674637_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
WP_024745971.1|1674629_1674986_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
WP_024745972.1|1674990_1675200_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	5.4e-15
WP_012445486.1|1675199_1675667_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
WP_011258475.1|1675766_1676486_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_024745974.1|1676489_1677509_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.9	2.1e-136
WP_024745975.1|1677555_1678398_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
WP_033004409.1|1678519_1680304_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.1	1.2e-267
WP_024745977.1|1680303_1681323_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	4.1e-140
WP_082351902.1|1681343_1681574_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	53.4	7.7e-15
WP_044750184.1|1681506_1682217_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.0	4.1e-107
WP_082351903.1|1682283_1683030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082351904.1|1683026_1683734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750186.1|1683747_1684089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750187.1|1684069_1684579_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	31.9	1.5e-05
WP_052806813.1|1684575_1684977_-	PAAR domain-containing protein	NA	A4PE23	Ralstonia_virus	38.2	1.3e-09
WP_044750190.1|1686563_1687085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751504.1|1687430_1689221_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	63.0	6.8e-191
WP_044750191.1|1689150_1690512_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_014501268.1|1690608_1691565_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_153296773.1|1691617_1691791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712731.1|1691787_1692300_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_144406564.1|1693022_1694342_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_144406620.1|1694501_1695603_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_044750192.1|1695748_1696717_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	3.3e-99
WP_014503523.1|1697219_1697726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406635.1|1697936_1699039_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.0	9.7e-39
WP_044749546.1|1699171_1700548_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_024711758.1|1702399_1703299_-	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	26.3	2.1e-07
WP_024711757.1|1703540_1705310_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	4.0e-58
WP_044751508.1|1705306_1705909_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	1.4e-15
WP_011258751.1|1706166_1706760_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	3.5e-11
WP_014502759.1|1706965_1708402_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
>prophage 13
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	1891384	1975149	5080102	transposase,tRNA	uncultured_Mediterranean_phage(37.5%)	53	NA	NA
WP_144406620.1|1891384_1892486_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_024711993.1|1893043_1894948_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.7	2.3e-112
WP_044750237.1|1895187_1895808_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_024711991.1|1895804_1896311_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_044750238.1|1896357_1896855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014502923.1|1897086_1897371_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_044750239.1|1897367_1899161_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_024711987.1|1899514_1900147_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_044750240.1|1900298_1902857_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024711985.1|1902853_1903975_+	phytase	NA	NA	NA	NA	NA
WP_024711984.1|1904098_1904494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161795302.1|1904578_1904824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711983.1|1905205_1905913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750241.1|1906257_1907754_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_014502935.1|1907876_1908308_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_044751518.1|1908473_1909544_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_044750242.1|1909613_1910759_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.9	4.9e-86
WP_044750243.1|1910890_1911244_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_044750244.1|1911440_1913285_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_014502940.1|1913398_1914367_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
WP_044750245.1|1914514_1914721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143703609.1|1914838_1915057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144406567.1|1915236_1916334_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.4	3.0e-40
WP_024712636.1|1917339_1918293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712635.1|1918330_1920202_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_044750250.1|1920433_1921402_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_082351906.1|1921552_1921753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296818.1|1922919_1923075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749551.1|1923068_1923914_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.7e-43
WP_082348314.1|1924602_1924902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750253.1|1925362_1928197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750255.1|1928193_1929123_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044750256.1|1929131_1931894_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	8.1e-42
WP_044750257.1|1932285_1933563_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_044750259.1|1933740_1935483_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_044750261.1|1935641_1936598_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_044750262.1|1936594_1939111_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	1.8e-08
WP_044750263.1|1939271_1940267_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_044750264.1|1941849_1945020_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_014502956.1|1945032_1946340_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044750265.1|1946339_1947014_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044750266.1|1947291_1952316_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_044750267.1|1952539_1953088_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_144406638.1|1954004_1955106_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_014502961.1|1956702_1957689_-	response regulator	NA	W8CYM9	Bacillus_phage	26.8	4.8e-05
WP_044750269.1|1957722_1961817_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_044750270.1|1961958_1963263_-	DUF445 family protein	NA	NA	NA	NA	NA
WP_044750271.1|1963433_1964288_-	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_044751524.1|1964454_1967586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712293.1|1967646_1968999_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_162484709.1|1969227_1969383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712294.1|1971217_1972063_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_053502200.1|1974117_1975149_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	1.0e-74
>prophage 14
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	2186971	2230754	5080102	transposase,tRNA	Leptospira_phage(75.0%)	32	NA	NA
WP_144406570.1|2186971_2188073_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.6	1.3e-38
WP_024710669.1|2189608_2189923_-	EthD family reductase	NA	NA	NA	NA	NA
WP_044750321.1|2190084_2191389_+	threonine synthase	NA	NA	NA	NA	NA
WP_024710667.1|2193228_2194641_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.4	1.3e-40
WP_011258940.1|2195399_2195726_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014503171.1|2195735_2196650_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_024710666.1|2196646_2197942_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_014503173.1|2197938_2199030_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_024710664.1|2199026_2200154_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_014503175.1|2200150_2200753_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_024710662.1|2200749_2201484_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_024710661.1|2201477_2202254_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_044750323.1|2202243_2202864_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_144406620.1|2203024_2204126_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_024710659.1|2204240_2205827_+	calcineurin phosphoesterase	NA	NA	NA	NA	NA
WP_044750325.1|2206273_2207359_-	peptidase C13	NA	NA	NA	NA	NA
WP_024710657.1|2207693_2208392_-	acireductone synthase	NA	NA	NA	NA	NA
WP_014503183.1|2208394_2208961_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_019305395.1|2208972_2209650_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_044750327.1|2209738_2211169_-	amino acid permease	NA	NA	NA	NA	NA
WP_024710655.1|2211245_2212718_-	amino acid permease	NA	NA	NA	NA	NA
WP_082351912.1|2212860_2213448_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011258842.1|2213596_2214838_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_044750329.1|2215046_2216465_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_014503189.1|2216499_2216799_+	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_144406638.1|2218701_2219803_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_144406571.1|2220140_2221850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750330.1|2221904_2222936_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	1.6e-72
WP_082351913.1|2223125_2227130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143706713.1|2227126_2227612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406620.1|2228001_2229104_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_144406572.1|2229667_2230754_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	2.4e-42
>prophage 15
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	2327442	2383427	5080102	transposase	Leptospira_phage(33.33%)	39	NA	NA
WP_144406620.1|2327442_2328544_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_044750366.1|2329062_2331792_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.9	5.9e-69
WP_044750367.1|2331845_2333033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082348267.1|2333085_2334963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750369.1|2334976_2336563_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_144406574.1|2337574_2338677_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	4.2e-42
WP_044750374.1|2339922_2341605_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_014503273.1|2343176_2344835_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_014503274.1|2344837_2345464_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_002813536.1|2345463_2345856_-	chemotaxis protein CheY	NA	NA	NA	NA	NA
WP_010374297.1|2345890_2346658_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_005918202.1|2346654_2347539_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_044750377.1|2347525_2349199_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_033005200.1|2349783_2351877_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_044750378.1|2351873_2353004_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_014503280.1|2353266_2355351_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.8	1.1e-19
WP_044750380.1|2355601_2358523_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	3.5e-11
WP_044750381.1|2358875_2361857_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.7	6.5e-13
WP_024711854.1|2361951_2362743_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_005917968.1|2362755_2363025_-	flagellar biosynthesis	NA	NA	NA	NA	NA
WP_162484710.1|2363096_2363234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711852.1|2363353_2364184_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_044750382.1|2364185_2364593_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_014503288.1|2364589_2364928_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_014503289.1|2364924_2365938_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_014503290.1|2365948_2366473_-	flagellar basal body protein FliL	NA	NA	NA	NA	NA
WP_044750383.1|2366664_2367981_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_044750384.1|2367977_2368433_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_014503293.1|2368436_2369813_-	FliI/YscN family ATPase	NA	NA	NA	NA	NA
WP_014503294.1|2369809_2370430_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_024712485.1|2370426_2371416_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_014503296.1|2371426_2373151_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_024712486.1|2373164_2373536_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_044750385.1|2374353_2377851_-	glycosyltransferase	NA	K7QL84	Escherichia_phage	25.0	5.0e-12
WP_144406575.1|2378079_2379111_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_144406628.1|2379245_2380347_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	6.5e-43
WP_153296820.1|2380642_2380888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2380939_2381908_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_144406577.1|2382107_2383427_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	2426333	2482267	5080102	transposase,tRNA,protease	uncultured_Mediterranean_phage(10.0%)	46	NA	NA
WP_044750400.1|2426333_2427470_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_024710747.1|2427466_2427925_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_044750401.1|2428175_2428502_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	6.0e-13
WP_024710745.1|2428645_2430928_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.7	2.3e-175
WP_002813418.1|2431205_2431424_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_044751571.1|2431505_2432258_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_082351990.1|2432391_2432805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750402.1|2432797_2434174_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	60.7	2.5e-76
WP_024710743.1|2435215_2436337_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024710742.1|2436394_2437363_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.2	2.2e-63
WP_044750403.1|2437646_2440004_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	3.3e-84
WP_024710740.1|2440166_2442095_+	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_024710739.1|2442159_2442831_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_044750404.1|2442943_2447110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024710737.1|2447346_2448723_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.1	1.2e-73
WP_024710736.1|2448754_2449081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033004667.1|2449077_2449485_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_024710734.1|2449516_2449867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750405.1|2449863_2451195_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	34.9	3.7e-40
WP_014503360.1|2451515_2452721_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_044750406.1|2452878_2455251_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_024710731.1|2455275_2455908_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014503363.1|2456126_2456552_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.4	6.6e-20
WP_044750407.1|2456570_2457776_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_024710729.1|2457786_2458575_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_024710728.1|2458571_2459432_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014503367.1|2459502_2460141_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_044750408.1|2460140_2461358_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_044750409.1|2461368_2462766_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_024710724.1|2463080_2464301_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_044750411.1|2464497_2465556_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_076342601.1|2465881_2467042_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_014503373.1|2467468_2467660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406580.1|2468125_2468923_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044750416.1|2469013_2469769_-	DUF1264 domain-containing protein	NA	NA	NA	NA	NA
WP_082351917.1|2469895_2470285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503376.1|2470223_2470601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750418.1|2470806_2472060_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_024711962.1|2472097_2472667_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_044750420.1|2472650_2473013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711959.1|2474394_2474589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750421.1|2475042_2476020_-	siroheme synthase	NA	NA	NA	NA	NA
WP_014503390.1|2478530_2478788_+	stress-induced protein	NA	NA	NA	NA	NA
WP_024711954.1|2479463_2479949_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_024711953.1|2480055_2480976_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_014501268.1|2481310_2482267_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
>prophage 17
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	2486477	2559423	5080102	transposase	Stenotrophomonas_phage(45.0%)	48	NA	NA
WP_144406642.1|2486477_2487580_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	5.5e-42
WP_044749546.1|2496549_2497926_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_153296821.1|2497995_2498154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750426.1|2498431_2499043_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024712317.1|2499039_2500062_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_024712316.1|2500180_2501665_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_044750427.1|2501661_2504754_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_033005522.1|2504746_2505862_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044750428.1|2506351_2509087_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_076342622.1|2509861_2510878_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	2.1e-48
WP_144406620.1|2511421_2512523_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_162484711.1|2512920_2513166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750429.1|2513527_2517832_+	avirulence protein	NA	NA	NA	NA	NA
WP_044750430.1|2518179_2518380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131085336.1|2518984_2520016_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.5e-73
WP_144406582.1|2520371_2521605_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	70.6	1.0e-105
WP_044750433.1|2522349_2525838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712350.1|2527369_2527642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750434.1|2527702_2528773_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.1	1.0e-61
WP_024712352.1|2528881_2529172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750435.1|2529410_2529635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406584.1|2529775_2531152_+	hypothetical protein	NA	B1NI80	Stenotrophomonas_phage	48.0	8.9e-82
WP_024712356.1|2531159_2531444_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_024712357.1|2531443_2532586_+	zonular occludens toxin	NA	B1NI81	Stenotrophomonas_phage	59.1	6.4e-126
WP_162484712.1|2532665_2532968_+	hypothetical protein	NA	A0A1W6DXU7	Xanthomonas_phage	94.8	7.2e-45
WP_082351919.1|2533136_2533520_-	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	95.3	1.0e-64
WP_024712350.1|2534135_2534408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712351.1|2534468_2535539_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.3	1.2e-62
WP_024712352.1|2535647_2535938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750435.1|2536176_2536401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033005552.1|2536541_2537918_+	hypothetical protein	NA	B1NI80	Stenotrophomonas_phage	48.0	8.9e-82
WP_044751590.1|2537925_2538210_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_024712357.1|2538209_2539352_+	zonular occludens toxin	NA	B1NI81	Stenotrophomonas_phage	59.1	6.4e-126
WP_162484712.1|2539431_2539734_+	hypothetical protein	NA	A0A1W6DXU7	Xanthomonas_phage	94.8	7.2e-45
WP_162484713.1|2540903_2541059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750434.1|2541197_2542268_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.1	1.0e-61
WP_024712352.1|2542376_2542667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712354.1|2542905_2543130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143706732.1|2543636_2544647_+	hypothetical protein	NA	B1NI80	Stenotrophomonas_phage	54.9	8.3e-69
WP_024712356.1|2544654_2544939_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_044750441.1|2544938_2546081_+	zonular occludens toxin	NA	B1NI81	Stenotrophomonas_phage	56.8	7.0e-125
WP_044750442.1|2546169_2546445_+	hypothetical protein	NA	A0A1W6DXU7	Xanthomonas_phage	51.0	2.9e-16
WP_158525259.1|2546711_2546873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712360.1|2549398_2552524_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.2	3.0e-45
WP_024712361.1|2552575_2553688_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024712362.1|2553812_2554391_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044750443.1|2555868_2557956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711356.1|2558331_2559423_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	2581673	2677305	5080102	transposase,plate	Tupanvirus(22.22%)	55	NA	NA
WP_044750453.1|2581673_2583011_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_044750454.1|2583007_2584531_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_044750455.1|2584527_2585067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041183296.1|2585075_2587013_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	2.6e-39
WP_044751595.1|2587276_2587738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750456.1|2587839_2588046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750457.1|2588394_2589225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750459.1|2592044_2593055_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_024743896.1|2593018_2594896_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_044750460.1|2594899_2595403_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_044750461.1|2595390_2596224_-	ImpE protein	NA	NA	NA	NA	NA
WP_024743899.1|2596259_2596763_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_044750462.1|2596862_2598377_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|2598369_2598876_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_044750463.1|2599476_2602239_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	2.8e-42
WP_052806821.1|2602213_2603086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750465.1|2603105_2605973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750466.1|2605984_2607010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750467.1|2608317_2609340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082351920.1|2609251_2611195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750469.1|2611199_2612219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406620.1|2612581_2613684_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_144406561.1|2613870_2614902_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044750471.1|2614972_2616796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750472.1|2616809_2617409_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_019301510.1|2617499_2617856_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_044750473.1|2617852_2618275_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014503470.1|2619159_2620950_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_014503471.1|2620982_2621969_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_024712077.1|2622379_2626108_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_014503473.1|2626702_2627350_-	response regulator	NA	NA	NA	NA	NA
WP_014503474.1|2627562_2628324_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_014503475.1|2628423_2628789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503476.1|2628847_2629279_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_014503477.1|2629290_2630553_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_014503478.1|2630536_2631829_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_033005365.1|2632198_2632969_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_161795291.1|2633178_2644827_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	30.9	4.0e-66
WP_044750474.1|2644823_2654408_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.9	9.0e-56
WP_044750475.1|2654709_2655672_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_153296772.1|2655685_2655829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144406585.1|2656490_2657810_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_014501268.1|2658126_2659083_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
WP_076342622.1|2659699_2660716_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	2.1e-48
WP_014503486.1|2664235_2664868_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_044750477.1|2664867_2666724_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_014503488.1|2666720_2668139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503489.1|2668162_2668627_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_014503490.1|2668623_2669403_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_044750478.1|2669694_2670735_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_014503492.1|2670731_2672501_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	7.2e-52
WP_014503493.1|2672497_2672962_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_014503494.1|2672965_2673628_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_044750479.1|2673656_2676065_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_014502919.1|2676348_2677305_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.6e-42
>prophage 19
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	2827001	2837045	5080102	tRNA	Escherichia_phage(16.67%)	8	NA	NA
WP_014503645.1|2827001_2827481_-	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	67.1	3.0e-53
WP_024712678.1|2827724_2828474_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_003481884.1|2829539_2829752_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_024710527.1|2829891_2832540_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	9.7e-85
WP_014503650.1|2832641_2833130_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_014503651.1|2833431_2834466_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	3.6e-112
WP_024710528.1|2834638_2835280_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	1.8e-13
WP_024710529.1|2835368_2837045_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.5	1.9e-38
>prophage 20
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	2959961	2969366	5080102		Xylella_phage(66.67%)	10	NA	NA
WP_044750535.1|2959961_2962052_-	hypothetical protein	NA	C8CLJ3	Xylella_phage	32.2	6.4e-07
WP_052806825.1|2962054_2963506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750536.1|2963505_2964153_-	hypothetical protein	NA	C8CLJ1	Xylella_phage	48.0	3.2e-26
WP_052806826.1|2964149_2964533_-	hypothetical protein	NA	I3PUW8	Vibrio_phage	40.4	2.7e-20
WP_044750537.1|2964613_2964835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052806828.1|2964831_2967147_-	hypothetical protein	NA	C8CLI9	Xylella_phage	47.1	2.8e-120
WP_044750538.1|2967146_2967551_-	hypothetical protein	NA	C8CLI8	Xylella_phage	50.4	2.6e-26
WP_044750539.1|2967612_2967924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750540.1|2967933_2968146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750541.1|2968157_2969366_-	hypothetical protein	NA	A0A1B1IR95	uncultured_Mediterranean_phage	33.0	1.6e-47
>prophage 21
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	2975509	2982390	5080102		Mannheimia_phage(16.67%)	14	NA	NA
WP_044750549.1|2975509_2975992_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	54.6	1.1e-42
WP_044750550.1|2976183_2976633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052806834.1|2976629_2976863_-	DUF3310 domain-containing protein	NA	NA	NA	NA	NA
WP_044750551.1|2976859_2977333_-	hypothetical protein	NA	R9ZZU8	Cellulophaga_phage	47.5	8.1e-27
WP_044750552.1|2977329_2977569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750553.1|2977565_2977952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750554.1|2977944_2978145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144406588.1|2978141_2978438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750555.1|2978434_2978755_-	DUF1364 family protein	NA	Q8W6N7	Burkholderia_virus	47.9	7.2e-11
WP_044750556.1|2978751_2979195_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_044750557.1|2979194_2979380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750558.1|2979379_2980444_-	site-specific DNA-methyltransferase	NA	A0A060D598	Salmonella_phage	46.7	1.7e-77
WP_082351930.1|2980440_2980881_-	hypothetical protein	NA	A0A0H5AUD0	Pseudomonas_phage	45.6	1.3e-26
WP_044750561.1|2981442_2982390_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	70.5	4.5e-133
>prophage 22
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	3057653	3130910	5080102	transposase,tRNA,protease	Acidithiobacillus_phage(13.33%)	49	NA	NA
WP_014503812.1|3057653_3058427_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_014503813.1|3058596_3059004_-	VOC family protein	NA	NA	NA	NA	NA
WP_044750595.1|3059000_3060905_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3061611_3062637_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024710824.1|3062721_3063795_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	24.1	9.5e-15
WP_044750596.1|3063787_3064891_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	41.0	5.5e-74
WP_014503818.1|3064901_3065828_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_014503819.1|3065908_3066559_+	SCO family protein	NA	NA	NA	NA	NA
WP_044750597.1|3066555_3067404_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_144406591.1|3067517_3068549_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.5e-73
WP_024712619.1|3069035_3070619_-	transglycosylase SLT domain-containing protein	NA	I1VXB7	Halocynthia_phage	31.2	4.7e-10
WP_024712618.1|3070913_3072419_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.7	2.5e-85
WP_044750599.1|3073044_3074013_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_024712210.1|3077664_3078786_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_041183173.1|3078782_3079691_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_014502751.1|3080219_3081341_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	4.8e-25
WP_044750602.1|3081500_3083426_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.8	1.3e-147
WP_011258741.1|3083567_3084086_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_044750603.1|3084186_3085218_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_014502748.1|3085355_3087020_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002804358.1|3087461_3087872_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_011258737.1|3087976_3088372_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_014502746.1|3088720_3088996_-	RnfH family protein	NA	NA	NA	NA	NA
WP_014502745.1|3089009_3089441_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_010366344.1|3089501_3090005_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
WP_044750604.1|3090148_3092596_-	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	26.4	9.8e-15
WP_044750605.1|3095130_3097146_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_014502737.1|3098097_3098412_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_044750606.1|3099089_3100466_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_024712694.1|3100957_3101656_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_044750607.1|3102883_3106375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750608.1|3106507_3109993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750609.1|3110125_3113620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024710670.1|3113961_3115332_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	3.5e-38
WP_014502722.1|3115328_3116579_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024710672.1|3116586_3117831_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_044750610.1|3118058_3118538_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_044751653.1|3118648_3119230_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.2	1.3e-18
WP_024710675.1|3119300_3120050_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_041183169.1|3120224_3120716_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_131074902.1|3120728_3120956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024710677.1|3120962_3121799_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_024710678.1|3121808_3123149_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_024710679.1|3123291_3124998_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_014502712.1|3125031_3126336_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_014502711.1|3126367_3126628_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_014502710.1|3126629_3127505_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_044750611.1|3127970_3129047_+|protease	protease	protease	NA	NA	NA	NA
WP_044749546.1|3129533_3130910_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 23
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	3208257	3317097	5080102	transposase,tRNA	Leptospira_phage(33.33%)	72	NA	NA
WP_044750630.1|3208257_3209214_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	2.8e-42
WP_044751664.1|3209203_3210148_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.8	2.3e-44
WP_144406593.1|3210658_3211690_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_024711877.1|3211776_3211980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144406593.1|3212706_3213738_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044750632.1|3213847_3214306_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014502634.1|3214707_3215214_-	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_044750633.1|3215227_3216631_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_044750634.1|3216699_3217791_-	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_024711873.1|3217812_3218697_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_033005206.1|3218815_3219427_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014502629.1|3219462_3219846_-	membrane protein	NA	NA	NA	NA	NA
WP_044750635.1|3220358_3221171_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_162484714.1|3221302_3221494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033005209.1|3222739_3223648_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_014502625.1|3224072_3224615_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024711869.1|3225014_3228479_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_143706909.1|3228710_3228929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258268.1|3228968_3229298_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024711868.1|3229316_3231314_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_044750636.1|3231382_3233539_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	1.1e-06
WP_024711866.1|3233549_3234065_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024711865.1|3234091_3235375_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024711864.1|3235379_3236186_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_014502616.1|3236182_3237322_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_144406594.1|3238602_3238998_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_044750638.1|3239031_3243744_+	avirulence protein	NA	NA	NA	NA	NA
WP_044750639.1|3243876_3248079_+	avirulence protein	NA	NA	NA	NA	NA
WP_044750640.1|3248211_3251496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750641.1|3251627_3254612_+	avirulence protein	NA	NA	NA	NA	NA
WP_044750642.1|3254742_3257928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750643.1|3258060_3261450_+	avirulence protein avrBs3	NA	NA	NA	NA	NA
WP_082351934.1|3261627_3262773_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.4	5.8e-87
WP_044750644.1|3262936_3263326_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_144406620.1|3263674_3264776_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_144406646.1|3266749_3267851_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.1e-42
WP_011258259.1|3267992_3268742_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_024712499.1|3268845_3269559_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_041183149.1|3269882_3270143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750646.1|3270320_3271211_+	pirin family protein	NA	NA	NA	NA	NA
WP_044750647.1|3271457_3271937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750648.1|3272282_3274691_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_044750649.1|3274687_3275272_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_153296825.1|3275304_3275478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751669.1|3275474_3276041_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082351994.1|3276261_3276654_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_144406630.1|3277450_3278553_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.0	6.7e-40
WP_161795295.1|3278601_3279069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750650.1|3279137_3279998_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044750651.1|3280052_3280445_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_044750653.1|3280425_3282657_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_044751674.1|3282656_3283223_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044751676.1|3283264_3284164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750654.1|3284232_3284829_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_044750655.1|3284821_3285646_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044750657.1|3285642_3288465_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	2.7e-53
WP_044750659.1|3288585_3288906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750661.1|3289085_3290048_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	32.0	7.7e-16
WP_144406647.1|3291429_3292531_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	6.5e-43
WP_044750667.1|3293651_3294611_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_044749647.1|3295459_3296836_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_044750670.1|3298526_3299492_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_044750672.1|3299544_3302610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751682.1|3302596_3305536_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	3.2e-52
WP_044750674.1|3305692_3306013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750675.1|3306192_3307149_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	33.7	9.1e-17
WP_144406648.1|3307205_3309473_-	DNA repair protein	NA	NA	NA	NA	NA
WP_044750676.1|3309540_3310500_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144406649.1|3310647_3312924_-	DNA repair protein	NA	NA	NA	NA	NA
WP_044750677.1|3312991_3313951_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144406596.1|3314274_3315306_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.5e-73
WP_011258802.1|3316128_3317097_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 24
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	3452402	3473538	5080102	transposase,plate	Staphylococcus_prophage(20.0%)	14	NA	NA
WP_011407237.1|3452402_3453359_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_044749546.1|3453933_3455310_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_144406630.1|3455941_3457043_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.0	6.7e-40
WP_044750735.1|3457363_3458263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750736.1|3458270_3458879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750737.1|3458956_3459856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751696.1|3459862_3460474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159089421.1|3463151_3464027_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044750738.1|3464111_3466862_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	1.8e-41
WP_014502423.1|3466954_3467308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750739.1|3467338_3470071_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	4.2e-91
WP_014502421.1|3470156_3471248_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_044750741.1|3471211_3473047_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259942.1|3473049_3473538_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 25
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	3609860	3681832	5080102	integrase,transposase,protease	Staphylococcus_phage(10.0%)	52	3607134:3607155	3652569:3652590
3607134:3607155	attL	GCCGCCCAGCAGGCGCAGCACG	NA	NA	NA	NA
WP_044750797.1|3609860_3610817_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	4.3e-43
WP_044750798.1|3610893_3614145_-	DNA polymerase III subunit alpha	NA	A0A1B1PA77	Streptomyces_phage	24.9	6.1e-81
WP_044750799.1|3614326_3615745_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011259909.1|3615754_3616405_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_044750800.1|3616406_3617012_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_014502325.1|3617161_3617383_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024711505.1|3617392_3617818_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	42.9	2.2e-07
WP_048488523.1|3618213_3618411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751733.1|3619333_3620113_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_044750802.1|3620328_3620958_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024711501.1|3621018_3621774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750804.1|3622100_3622877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750805.1|3623285_3624860_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_044750806.1|3625108_3625375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750807.1|3625762_3628033_-	type I restriction-modification system subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	43.2	2.2e-21
WP_044750811.1|3628029_3629499_-	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	33.2	1.2e-28
WP_024711494.1|3629503_3630226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750813.1|3630225_3630861_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024711493.1|3630924_3633306_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_012445655.1|3633384_3633693_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011259930.1|3633699_3633963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750814.1|3634272_3637746_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	9.6e-08
WP_044750815.1|3637834_3639037_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	26.7	1.5e-05
WP_044750816.1|3639033_3640578_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	24.2	6.8e-14
WP_052806854.1|3640717_3641956_+	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_044751736.1|3643821_3644508_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	52.2	4.6e-55
WP_044750824.1|3644631_3645363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044750826.1|3645365_3645950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296826.1|3645958_3646312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750828.1|3646450_3646780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082351950.1|3646821_3647085_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	42.2	3.7e-05
WP_044750832.1|3647081_3648662_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_082351951.1|3648675_3650553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750835.1|3650605_3651793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750837.1|3651846_3654576_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.3	6.5e-68
3652569:3652590	attR	CGTGCTGCGCCTGCTGGGCGGC	NA	NA	NA	NA
WP_044750839.1|3656254_3658927_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.2	1.0e-78
WP_014502292.1|3659241_3660534_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.3	1.4e-73
WP_024711891.1|3660874_3661060_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_014502291.1|3661354_3662218_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_014502290.1|3662217_3663345_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_014502288.1|3663975_3664362_-	response regulator	NA	W8CYM9	Bacillus_phage	30.9	3.7e-09
WP_014502287.1|3664921_3665821_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	4.5e-18
WP_044750842.1|3666236_3666713_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_044750845.1|3666875_3667358_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	35.2	4.0e-21
WP_024711893.1|3667400_3667961_+	bacterioferritin	NA	NA	NA	NA	NA
WP_144406620.1|3668067_3669169_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_024711895.1|3670157_3671105_-	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.1	6.5e-07
WP_044750847.1|3671279_3674267_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024711898.1|3675537_3676536_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_024711899.1|3676613_3678830_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024711900.1|3679333_3680533_-	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_082351952.1|3680815_3681832_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	3.6e-48
>prophage 26
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	3912151	3972513	5080102	transposase,protease	Ralstonia_phage(18.75%)	56	NA	NA
WP_014501361.1|3912151_3913168_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.2	1.6e-48
WP_014502270.1|3913219_3913357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750909.1|3913679_3916271_-	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_024712613.1|3916456_3917611_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_024712614.1|3917686_3918583_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_014502265.1|3918728_3920327_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_024712615.1|3920563_3920890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144406633.1|3921157_3922259_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	3.8e-43
WP_011258802.1|3922405_3923374_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044750910.1|3923488_3923956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044750911.1|3924454_3924808_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_044750912.1|3924804_3925764_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_044750914.1|3925760_3926834_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_014502259.1|3926894_3928250_-	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_014502258.1|3928420_3929656_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_010368407.1|3929797_3930037_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_024712433.1|3930240_3930984_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.4	1.5e-11
WP_024712434.1|3931066_3932011_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_024712435.1|3932288_3932729_-	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_044750917.1|3932958_3933936_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010368401.1|3934025_3934220_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_024712438.1|3934317_3934827_-	characterized ACR protein	NA	NA	NA	NA	NA
WP_024712439.1|3934939_3935515_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_044751761.1|3935619_3937413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014502250.1|3937563_3939432_-	membrane protein	NA	NA	NA	NA	NA
WP_011407746.1|3939469_3940423_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_014502248.1|3940428_3941385_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_024712086.1|3941377_3943330_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_014502246.1|3943326_3943860_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011407744.1|3943979_3944330_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257913.1|3944431_3945025_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_005913896.1|3945122_3945443_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_044750919.1|3945449_3947546_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	3.1e-46
WP_014502242.1|3947999_3948449_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_014502241.1|3948445_3948691_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011407742.1|3948687_3949185_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_044750921.1|3949209_3949590_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_044750924.1|3949586_3950618_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_044750925.1|3950617_3951367_-	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.2	1.4e-09
WP_044750926.1|3951366_3952116_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_044750928.1|3952136_3953186_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014502236.1|3953396_3953801_-	hypothetical protein	NA	M1H7V2	Paramecium_bursaria_Chlorella_virus	39.7	1.8e-14
WP_014502235.1|3954343_3955048_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_044750930.1|3955409_3956378_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_011257889.1|3956641_3957376_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257888.1|3957384_3957837_-	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_024712320.1|3957864_3958521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014502233.1|3958533_3959301_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_024712321.1|3959297_3960482_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_024712322.1|3961180_3963151_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002806049.1|3963766_3964039_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_014502230.1|3964252_3966724_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	6.4e-224
WP_011257881.1|3966870_3968157_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_002806026.1|3968281_3968908_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_044750934.1|3969000_3970293_-	trigger factor	NA	NA	NA	NA	NA
WP_144406650.1|3971411_3972513_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.4e-40
>prophage 27
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	4295741	4458657	5080102	integrase,transposase,protease	Leptospira_phage(18.18%)	109	4303935:4303953	4371747:4371765
WP_144406593.1|4295741_4296773_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044751087.1|4301829_4303062_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	42.0	1.5e-72
4303935:4303953	attL	GTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_044751094.1|4305771_4307814_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_044751096.1|4307815_4309714_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_014501923.1|4309715_4310969_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_024711947.1|4310965_4311571_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_024711946.1|4311995_4313150_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_024711945.1|4313152_4314181_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_014501919.1|4314187_4315255_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4315295_4316573_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4316617_4317385_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044751099.1|4317599_4318766_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_044751102.1|4318899_4321296_-	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_044751105.1|4321292_4324190_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.1	1.2e-22
WP_044751107.1|4324340_4327046_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_014501907.1|4329276_4330461_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014501906.1|4330528_4331266_+	pteridine reductase	NA	NA	NA	NA	NA
WP_024711742.1|4331435_4331951_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_014501904.1|4332042_4333545_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_003482689.1|4333548_4333989_-	response regulator	NA	NA	NA	NA	NA
WP_014501903.1|4333985_4335797_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.7	1.0e-08
WP_014501902.1|4336082_4336454_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_014501901.1|4336604_4337663_+	oxidoreductase	NA	NA	NA	NA	NA
WP_024711740.1|4338002_4338944_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	1.0e-68
WP_076342573.1|4338964_4340302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501897.1|4340473_4340854_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_044751114.1|4340978_4341740_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_014501892.1|4343965_4345369_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.7	2.8e-131
WP_024711734.1|4345491_4346547_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	4.9e-80
WP_014501890.1|4346708_4347575_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_033005118.1|4347866_4350050_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.6	8.3e-82
WP_044751118.1|4350591_4351245_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_052806859.1|4351241_4353110_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_044751120.1|4353096_4354002_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_052806861.1|4353953_4354763_+	TniQ family protein	NA	NA	NA	NA	NA
WP_144406644.1|4354759_4355862_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_161795296.1|4355886_4356219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044751121.1|4356243_4357089_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_161795297.1|4357149_4358490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144406604.1|4358563_4360114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751123.1|4360326_4361373_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_024711731.1|4361387_4362086_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_014501886.1|4362073_4362352_-	YbeD family protein	NA	NA	NA	NA	NA
WP_014501883.1|4363417_4364623_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.6	1.6e-66
WP_044751125.1|4365125_4366541_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_024711726.1|4366537_4367677_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_144406620.1|4368265_4369367_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_125168765.1|4370175_4370718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749546.1|4371767_4373144_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
4371747:4371765	attR	GTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_011407237.1|4373264_4374221_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_144406656.1|4374687_4375173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751132.1|4376126_4377212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052806863.1|4377208_4378594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751133.1|4378725_4379805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082351961.1|4379801_4381286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751136.1|4381345_4382332_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_014501876.1|4383089_4384208_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_044751138.1|4384204_4386265_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_014501874.1|4386268_4386754_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_044751140.1|4386750_4388109_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003482734.1|4388281_4389328_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	2.7e-06
WP_014501872.1|4389603_4390536_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_014501871.1|4390647_4391271_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_024711069.1|4391570_4392290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751142.1|4392461_4394474_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_014501867.1|4394595_4395486_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_024711071.1|4395658_4396420_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_024711072.1|4396506_4398156_+	MFS transporter	NA	NA	NA	NA	NA
WP_044751144.1|4398152_4399241_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_024711074.1|4399415_4399916_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024711075.1|4399912_4400368_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_014501860.1|4400570_4401938_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	30.0	6.2e-43
WP_011260360.1|4402041_4402593_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_024711077.1|4403113_4404031_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	2.2e-12
WP_014501857.1|4404236_4404908_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_024711078.1|4404904_4405759_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_014501855.1|4405748_4405991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711079.1|4406048_4406447_-	YbaN family protein	NA	NA	NA	NA	NA
WP_044751800.1|4406790_4408926_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.0	1.6e-29
WP_024711081.1|4409035_4410235_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_044751146.1|4411043_4413137_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_014501848.1|4413204_4413516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711083.1|4413901_4414471_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_014501846.1|4414821_4415787_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_024711084.1|4416349_4417150_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_024711085.1|4417712_4418627_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_014501843.1|4418657_4419395_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024711087.1|4419425_4420478_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_014501841.1|4420482_4421151_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014501840.1|4421302_4423240_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_053502200.1|4423926_4424958_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	1.0e-74
WP_024711090.1|4425332_4426982_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_024711091.1|4428385_4429873_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	9.2e-125
WP_153296828.1|4431827_4432058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711092.1|4434594_4437177_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	2.5e-08
WP_044751147.1|4437430_4440310_+	insulinase family protein	NA	NA	NA	NA	NA
WP_014501826.1|4440867_4441797_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_041183062.1|4441835_4442831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711096.1|4444075_4444861_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_044751148.1|4445114_4446788_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_144406605.1|4447289_4448255_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_024712776.1|4448399_4448849_-	autotransporter	NA	NA	NA	NA	NA
WP_014501818.1|4449182_4449467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406606.1|4449928_4450727_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014501814.1|4450854_4451766_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024712628.1|4452011_4453007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501811.1|4453093_4454470_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_144406620.1|4456125_4457227_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_044751158.1|4457694_4458657_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	4480784	4562970	5080102	transposase,tRNA	Pandoravirus(11.76%)	57	NA	NA
WP_082351966.1|4480784_4481741_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	6.2e-42
WP_044751807.1|4482723_4485162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712526.1|4485255_4487433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712525.1|4487949_4489023_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	48.2	7.4e-84
WP_044751171.1|4489896_4492686_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.8	1.7e-103
WP_033005440.1|4493059_4495330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501779.1|4495629_4497270_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	6.7e-177
WP_014501778.1|4497406_4497694_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.9	2.3e-16
WP_076342523.1|4499577_4499877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712189.1|4501170_4501785_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_010370120.1|4501863_4502739_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	2.7e-44
WP_014501767.1|4502955_4503681_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	6.2e-50
WP_014501766.1|4503677_4504520_-	response regulator	NA	NA	NA	NA	NA
WP_024712190.1|4504528_4505479_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003484499.1|4505475_4506162_-	cell division ATP-binding protein FtsE	NA	F2Y165	Organic_Lake_phycodnavirus	24.4	7.5e-05
WP_044751177.1|4506237_4507962_-	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.6	1.4e-47
WP_044751179.1|4508160_4508502_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.4	5.1e-15
WP_014501761.1|4508718_4510608_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_024712111.1|4512783_4513017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501756.1|4513091_4515323_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_044751809.1|4515512_4517225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501753.1|4518047_4518863_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.1	7.4e-36
WP_024712107.1|4519624_4520941_-	amidohydrolase	NA	NA	NA	NA	NA
WP_024712106.1|4521200_4522445_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044751181.1|4522538_4525787_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_024712104.1|4525920_4529061_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_014501746.1|4529530_4529893_+	VOC family protein	NA	NA	NA	NA	NA
WP_144406607.1|4530239_4531205_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041183602.1|4531430_4532798_-	VOC family protein	NA	NA	NA	NA	NA
WP_014501739.1|4533856_4534435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712458.1|4534586_4535339_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4535376_4535817_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_014501736.1|4536023_4536365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501735.1|4536590_4536968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4537179_4537377_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_024712456.1|4537692_4538439_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_014501732.1|4538531_4539338_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	29.8	1.7e-08
WP_024712455.1|4539558_4540971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712454.1|4540967_4542065_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_024712667.1|4542943_4543720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501728.1|4543716_4545033_+	amino acid permease	NA	NA	NA	NA	NA
WP_044751184.1|4545244_4545526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712762.1|4545703_4546036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712763.1|4546090_4546426_-	membrane protein	NA	NA	NA	NA	NA
WP_143703629.1|4546474_4547238_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044751185.1|4547525_4548704_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_144406609.1|4549125_4550158_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_014501722.1|4550337_4552509_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_003484603.1|4552738_4553095_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014501720.1|4553180_4554245_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.4	6.6e-101
WP_002808376.1|4554524_4554740_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014501719.1|4555047_4555494_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.9	6.1e-24
WP_144406574.1|4555582_4556684_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	4.2e-42
WP_044751191.1|4558231_4559194_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_044751192.1|4559282_4561031_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	3.2e-44
WP_044751193.1|4561187_4561619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144406620.1|4561868_4562970_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
>prophage 29
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	4580656	4641010	5080102	transposase,tRNA	Leptospira_phage(30.0%)	39	NA	NA
WP_044749546.1|4580656_4582033_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_024712516.1|4588912_4590124_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_044751203.1|4590294_4591713_+	M23 family metallopeptidase	NA	A0A222ZJ66	Rhodococcus_phage	32.9	2.2e-11
WP_024712514.1|4592083_4593217_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_014501697.1|4593254_4593482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751205.1|4593540_4594836_-	MFS transporter	NA	NA	NA	NA	NA
WP_024712512.1|4595154_4595955_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	29.0	5.2e-26
WP_144406612.1|4596827_4597930_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.0	4.8e-38
WP_024712498.1|4599162_4600758_+	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_024712497.1|4600857_4601343_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_162484715.1|4601368_4601533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712496.1|4601888_4604717_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_024712495.1|4604716_4605091_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_044751211.1|4605087_4606632_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_024712493.1|4606628_4607135_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_011260421.1|4607131_4607416_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260422.1|4607412_4607766_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_076342620.1|4608162_4608552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044751212.1|4609058_4610027_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_024712714.1|4610136_4611462_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_014501681.1|4613245_4614361_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_019301451.1|4614483_4614972_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024712413.1|4615327_4615918_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014501677.1|4615929_4617438_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.7	1.2e-63
WP_014501676.1|4617880_4618774_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_044751214.1|4621937_4623008_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_024712410.1|4623009_4623393_+	peptide-binding protein	NA	NA	NA	NA	NA
WP_044751216.1|4623389_4624901_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_044751218.1|4624954_4625197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751219.1|4625138_4625462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751221.1|4625926_4626898_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.3	2.7e-85
WP_044751223.1|4627736_4629026_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.6	3.5e-40
WP_014501665.1|4629465_4629801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712587.1|4630075_4630507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712586.1|4630855_4632265_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044751230.1|4635792_4638777_+	avirulence protein	NA	NA	NA	NA	NA
WP_144406642.1|4638874_4639976_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	5.5e-42
WP_052806865.1|4640021_4640171_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_044749821.1|4640164_4641010_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	5.0e-43
>prophage 30
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	4686325	4760893	5080102	transposase	Leptospira_phage(28.57%)	51	NA	NA
WP_144406646.1|4686325_4687427_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.1e-42
WP_044751255.1|4688991_4690302_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_041183034.1|4691083_4693444_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_024712120.1|4693888_4694608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044751256.1|4694604_4695198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044751824.1|4695896_4696796_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_044749568.1|4697005_4697968_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_144406642.1|4698393_4699495_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	5.5e-42
WP_044751257.1|4700204_4703006_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	3.1e-65
WP_044751258.1|4703082_4703373_+	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_014501600.1|4705607_4706507_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014501595.1|4708036_4708483_-	universal stress protein	NA	NA	NA	NA	NA
WP_024711626.1|4708744_4709323_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_014501593.1|4709299_4709524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711627.1|4709691_4711878_-	DNA helicase II	NA	A7KV33	Bacillus_phage	36.8	1.0e-111
WP_014501591.1|4712225_4713620_-	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_024711628.1|4713786_4713993_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_024711629.1|4714191_4715610_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_044751259.1|4715626_4716934_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044751260.1|4717035_4717707_+	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_024711632.1|4717699_4718755_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_014501584.1|4718983_4720006_+	amidohydrolase	NA	NA	NA	NA	NA
WP_002809462.1|4720438_4720606_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002809459.1|4720619_4720856_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_014501582.1|4721040_4721400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711633.1|4722126_4723944_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_024711634.1|4724297_4724936_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_024711635.1|4725158_4726787_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_044751261.1|4726963_4728535_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_014501576.1|4728553_4729150_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_024711636.1|4729285_4729537_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_024711637.1|4729598_4730036_-	GFA family protein	NA	NA	NA	NA	NA
WP_044751262.1|4730032_4730812_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_044751263.1|4731225_4731870_+	ROK family protein	NA	NA	NA	NA	NA
WP_024711809.1|4732479_4734207_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_014501570.1|4734203_4734521_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_024711808.1|4734607_4735984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024711807.1|4736280_4738224_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.2	3.0e-83
WP_014501567.1|4738485_4739154_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024711805.1|4740418_4740622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024711803.1|4741318_4742095_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024711802.1|4742561_4743146_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_044751825.1|4743338_4746788_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_044751264.1|4747525_4750168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044751827.1|4750271_4752671_-	NdvB protein	NA	NA	NA	NA	NA
WP_044751265.1|4752673_4754056_-	MFS transporter	NA	NA	NA	NA	NA
WP_024711796.1|4754213_4754798_+	gluconokinase	NA	NA	NA	NA	NA
WP_024711795.1|4755862_4757593_+	PQQ-binding-like beta-propeller repeat protein	NA	S4VRB1	Pandoravirus	36.5	1.4e-79
WP_044751266.1|4757895_4758864_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_144406614.1|4759000_4760320_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_044751830.1|4760416_4760893_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	4766541	4844020	5080102	holin,transposase,tRNA	Acidithiobacillus_phage(27.27%)	54	NA	NA
WP_014501549.1|4766541_4767171_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|4767173_4767605_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_024711709.1|4767661_4768240_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_044751268.1|4768335_4769088_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_044751269.1|4769785_4770280_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_044751270.1|4770289_4771963_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.4	1.2e-27
WP_014501542.1|4771959_4772604_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_044751272.1|4772838_4773942_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003468167.1|4774535_4774694_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_044751274.1|4774758_4775769_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	31.7	3.8e-13
WP_011258802.1|4775959_4776928_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_024711718.1|4777157_4778828_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409606.1|4779156_4779540_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_044751276.1|4779761_4780664_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_014501535.1|4780804_4781923_-	Fic family protein	NA	NA	NA	NA	NA
WP_014501534.1|4782094_4783111_-	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010370565.1|4783212_4783533_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_044751278.1|4783918_4784368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501532.1|4784389_4784866_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_044751280.1|4785207_4786431_-	MFS transporter	NA	NA	NA	NA	NA
WP_024711724.1|4786535_4787147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712153.1|4788306_4789653_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_024712154.1|4789637_4791080_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_044751281.1|4791129_4792857_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_024712156.1|4793215_4793812_+	Ax21 family protein	NA	NA	NA	NA	NA
WP_024712157.1|4794134_4795160_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_014501523.1|4795175_4795688_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_014501522.1|4795797_4796232_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_024712158.1|4796307_4796730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712159.1|4796758_4797229_-	thioesterase	NA	NA	NA	NA	NA
WP_014501519.1|4797499_4798309_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_082352011.1|4798484_4799288_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_024712161.1|4799391_4800369_+	uroporphyrin-III methyltransferase	NA	NA	NA	NA	NA
WP_014501516.1|4800365_4801631_+	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_044751285.1|4802056_4802521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712162.1|4802684_4803980_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_082351970.1|4804051_4804954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406620.1|4805882_4806984_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_044749546.1|4807254_4808631_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_044751286.1|4809365_4812128_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	8.1e-42
WP_024745590.1|4812136_4813063_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044751288.1|4813059_4815900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082332991.1|4815917_4816655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044751290.1|4816681_4819024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743124.1|4819051_4819783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044751292.1|4819809_4822152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044751831.1|4822180_4822927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144406657.1|4824464_4825567_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.5e-42
WP_044751293.1|4825466_4825934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082351971.1|4825948_4826167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071162382.1|4826163_4838772_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.8	1.1e-40
WP_044751294.1|4838793_4840536_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	24.6	2.1e-27
WP_044751295.1|4840849_4842226_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.2e-78
WP_044749546.1|4842643_4844020_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 32
NZ_CP007221	Xanthomonas oryzae pv. oryzicola strain CFBP7342 chromosome, complete genome	5080102	4906641	4958278	5080102	transposase	Leptospira_phage(36.36%)	35	NA	NA
WP_044751314.1|4906641_4907598_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.3e-42
WP_131085336.1|4907927_4908959_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.5e-73
WP_011258802.1|4910872_4911841_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_144406620.1|4912064_4913167_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.2e-43
WP_024712074.1|4919299_4920481_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_044751317.1|4920589_4922494_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	5.1e-19
WP_024712071.1|4922490_4923093_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_044751318.1|4923193_4924459_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_044751319.1|4925013_4927176_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_014501443.1|4927469_4927676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076342453.1|4927883_4928273_-	YchJ family protein	NA	NA	NA	NA	NA
WP_044751321.1|4929258_4930440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751322.1|4930537_4933969_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_014501438.1|4934116_4934815_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_014501437.1|4934798_4936271_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_044751324.1|4936267_4936855_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_024712061.1|4937249_4937852_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	3.1e-47
WP_044751329.1|4937979_4938471_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044751844.1|4938822_4939341_+	TolC family protein	NA	NA	NA	NA	NA
WP_024712693.1|4940181_4941543_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	6.4e-32
WP_082351973.1|4941656_4941977_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_044751845.1|4942328_4943543_+	phospholipase	NA	NA	NA	NA	NA
WP_014501423.1|4943792_4943999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014501422.1|4943985_4945098_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_144406633.1|4945899_4947001_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	3.8e-43
WP_024712260.1|4947411_4948284_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	34.9	1.6e-44
WP_082348143.1|4948283_4949843_-	ATP-binding protein	NA	K7PHD1	Enterobacteria_phage	50.0	1.1e-136
WP_044751330.1|4949999_4950449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014501418.1|4950573_4950795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044751331.1|4951474_4951663_-	CsbD family protein	NA	NA	NA	NA	NA
WP_044751852.1|4951904_4953074_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_087770651.1|4953369_4953852_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_044751332.1|4954411_4955485_-	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_024712265.1|4955887_4956358_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_144406617.1|4957177_4958278_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.0	4.7e-41
