The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010577	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 chromosome, complete genome	5652292	239451	247550	5652292		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|239451_239736_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029992.1|239774_241409_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	1.3e-156
WP_164852166.1|241812_243354_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	6.8e-22
WP_000833094.1|243740_245066_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	7.1e-44
WP_000929886.1|245359_246061_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.6e-39
WP_000719237.1|246044_247550_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	1.3e-30
>prophage 2
NZ_CP010577	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 chromosome, complete genome	5652292	287523	295899	5652292		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625682.1|287523_288831_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170545.1|288919_289639_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|289631_289886_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666782.1|289882_290566_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055594.1|290549_292769_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	3.3e-163
WP_000879026.1|292753_294169_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262424.1|294274_295315_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.3	5.5e-68
WP_016078569.1|295311_295899_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	2.7e-27
>prophage 3
NZ_CP010577	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 chromosome, complete genome	5652292	645258	688813	5652292	tail,head,terminase,portal,integrase,capsid,plate,bacteriocin,protease	Bacillus_phage(92.73%)	59	646615:646629	679756:679770
WP_001132863.1|645258_646155_+	ribokinase	NA	A0A0K0KW05	Prochlorococcus_phage	30.2	2.0e-05
WP_000716153.1|646151_646547_+	D-ribose pyranase	NA	NA	NA	NA	NA
646615:646629	attL	TTTTGAAGAATGCAC	NA	NA	NA	NA
WP_044797803.1|646951_648112_-|integrase	site-specific integrase	integrase	A0A1C8E994	Bacillus_phage	100.0	2.2e-219
WP_044797805.1|648181_648607_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	100.0	2.6e-77
WP_044797807.1|648622_649045_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	100.0	2.8e-71
WP_044797808.1|649317_649503_+	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	100.0	9.2e-27
WP_044797810.1|649502_649775_+	DUF771 domain-containing protein	NA	A0A1C8E9B3	Bacillus_phage	100.0	5.3e-47
WP_172452020.1|649788_649944_+	hypothetical protein	NA	A0A1C8E9A0	Bacillus_phage	100.0	6.7e-23
WP_044797811.1|649960_650791_+	ORF6C domain-containing protein	NA	A0A1C8E9A5	Bacillus_phage	100.0	4.0e-154
WP_044797813.1|650802_650991_+	hypothetical protein	NA	A0A1C8E9A1	Bacillus_phage	100.0	2.7e-26
WP_033669561.1|651017_651452_+	hypothetical protein	NA	A0A1C8E9A2	Bacillus_phage	100.0	2.1e-74
WP_016099145.1|651470_652184_+	hypothetical protein	NA	A0A1C8EA84	Bacillus_phage	100.0	3.2e-128
WP_080893217.1|652183_652399_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	100.0	5.0e-32
WP_080893219.1|652328_652670_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	97.3	9.9e-51
WP_044797814.1|652763_653678_+	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	99.0	1.8e-139
WP_044797815.1|653689_654169_+	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	94.3	8.4e-80
WP_000139235.1|654161_654392_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_044797816.1|654415_655009_+	hypothetical protein	NA	A0A1C8E9A7	Bacillus_phage	97.5	1.1e-84
WP_044797817.1|655041_655590_+	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	53.8	4.4e-48
WP_001053195.1|655628_656063_+	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	93.8	3.3e-75
WP_001093039.1|656231_657023_+	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_044797818.1|657106_657634_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	100.0	2.9e-97
WP_044797819.1|657630_657957_+	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	100.0	3.3e-59
WP_003308641.1|657994_658396_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	99.2	1.1e-67
WP_044797820.1|658798_659383_-	hypothetical protein	NA	A0A1C8E9C5	Bacillus_phage	100.0	1.2e-107
WP_044797821.1|659508_659706_+	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	100.0	2.3e-28
WP_044797822.1|659751_660093_+	hypothetical protein	NA	A0A1C8E9B7	Bacillus_phage	100.0	1.2e-61
WP_044797823.1|660089_660377_+	phage protein	NA	A0A1C8EAA0	Bacillus_phage	100.0	9.5e-47
WP_044797824.1|660373_660766_+	HNH endonuclease	NA	A0A1C8E9C7	Bacillus_phage	100.0	3.9e-75
WP_044797825.1|660849_661275_+|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	100.0	4.7e-74
WP_044797826.1|661271_662996_+|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	100.0	0.0e+00
WP_044797827.1|663010_663223_+	hypothetical protein	NA	A0A1C8E971	Bacillus_phage	100.0	7.3e-36
WP_044797828.1|663222_663438_+	hypothetical protein	NA	A0A1C8E977	Bacillus_phage	100.0	1.4e-31
WP_044797829.1|663476_664649_+|portal	phage portal protein	portal	A0A1C8E972	Bacillus_phage	100.0	7.5e-223
WP_044797830.1|664817_665075_-	hypothetical protein	NA	A0A1C8E966	Bacillus_phage	100.0	2.4e-41
WP_044797831.1|665147_665729_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	100.0	3.0e-100
WP_044797832.1|665730_667053_+|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	100.0	1.8e-217
WP_044797833.1|667056_667317_+|head,tail	phage head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	100.0	3.8e-42
WP_044797834.1|667291_667627_+	phage protein	NA	A0A1C8E986	Bacillus_phage	100.0	2.9e-55
WP_001167236.1|667616_667946_+	hypothetical protein	NA	A0A1C8E981	Bacillus_phage	100.0	6.2e-58
WP_044797835.1|667945_668323_+	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	100.0	1.7e-64
WP_044797836.1|668334_668970_+|tail	phi13 family phage major tail protein	tail	A0A1C8E980	Bacillus_phage	100.0	5.7e-116
WP_000113342.1|668981_669368_+	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	100.0	7.3e-66
WP_000383689.1|669406_669595_+	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	100.0	1.6e-31
WP_044797837.1|669611_673133_+|tail	phage tail tape measure protein	tail	A0A1C8E982	Bacillus_phage	100.0	1.2e-295
WP_044797838.1|673134_673818_+|tail	phage tail family protein	tail	A0A1C8EA72	Bacillus_phage	100.0	4.3e-130
WP_044797839.1|673814_676157_+|tail	phage tail protein	tail	A0A1C8E983	Bacillus_phage	100.0	0.0e+00
WP_044797840.1|676171_677446_+|plate	BppU family phage baseplate upper protein	plate	A0A1C8E978	Bacillus_phage	100.0	7.1e-243
WP_000392439.1|677541_677772_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	100.0	5.7e-34
WP_044797842.1|677768_678821_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1C8E990	Bacillus_phage	100.0	3.5e-203
WP_000119474.1|679341_679671_-	hypothetical protein	NA	A0A1C8E989	Bacillus_phage	100.0	2.8e-50
WP_044797843.1|679735_680407_-	hypothetical protein	NA	A0A1C8E993	Bacillus_phage	100.0	1.0e-115
679756:679770	attR	TTTTGAAGAATGCAC	NA	NA	NA	NA
WP_044797844.1|680557_680776_+	hypothetical protein	NA	A0A1C8E991	Bacillus_phage	100.0	7.0e-34
WP_044797845.1|680799_681093_+	YolD-like family protein	NA	A0A1C8E992	Bacillus_phage	100.0	2.6e-47
WP_044797846.1|681109_681937_-	helix-turn-helix domain-containing protein	NA	A0A1C8EA76	Bacillus_phage	100.0	5.1e-149
WP_016078612.1|683472_684408_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000758976.1|684422_685349_+	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_000667666.1|685383_686031_+	fructose-6-phosphate aldolase	NA	G8EY84	Synechococcus_phage	48.8	5.1e-48
WP_001252976.1|686413_688813_+|protease	M6 family metalloprotease immune inhibitor InhA	protease	NA	NA	NA	NA
>prophage 4
NZ_CP010577	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 chromosome, complete genome	5652292	1167348	1254354	5652292	tail,head,terminase,portal,tRNA,integrase,capsid,transposase,holin,protease	Bacillus_phage(42.86%)	93	1182850:1182867	1214029:1214046
WP_044797875.1|1167348_1169127_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.1	2.7e-22
WP_044797876.1|1169157_1170561_-	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	3.1e-114
WP_000289676.1|1170673_1170892_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044797877.1|1170907_1171591_-	LexA family transcriptional regulator	NA	A0A2I6PF08	Staphylococcus_phage	31.9	4.5e-18
WP_000385075.1|1171741_1172014_+	helix-turn-helix transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	50.0	2.3e-10
WP_000014073.1|1172079_1172244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175566458.1|1172312_1172480_+	hypothetical protein	NA	A0A1B2APZ0	Phage_Wrath	76.4	2.8e-14
WP_175566457.1|1172480_1172636_+	hypothetical protein	NA	A0A1C8E9A0	Bacillus_phage	88.0	7.7e-19
WP_044797878.1|1172648_1173410_+	ORF6C domain-containing protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	93.3	4.5e-128
WP_001187283.1|1173421_1173610_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	62.9	2.6e-13
WP_044797879.1|1173636_1174065_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	97.2	6.4e-71
WP_044797880.1|1174082_1174796_+	hypothetical protein	NA	A0A2H4JC60	uncultured_Caudovirales_phage	97.5	1.2e-125
WP_014894867.1|1174795_1175011_+	hypothetical protein	NA	A0A2H4J3B2	uncultured_Caudovirales_phage	90.1	2.0e-28
WP_042597302.1|1174943_1175282_+	hypothetical protein	NA	A0A2H4J6H7	uncultured_Caudovirales_phage	99.1	6.2e-53
WP_044797881.1|1175367_1176285_+	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	91.5	9.6e-125
WP_044797815.1|1176296_1176776_+	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	94.3	8.4e-80
WP_000139235.1|1176768_1176999_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_044797816.1|1177022_1177616_+	hypothetical protein	NA	A0A1C8E9A7	Bacillus_phage	97.5	1.1e-84
WP_044797817.1|1177648_1178197_+	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	53.8	4.4e-48
WP_044797882.1|1178235_1178670_+	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	94.4	3.9e-76
WP_001093039.1|1178838_1179630_+	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_175566456.1|1179711_1179876_+	hypothetical protein	NA	A0A068EMC2	Bacillus_phage	79.2	7.4e-20
WP_000331717.1|1179911_1180439_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	91.4	1.9e-88
WP_042596893.1|1180435_1180759_+	hypothetical protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	74.8	4.7e-42
WP_044797884.1|1180959_1181346_+	hypothetical protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	74.4	9.8e-47
WP_044798211.1|1181628_1181964_+	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	70.5	6.0e-16
WP_044797885.1|1181969_1182404_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	58.5	2.2e-18
WP_044797886.1|1182463_1182772_+	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	48.5	1.2e-18
1182850:1182867	attL	GATGAATTAAATGCTAAA	NA	NA	NA	NA
WP_044798212.1|1182963_1183422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044797888.1|1183514_1183877_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	41.0	1.7e-16
WP_044797889.1|1183873_1185574_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	71.6	1.6e-245
WP_044797890.1|1185587_1186766_+|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	61.6	5.5e-141
WP_001236353.1|1186900_1188130_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_044797892.1|1188500_1189085_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	44.1	1.0e-31
WP_044797893.1|1189101_1190286_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	23.1	5.6e-08
WP_001016250.1|1190301_1190559_+	hypothetical protein	NA	A6XMJ7	Bacillus_virus	43.2	1.1e-06
WP_044797895.1|1190555_1190828_+	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	55.1	3.6e-19
WP_042596912.1|1190824_1191124_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_044797896.1|1191116_1191473_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	61.5	3.6e-35
WP_044797897.1|1191469_1191799_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	84.4	4.4e-48
WP_044797898.1|1191799_1192393_+|tail	phage tail protein	tail	D2XR23	Bacillus_phage	93.8	6.1e-104
WP_000415931.1|1192399_1192762_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	71.7	1.4e-42
WP_044797899.1|1192992_1194237_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	81.6	8.6e-177
WP_044797901.1|1195880_1198898_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	99.9	0.0e+00
WP_024086117.1|1198969_1199890_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	100.0	3.6e-172
WP_024086118.1|1200045_1200303_+	hypothetical protein	NA	A0A125RQ77	Bacillus_phage	100.0	1.4e-41
WP_024086119.1|1200271_1200535_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A125RQ76	Bacillus_phage	100.0	3.4e-43
WP_044797902.1|1201812_1203282_+|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	78.9	1.3e-232
WP_044797903.1|1203278_1207667_+|tail	phage tail protein	tail	A0A0S2MVB4	Bacillus_phage	58.1	0.0e+00
WP_044797904.1|1207683_1208061_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	66.4	6.5e-43
WP_044797905.1|1208098_1208524_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	99.3	1.3e-71
WP_044797906.1|1208523_1209459_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	82.3	2.7e-154
WP_044797907.1|1210013_1211117_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	92.5	6.9e-186
WP_044797908.1|1211259_1211700_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_044797909.1|1211757_1212726_-	helix-turn-helix domain-containing protein	NA	A0A0S2MVF4	Bacillus_phage	78.8	1.4e-137
WP_000159539.1|1213203_1214163_+	ferrochelatase	NA	NA	NA	NA	NA
1214029:1214046	attR	GATGAATTAAATGCTAAA	NA	NA	NA	NA
WP_001069166.1|1214222_1215689_+	catalase	NA	A0A2K9L572	Tupanvirus	47.8	1.7e-123
WP_044797910.1|1215933_1217166_-	ammonium transporter	NA	NA	NA	NA	NA
WP_033668897.1|1217324_1218680_+	alpha-amylase	NA	NA	NA	NA	NA
WP_000397873.1|1218977_1219874_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001040146.1|1220725_1221217_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_000281261.1|1221447_1222302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214205.1|1222356_1223214_-	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_001120851.1|1223343_1223475_-	DUF3941 domain-containing protein	NA	NA	NA	NA	NA
WP_000364431.1|1223575_1224433_+	YitT family protein	NA	NA	NA	NA	NA
WP_000527408.1|1224458_1224656_-	DUF3813 domain-containing protein	NA	NA	NA	NA	NA
WP_000516816.1|1224656_1224797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041241.1|1224902_1225712_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000531422.1|1226202_1226382_+	YjzC family protein	NA	NA	NA	NA	NA
WP_000365378.1|1226593_1229194_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.4	6.3e-121
WP_001211116.1|1229232_1229415_-	YjzD family protein	NA	NA	NA	NA	NA
WP_000028706.1|1229571_1230306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000486171.1|1230335_1231208_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001003335.1|1231262_1231439_+	ComZ family protein	NA	NA	NA	NA	NA
WP_001100533.1|1231670_1232603_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_000412645.1|1232634_1233873_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_000538198.1|1233980_1234769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000966119.1|1234912_1235659_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	41.6	3.6e-45
WP_000110979.1|1235936_1236926_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001045002.1|1237323_1237704_-	DUF3899 domain-containing protein	NA	NA	NA	NA	NA
WP_000727209.1|1238023_1239679_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000534168.1|1239807_1240737_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000974107.1|1240733_1241750_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000854341.1|1241770_1242814_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	8.1e-19
WP_000166354.1|1242806_1243742_+	ATP-binding cassette domain-containing protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.1	4.9e-07
WP_002083070.1|1243799_1245242_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_000727253.1|1245593_1247240_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000559983.1|1247267_1247471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000258267.1|1248062_1248458_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_000362600.1|1248507_1249182_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	43.1	3.4e-26
WP_000350716.1|1249527_1250211_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_000799189.1|1250283_1251828_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001053969.1|1252917_1254354_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP010577	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 chromosome, complete genome	5652292	1917164	1962951	5652292	capsid,terminase,tail,portal	Bacillus_phage(84.75%)	60	NA	NA
WP_000755512.1|1917164_1918457_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.5	2.2e-10
WP_001194308.1|1918556_1919321_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_044797938.1|1919557_1921132_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	100.0	1.9e-285
WP_000649486.1|1921109_1922492_-	recombinase family protein	NA	B8R885	Bacillus_phage	100.0	3.8e-266
WP_001137803.1|1922491_1923124_-	helix-turn-helix domain-containing protein	NA	W8CZ28	Bacillus_phage	100.0	2.1e-110
WP_016064699.1|1923374_1923623_+	helix-turn-helix transcriptional regulator	NA	W8CYU5	Bacillus_phage	100.0	8.3e-39
WP_016064700.1|1923738_1923975_+	hypothetical protein	NA	W8CYL8	Bacillus_phage	100.0	6.4e-33
WP_016064701.1|1923967_1924237_+	hypothetical protein	NA	W8CYE5	Bacillus_phage	100.0	4.0e-47
WP_016064702.1|1924236_1924410_+	hypothetical protein	NA	W8CZ30	Bacillus_phage	100.0	1.2e-23
WP_016064703.1|1924422_1924908_+	siphovirus Gp157 family protein	NA	W8CYU7	Bacillus_phage	100.0	3.5e-81
WP_016064704.1|1924918_1925122_+	hypothetical protein	NA	K4LP06	Bacillus_virus	100.0	1.4e-28
WP_016064705.1|1925108_1925765_+	ERF family protein	NA	W8CYS2	Bacillus_phage	100.0	1.5e-100
WP_016064706.1|1925764_1926079_+	hypothetical protein	NA	W8CYL9	Bacillus_phage	100.0	1.5e-53
WP_016064707.1|1926107_1926641_+	hypothetical protein	NA	W8CYE6	Bacillus_phage	100.0	1.3e-81
WP_016064708.1|1926643_1927231_+	hypothetical protein	NA	W8CZ31	Bacillus_phage	100.0	3.4e-107
WP_052574927.1|1927230_1928064_+	hypothetical protein	NA	W8CYV0	Bacillus_phage	100.0	9.0e-162
WP_016064710.1|1928126_1928822_+	Rha family transcriptional regulator	NA	W8CYS3	Bacillus_phage	100.0	7.8e-127
WP_044798217.1|1928988_1929444_+	hypothetical protein	NA	W8CYM0	Bacillus_phage	100.0	9.7e-86
WP_016064712.1|1929436_1929643_+	hypothetical protein	NA	W8CYE7	Bacillus_phage	100.0	2.5e-33
WP_016064713.1|1929644_1929782_+	hypothetical protein	NA	W8CZ32	Bacillus_phage	100.0	7.8e-23
WP_044797940.1|1930061_1930565_+	hypothetical protein	NA	W8CYS4	Bacillus_phage	100.0	1.4e-69
WP_000730536.1|1930695_1930896_+	NINE protein	NA	W8CYM1	Bacillus_phage	100.0	2.1e-32
WP_016064715.1|1930933_1932268_+	helicase DnaB	NA	W8CYE8	Bacillus_phage	100.0	2.6e-256
WP_016064717.1|1932461_1932677_+	hypothetical protein	NA	K4LP17	Bacillus_virus	100.0	1.4e-34
WP_103599638.1|1932616_1932904_+	hypothetical protein	NA	W8CYS5	Bacillus_phage	100.0	4.3e-47
WP_016064719.1|1932900_1933047_+	hypothetical protein	NA	W8CYM2	Bacillus_phage	100.0	6.8e-17
WP_016064720.1|1933018_1933618_+	DUF1064 domain-containing protein	NA	W8CYE9	Bacillus_phage	100.0	1.4e-111
WP_153598355.1|1933614_1933770_+	hypothetical protein	NA	A0A1B1P7H5	Bacillus_phage	94.1	2.9e-18
WP_016064721.1|1933769_1933922_+	hypothetical protein	NA	W8CZ34	Bacillus_phage	100.0	2.8e-21
WP_016064723.1|1934274_1934439_+	hypothetical protein	NA	W8CYS6	Bacillus_phage	100.0	8.4e-24
WP_016064724.1|1934556_1934835_+	hypothetical protein	NA	K4LPB5	Bacillus_virus	100.0	4.0e-50
WP_016064725.1|1935136_1935379_+	hypothetical protein	NA	W8CYF0	Bacillus_phage	100.0	2.3e-38
WP_015994878.1|1936845_1937130_+	hypothetical protein	NA	W8CYW3	Bacillus_phage	100.0	7.7e-49
WP_016064726.1|1937101_1937365_+	hypothetical protein	NA	W8CYS7	Bacillus_phage	100.0	2.2e-45
WP_000432374.1|1937364_1937634_+	hypothetical protein	NA	W8CYM4	Bacillus_phage	100.0	4.6e-43
WP_016064727.1|1937728_1938208_+|terminase	terminase small subunit	terminase	W8CYF1	Bacillus_phage	100.0	3.2e-87
WP_016064728.1|1938382_1939702_+|terminase	PBSX family phage terminase large subunit	terminase	W8CZ36	Bacillus_phage	100.0	2.7e-261
WP_016064729.1|1939716_1941189_+|portal	phage portal protein	portal	W8CYW5	Bacillus_phage	100.0	4.4e-281
WP_016064730.1|1941192_1942218_+|capsid	minor capsid protein	capsid	K4LP29	Bacillus_virus	100.0	2.3e-191
WP_016064731.1|1942226_1942427_+	hypothetical protein	NA	W8CYM5	Bacillus_phage	100.0	4.5e-27
WP_016064732.1|1942527_1943151_+	DUF4355 domain-containing protein	NA	W8CZ37	Bacillus_phage	100.0	1.4e-90
WP_016064733.1|1943227_1944064_+	hypothetical protein	NA	W8CYW9	Bacillus_phage	100.0	5.3e-154
WP_000782183.1|1944100_1944466_+	hypothetical protein	NA	W8CYS9	Bacillus_phage	100.0	7.1e-63
WP_001216890.1|1944469_1944802_+	hypothetical protein	NA	W8CYM6	Bacillus_phage	100.0	3.1e-57
WP_000503577.1|1944801_1945218_+	hypothetical protein	NA	W8CYF3	Bacillus_phage	100.0	8.9e-70
WP_016064734.1|1945214_1945616_+	hypothetical protein	NA	W8CZ38	Bacillus_phage	100.0	1.6e-71
WP_016064735.1|1945634_1946300_+	hypothetical protein	NA	W8CYX2	Bacillus_phage	100.0	5.7e-127
WP_000446742.1|1946365_1946785_+	hypothetical protein	NA	W8CYT0	Bacillus_phage	100.0	3.3e-72
WP_015994840.1|1946805_1947078_+	hypothetical protein	NA	W8CYM7	Bacillus_phage	100.0	1.0e-45
WP_016064737.1|1947080_1949924_+|tail	phage tail tape measure protein	tail	K4LRV6	Bacillus_virus	100.0	0.0e+00
WP_044797944.1|1949935_1951450_+|tail	phage tail family protein	tail	W8CYX4	Bacillus_phage	100.0	3.0e-301
WP_044797945.1|1951453_1956814_+	phage minor structural protein	NA	K4LNZ9	Bacillus_virus	99.9	0.0e+00
WP_000427019.1|1956823_1957111_+	hypothetical protein	NA	W8CZ40	Bacillus_phage	100.0	6.2e-46
WP_016064697.1|1957169_1957961_+	N-acetylmuramoyl-L-alanine amidase	NA	K4LP86	Bacillus_virus	100.0	3.5e-155
WP_044797946.1|1957992_1958250_+	multidrug transporter	NA	W8CYT2	Bacillus_phage	100.0	4.4e-27
WP_000612415.1|1958290_1958968_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.6	3.0e-123
WP_016077844.1|1958964_1960038_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	100.0	2.2e-192
WP_000818985.1|1960265_1960985_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_002083265.1|1961697_1961952_+	hypothetical protein	NA	W8CYN0	Bacillus_phage	100.0	4.5e-40
WP_001258547.1|1962081_1962951_+	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	44.2	1.6e-65
>prophage 6
NZ_CP010577	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 chromosome, complete genome	5652292	2140712	2147626	5652292		Bacillus_phage(33.33%)	8	NA	NA
WP_000427801.1|2140712_2140988_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	41.2	2.9e-08
WP_003277991.1|2141186_2141450_+	hypothetical protein	NA	A0A218KBU4	Bacillus_phage	38.9	4.4e-06
WP_000456183.1|2142096_2142444_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	27.5	6.6e-10
WP_000109855.1|2142634_2143708_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.3	6.9e-74
WP_000709202.1|2143704_2143830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499713.1|2144149_2144977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000165966.1|2145086_2145734_+	HD domain-containing protein	NA	S4W232	Pandoravirus	28.3	2.5e-10
WP_000783164.1|2145730_2147626_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	25.3	4.9e-46
>prophage 7
NZ_CP010577	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 chromosome, complete genome	5652292	2595518	2687729	5652292	tail,head,portal,terminase,tRNA,integrase,capsid,transposase,bacteriocin,protease	Bacillus_phage(61.22%)	97	2632595:2632611	2675414:2675430
WP_000558613.1|2595518_2597072_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016077648.1|2597131_2597560_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_000285653.1|2597710_2598625_+	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_000238992.1|2598752_2599460_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002082724.1|2599456_2600440_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000354655.1|2600641_2601538_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	33.7	2.0e-05
WP_000395988.1|2601596_2602586_-	aldo/keto reductase family protein	NA	NA	NA	NA	NA
WP_002082721.1|2603104_2604733_+	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	34.3	1.2e-53
WP_000503550.1|2604753_2605347_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016077647.1|2606077_2606848_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	3.1e-31
WP_016077646.1|2606822_2608754_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000975387.1|2608804_2609491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165517.1|2609568_2609910_-	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
WP_044797970.1|2610186_2611428_+	lipase	NA	NA	NA	NA	NA
WP_000701766.1|2611515_2612541_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000471637.1|2612630_2614079_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_016077645.1|2614083_2614998_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016077644.1|2615304_2615994_+	thiaminase II	NA	NA	NA	NA	NA
WP_002082716.1|2616391_2616655_+	DUF3937 domain-containing protein	NA	NA	NA	NA	NA
WP_001071349.1|2617108_2617438_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_042598145.1|2617931_2618417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000736198.1|2618723_2619425_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_000675852.1|2619463_2620573_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.7	5.7e-148
WP_080893239.1|2621675_2622869_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVK2	Bacillus_phage	59.2	1.7e-126
WP_164852155.1|2622910_2623063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164852160.1|2623222_2623360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427704.1|2623389_2623749_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	43.9	7.8e-22
WP_044797971.1|2623919_2624123_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	59.7	4.4e-14
WP_044797972.1|2624328_2624595_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	89.4	2.7e-35
WP_044797973.1|2624594_2624759_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	90.7	5.1e-21
WP_044797974.1|2624788_2624965_+	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	89.7	1.5e-23
WP_044797975.1|2624969_2625716_+	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	93.5	2.0e-104
WP_044797976.1|2625684_2626488_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	98.5	7.3e-145
WP_044797977.1|2626503_2626698_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	85.9	2.2e-26
WP_000805174.1|2626723_2626897_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	100.0	1.2e-25
WP_044797978.1|2626911_2627166_+	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	88.1	1.4e-36
WP_044797979.1|2627177_2627603_+	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	41.9	2.1e-13
WP_044797980.1|2627618_2628074_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	46.8	9.3e-20
WP_044797981.1|2628112_2628502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044797982.1|2628956_2629823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044797983.1|2630118_2630766_-	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_044797984.1|2631282_2632581_-	collagen-like protein	NA	A0A285PWR0	Cedratvirus	62.6	4.4e-38
2632595:2632611	attL	TTATAAATTAACTAACA	NA	NA	NA	NA
WP_044797986.1|2634332_2634989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044797988.1|2635147_2635318_+	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	64.3	2.1e-09
WP_044797991.1|2635345_2635828_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	2.5e-71
WP_044797992.1|2635827_2636370_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	88.3	1.5e-85
WP_044797993.1|2636644_2637103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044797994.1|2638295_2638517_+	hypothetical protein	NA	B5LPQ8	Bacillus_virus	88.4	1.1e-26
WP_044797995.1|2638530_2638794_+	hypothetical protein	NA	A0A1B1P745	Bacillus_phage	42.5	1.3e-05
WP_044797997.1|2638759_2639095_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.9	3.6e-53
WP_000763337.1|2639247_2639604_+	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	99.2	1.4e-58
WP_000635289.1|2639600_2641256_+|terminase	terminase large subunit	terminase	A0A2H4JI41	uncultured_Caudovirales_phage	95.8	0.0e+00
WP_044797998.1|2641261_2642425_+|portal	phage portal protein	portal	D2XR16	Bacillus_phage	88.4	9.8e-183
WP_000216410.1|2642408_2643191_+|protease	Clp protease ClpP	protease	R9TLM7	Paenibacillus_phage	52.8	1.9e-57
WP_044797999.1|2643194_2644349_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	90.4	2.0e-199
WP_044798000.1|2644354_2644648_+	hypothetical protein	NA	D2XR19	Bacillus_phage	93.8	5.3e-45
WP_044798001.1|2644649_2645003_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	95.7	6.6e-58
WP_044798002.1|2645004_2645346_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	92.0	9.9e-51
WP_044798003.1|2645345_2645675_+	hypothetical protein	NA	D2XR22	Bacillus_phage	88.1	1.5e-48
WP_001004914.1|2645675_2646263_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	81.0	3.3e-86
WP_000415921.1|2646267_2646630_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	90.0	9.8e-57
WP_044798004.1|2646683_2646845_+	hypothetical protein	NA	A0A2H4JHE4	uncultured_Caudovirales_phage	86.8	4.3e-20
WP_044798005.1|2646860_2648324_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	85.4	4.9e-187
WP_044798007.1|2648546_2650712_+|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A2H4JC82	uncultured_Caudovirales_phage	82.6	7.6e-96
WP_044798008.1|2650753_2652229_+|tail	phage tail family protein	tail	D2XR27	Bacillus_phage	58.4	6.4e-163
WP_044798009.1|2652225_2656959_+|tail	phage tail protein	tail	D2XR28	Bacillus_phage	57.9	0.0e+00
WP_000398730.1|2656997_2657234_+	hemolysin XhlA family protein	NA	A0A0A7AQY5	Bacillus_phage	97.4	2.5e-08
WP_000461723.1|2657233_2657473_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	98.7	1.2e-34
WP_044798010.1|2657469_2658534_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	96.6	8.7e-202
WP_044798011.1|2658967_2660158_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	28.4	7.8e-34
WP_044798012.1|2660154_2660928_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000626096.1|2661616_2663299_+	DUF3893 domain-containing protein	NA	NA	NA	NA	NA
WP_033668957.1|2663506_2664274_+	DUF3959 family protein	NA	NA	NA	NA	NA
WP_016077599.1|2664418_2664835_+	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_000878369.1|2664957_2665161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416836.1|2665489_2665702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565700.1|2665911_2666916_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000282691.1|2667062_2667467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000062093.1|2667627_2668863_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000106404.1|2669129_2670413_+	MFS transporter	NA	NA	NA	NA	NA
WP_001069207.1|2670402_2671035_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.1	1.6e-25
WP_000046095.1|2671105_2671261_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_000289121.1|2671363_2671861_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000168021.1|2672001_2673216_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000954440.1|2673324_2673903_+	cysteine dioxygenase family protein	NA	NA	NA	NA	NA
WP_000766389.1|2674077_2674929_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001088545.1|2675351_2677139_+	PAS domain-containing protein	NA	NA	NA	NA	NA
2675414:2675430	attR	TTATAAATTAACTAACA	NA	NA	NA	NA
WP_000743784.1|2677373_2679500_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_002162782.1|2679576_2680107_+	signal peptidase I	NA	NA	NA	NA	NA
WP_000932152.1|2680366_2681554_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	24.3	4.0e-06
WP_000864388.1|2681645_2682326_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_001038209.1|2682735_2683284_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016077598.1|2683294_2684995_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	2.1e-16
WP_016077597.1|2684987_2685788_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2685924_2686032_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000348332.1|2686132_2687392_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	1.6e-24
WP_001074707.1|2687516_2687729_-|transposase	transposase	transposase	A0A0U3U8Y8	Bacillus_phage	75.0	1.8e-18
>prophage 8
NZ_CP010577	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 chromosome, complete genome	5652292	3877162	3982631	5652292	tail,head,portal,terminase,tRNA,integrase,capsid,coat,bacteriocin,protease	Bacillus_phage(50.98%)	108	3860385:3860402	3973312:3973329
3860385:3860402	attL	ACTTCGTCTTTTCCTTCT	NA	NA	NA	NA
WP_001288799.1|3877162_3877705_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_000870460.1|3877831_3878263_-	RicAFT regulatory complex protein RicA family protein	NA	NA	NA	NA	NA
WP_001005392.1|3878266_3879796_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000190155.1|3880224_3881091_-	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_000625429.1|3881077_3882835_-	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_003279695.1|3883060_3884020_-	dipeptidase	NA	NA	NA	NA	NA
WP_000404341.1|3884042_3884303_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_001221092.1|3884452_3885247_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000099770.1|3885405_3886971_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_001283853.1|3887454_3888486_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	71.5	3.2e-137
WP_000990684.1|3888629_3889868_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_001052967.1|3889888_3890467_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000137466.1|3890532_3891447_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|3891468_3892254_-	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_000114444.1|3892392_3892641_-	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_000759625.1|3892716_3893430_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000411972.1|3893530_3894817_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.4	3.8e-10
WP_044798052.1|3894817_3896092_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.5	9.2e-57
WP_000008857.1|3896301_3897261_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_044798053.1|3897261_3898320_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000456930.1|3898312_3899845_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	1.1e-11
WP_000725767.1|3899962_3901039_-	BMP family protein	NA	A0A0A7DN02	Lactobacillus_phage	33.6	5.6e-47
WP_000114182.1|3901131_3901857_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016077342.1|3902395_3904777_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_016077341.1|3904989_3905193_-	YlzJ-like family protein	NA	NA	NA	NA	NA
WP_000139825.1|3905189_3905939_-	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_000823089.1|3906043_3907714_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000564762.1|3908624_3909503_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000692458.1|3909514_3910747_-	aspartate kinase	NA	NA	NA	NA	NA
WP_044798054.1|3910770_3911817_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001238645.1|3911967_3912144_-	dipicolinate synthase	NA	NA	NA	NA	NA
WP_044798055.1|3912291_3912528_-	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	57.1	4.6e-15
WP_044798056.1|3912558_3913080_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_044798057.1|3913079_3913466_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	53.2	1.4e-32
WP_044798058.1|3913443_3914490_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	45.6	7.5e-81
WP_044798059.1|3914963_3915464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044798060.1|3915852_3916662_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	83.3	1.0e-133
WP_001261076.1|3916661_3916898_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A2H4JGN9	uncultured_Caudovirales_phage	100.0	1.7e-25
WP_044798061.1|3916927_3917311_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	70.6	2.4e-45
WP_044798063.1|3917332_3921652_-|tail	phage tail protein	tail	A0A0S2MVB4	Bacillus_phage	62.9	0.0e+00
WP_044798064.1|3921648_3923118_-|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	78.7	3.2e-231
WP_044798065.1|3923159_3926786_-	membrane protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	84.8	8.4e-180
WP_000477703.1|3926803_3926965_-	hypothetical protein	NA	A0A2H4JHE4	uncultured_Caudovirales_phage	81.1	2.1e-19
WP_044798066.1|3927018_3927381_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	71.7	6.2e-43
WP_001004907.1|3927385_3927973_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	82.1	5.1e-87
WP_000176452.1|3927973_3928309_-	hypothetical protein	NA	D2XR22	Bacillus_phage	89.9	7.5e-51
WP_000064422.1|3928305_3928650_-	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	79.5	2.4e-44
WP_001247293.1|3928651_3929005_-|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	93.1	4.3e-57
WP_000450783.1|3929006_3929300_-	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	87.6	3.8e-43
WP_044798067.1|3929305_3930457_-|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	95.8	6.7e-208
WP_044798228.1|3930460_3931204_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	82.6	1.1e-107
WP_044798068.1|3931203_3932349_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	81.9	1.8e-181
WP_044798069.1|3932357_3934025_-|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	90.3	4.2e-304
WP_000301142.1|3934021_3934333_-|terminase	P27 family phage terminase small subunit	terminase	D2XR14	Bacillus_phage	98.1	7.9e-47
WP_044798070.1|3934457_3934793_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	92.8	2.1e-53
WP_044798071.1|3934789_3935218_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	78.5	9.2e-54
WP_044798073.1|3935210_3935465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798074.1|3935478_3935658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798075.1|3935701_3936454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798076.1|3936990_3938019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000434816.1|3938625_3938826_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.8e-21
WP_016108998.1|3939344_3939887_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	5.0e-89
WP_044798077.1|3939886_3940369_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.0e-72
WP_016077323.1|3940396_3940567_-	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	80.4	1.1e-10
WP_044798080.1|3942478_3942904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798229.1|3942917_3943277_-	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	91.6	2.0e-57
WP_175581932.1|3943518_3943680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016077319.1|3943716_3943908_-	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	63.5	1.1e-14
WP_044798081.1|3943980_3944343_-	hypothetical protein	NA	D2XR47	Bacillus_phage	85.8	6.6e-53
WP_044798082.1|3944317_3944506_-	hypothetical protein	NA	D2XR45	Bacillus_phage	83.6	4.8e-15
WP_044798083.1|3944508_3945831_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	95.2	6.0e-237
WP_044798084.1|3945827_3946778_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	59.9	5.2e-73
WP_044798085.1|3947057_3947342_-	hypothetical protein	NA	D2XR42	Bacillus_phage	54.3	4.3e-23
WP_000215316.1|3947522_3947744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537277.1|3947757_3948345_-	hypothetical protein	NA	D2XR41	Bacillus_phage	69.7	2.2e-74
WP_001141264.1|3948435_3948684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798086.1|3948716_3948908_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016077312.1|3949080_3949518_+	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	59.9	7.0e-33
WP_044798087.1|3949530_3949962_+	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	79.0	1.2e-61
WP_044798088.1|3949999_3950767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044798089.1|3950863_3952411_+	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.4	5.9e-143
WP_000954737.1|3952865_3953768_-	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_016077306.1|3953938_3954190_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000592996.1|3954325_3955567_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	5.8e-56
WP_000868231.1|3955654_3956554_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000076742.1|3956706_3958845_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001229392.1|3959005_3959275_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_000766703.1|3959375_3960347_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	31.8	2.1e-05
WP_000399365.1|3960390_3961314_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000776437.1|3961400_3961757_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000634349.1|3961772_3962054_-	DUF503 family protein	NA	NA	NA	NA	NA
WP_000036346.1|3962050_3964117_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.9	1.9e-19
WP_001286522.1|3964121_3964433_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000071123.1|3964433_3964706_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000102599.1|3964717_3965824_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000359095.1|3965841_3966312_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000059996.1|3966645_3970947_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	39.6	4.1e-24
WP_000814295.1|3971071_3972772_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001090241.1|3972881_3974138_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
3973312:3973329	attR	ACTTCGTCTTTTCCTTCT	NA	NA	NA	NA
WP_000790358.1|3974155_3975298_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000813589.1|3975321_3976113_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000971296.1|3976130_3976907_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	9.0e-23
WP_000531505.1|3976992_3977550_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000042669.1|3977552_3978275_-	UMP kinase	NA	NA	NA	NA	NA
WP_001018576.1|3978341_3979229_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_000111485.1|3979332_3980034_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000421290.1|3980382_3981162_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_000550084.1|3981239_3982631_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.1e-47
>prophage 9
NZ_CP010577	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 chromosome, complete genome	5652292	4552766	4637676	5652292	tail,head,portal,terminase,tRNA,capsid,coat,protease	Bacillus_phage(88.52%)	102	NA	NA
WP_002082112.1|4552766_4553111_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|4553122_4553431_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000855476.1|4553600_4554989_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000599047.1|4555056_4555917_-	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_000797477.1|4555909_4556656_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503309.1|4556789_4557587_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391514.1|4557589_4558276_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975762.1|4558311_4558857_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135484.1|4558871_4559723_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466736.1|4559764_4560784_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_001013396.1|4560941_4561619_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000720491.1|4561665_4562241_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_042595877.1|4562473_4563424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000582079.1|4563588_4564890_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016077237.1|4564983_4567629_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.0	5.5e-165
WP_000350652.1|4568112_4569138_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_062804407.1|4569204_4570206_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000712938.1|4570286_4571573_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_001087080.1|4571572_4572562_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000992324.1|4572582_4573335_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001226403.1|4573337_4574267_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000009002.1|4574282_4575116_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_000547868.1|4575133_4576468_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000133913.1|4576884_4577337_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000359773.1|4577339_4577756_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000869118.1|4577790_4578387_-	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000097281.1|4578383_4580714_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	7.3e-177
WP_000119171.1|4580896_4582567_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.5	8.7e-15
WP_000472289.1|4582673_4583933_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	1.0e-148
WP_000105215.1|4584197_4585475_-	trigger factor	NA	NA	NA	NA	NA
WP_000358275.1|4585784_4586783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798102.1|4586980_4587229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000475202.1|4587748_4588363_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_000124591.1|4588452_4588653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000645510.1|4589456_4589960_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_000815946.1|4589973_4590582_-	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	34.4	2.0e-14
WP_001261763.1|4590593_4591331_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_001126747.1|4591462_4592512_-	spore germination protein GerM	NA	NA	NA	NA	NA
WP_000774005.1|4592746_4593556_-	glutamate racemase	NA	NA	NA	NA	NA
WP_000513862.1|4593769_4595095_-	MFS transporter	NA	NA	NA	NA	NA
WP_000728521.1|4595608_4596292_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001233010.1|4596341_4596980_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002082076.1|4597137_4597800_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_042631274.1|4597907_4597982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798103.1|4598016_4599471_-	recombinase family protein	NA	A0A288WG52	Bacillus_phage	96.5	2.6e-233
WP_044798105.1|4599568_4600432_-	helix-turn-helix domain-containing protein	NA	A0A288WFZ2	Bacillus_phage	95.1	1.0e-147
WP_127057650.1|4600446_4600566_-	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	66.7	2.0e-06
WP_153599615.1|4600700_4600919_+	helix-turn-helix domain-containing protein	NA	A0A288WG81	Bacillus_phage	97.2	1.2e-30
WP_044798107.1|4600962_4601580_-	replication-relaxation family protein	NA	Q2LIA9	Bacillus_phage	93.7	4.7e-107
WP_044798108.1|4601521_4602703_-	cell division protein FtsK	NA	Q3HKZ7	Bacillus_phage	95.2	6.2e-217
WP_044798109.1|4602820_4603003_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	96.7	9.4e-24
WP_044798110.1|4603005_4603308_-	hypothetical protein	NA	A0A288WG38	Bacillus_phage	92.9	2.4e-48
WP_044798111.1|4603467_4603665_+	helix-turn-helix domain-containing protein	NA	A0A288WG74	Bacillus_phage	96.9	8.3e-26
WP_044798112.1|4603670_4604255_+	type IV secretory system conjugative DNA transfer family protein	NA	A0A288WFT6	Bacillus_phage	95.4	3.5e-104
WP_044798113.1|4604322_4604652_+	hypothetical protein	NA	A0A288WGQ4	Bacillus_phage	95.4	6.6e-52
WP_044798114.1|4604690_4605746_-	N-acetylmuramoyl-L-alanine amidase	NA	D3WK93	Bacillus_phage	95.2	1.9e-193
WP_044798115.1|4605742_4605982_-	hypothetical protein	NA	A0A288WFV1	Bacillus_phage	94.9	1.2e-31
WP_044798117.1|4605981_4606218_-	hemolysin XhlA family protein	NA	A0A288WG97	Bacillus_phage	97.8	1.4e-16
WP_044798118.1|4606256_4610321_-|tail	tail fiber domain-containing protein	tail	W8CYT7	Bacillus_phage	90.4	0.0e+00
WP_080893257.1|4610317_4611799_-|tail	phage tail family protein	tail	H0USX4	Bacillus_phage	93.3	2.6e-281
WP_044798119.1|4611813_4615665_-|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	96.5	0.0e+00
WP_175581933.1|4615681_4615858_-	hypothetical protein	NA	A0A288WGC4	Bacillus_phage	96.6	1.3e-25
WP_044798120.1|4615887_4616205_-	hypothetical protein	NA	A0A288WGA9	Bacillus_phage	97.1	4.9e-52
WP_044798121.1|4616252_4616861_-|tail	tail protein	tail	A0A288WG55	Bacillus_phage	98.5	8.1e-104
WP_044798123.1|4616861_4617221_-	DUF3168 domain-containing protein	NA	Q2I8F3	Bacillus_phage	95.8	3.2e-60
WP_044798124.1|4617217_4617658_-	HK97 gp10 family phage protein	NA	A0A288WGB7	Bacillus_phage	100.0	4.2e-78
WP_044798125.1|4617650_4617974_-|head	phage head closure protein	head	Q2I8F5	Bacillus_phage	97.2	2.2e-55
WP_044798126.1|4617970_4618261_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A288WGQ6	Bacillus_phage	96.9	1.1e-45
WP_044798128.1|4618278_4619448_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	92.6	1.6e-196
WP_044798129.1|4619486_4620107_-|head,protease	HK97 family phage prohead protease	head,protease	Q2I8F8	Bacillus_phage	98.1	1.2e-110
WP_079245635.1|4620069_4621368_-|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	98.4	3.2e-243
WP_044798130.1|4621383_4623081_-|terminase	terminase large subunit	terminase	A0A288WFW5	Bacillus_phage	98.8	0.0e+00
WP_044798131.1|4623077_4623563_-|terminase	phage terminase small subunit P27 family	terminase	Q2I8G1	Bacillus_phage	96.9	6.5e-80
WP_044798132.1|4623663_4624047_-	HNH endonuclease	NA	Q2I8B2	Bacillus_phage	97.6	2.6e-68
WP_044798237.1|4624106_4624382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798133.1|4624591_4624801_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	67.2	1.3e-16
WP_153599616.1|4624813_4624954_-	hypothetical protein	NA	A0A288WG60	Bacillus_phage	78.3	4.5e-18
WP_044798134.1|4624968_4625223_-	hypothetical protein	NA	A0A288WG25	Bacillus_phage	92.9	1.0e-39
WP_080893259.1|4625227_4625449_-	hypothetical protein	NA	Q2LI85	Bacillus_phage	93.2	5.6e-31
WP_044798239.1|4625455_4625680_-	hypothetical protein	NA	Q3HKX2	Bacillus_phage	86.5	1.7e-27
WP_044798135.1|4625799_4626195_-	sigma-70 family RNA polymerase sigma factor	NA	A0A288WFT8	Bacillus_phage	96.2	1.8e-64
WP_127057652.1|4626369_4626492_-	DUF3983 domain-containing protein	NA	A0A288WG42	Bacillus_phage	87.5	7.2e-12
WP_044798136.1|4626645_4626834_-	hypothetical protein	NA	Q3HKX5	Bacillus_phage	87.1	1.5e-21
WP_000539655.1|4626982_4627150_-	hypothetical protein	NA	A0A0M4RER6	Bacillus_phage	87.3	2.0e-20
WP_153599617.1|4627211_4627370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798137.1|4627409_4627709_-	hypothetical protein	NA	A0A0M4REQ3	Bacillus_phage	80.8	2.0e-39
WP_044798138.1|4627871_4628384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798140.1|4628692_4629235_-	dUTP diphosphatase	NA	A0A288WGA4	Bacillus_phage	95.0	1.9e-96
WP_044798142.1|4629291_4629768_-	hypothetical protein	NA	A0A288WFT9	Bacillus_phage	95.6	2.1e-91
WP_044798143.1|4629764_4630511_-	sigma-70 family RNA polymerase sigma factor	NA	Q2I8C6	Bacillus_phage	95.2	1.5e-128
WP_044798144.1|4630503_4630737_-	hypothetical protein	NA	A0A288WG45	Bacillus_phage	87.0	1.7e-30
WP_044798145.1|4630755_4631667_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	96.7	5.9e-167
WP_044798146.1|4631682_4632600_-	phage protein	NA	Q2I8C9	Bacillus_phage	96.7	2.9e-145
WP_044798147.1|4632727_4633378_-	hypothetical protein	NA	A0A288WGQ2	Bacillus_phage	93.5	1.3e-115
WP_044798148.1|4633384_4633762_-	hypothetical protein	NA	A0A288WG31	Bacillus_phage	96.8	4.8e-62
WP_175581935.1|4633789_4634497_-	ORF6C domain-containing protein	NA	A0A288WG93	Bacillus_phage	98.3	3.4e-130
WP_175581934.1|4634553_4634709_-	hypothetical protein	NA	Q2I8D2	Bacillus_phage	98.0	3.3e-22
WP_175581929.1|4634782_4634938_-	hypothetical protein	NA	A0A288WFR7	Bacillus_phage	92.2	1.3e-18
WP_044798152.1|4635034_4635262_-	helix-turn-helix transcriptional regulator	NA	A0A288WG89	Bacillus_phage	100.0	2.7e-36
WP_103572836.1|4635423_4635783_+	helix-turn-helix transcriptional regulator	NA	A0A288WFW4	Bacillus_phage	99.2	6.8e-58
WP_080893263.1|4636115_4637402_-	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	98.1	1.4e-241
WP_044798153.1|4637508_4637676_-	helix-turn-helix transcriptional regulator	NA	A0A290GJH9	Caldibacillus_phage	84.6	1.2e-14
>prophage 10
NZ_CP010577	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 chromosome, complete genome	5652292	4670355	4678043	5652292		Staphylococcus_phage(16.67%)	10	NA	NA
WP_000221121.1|4670355_4671279_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	2.6e-45
WP_000247674.1|4671404_4672340_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.4e-24
WP_000018046.1|4672341_4673034_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	26.9	6.8e-06
WP_001293576.1|4673204_4673378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014310.1|4673378_4673573_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255945.1|4673612_4674812_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	6.1e-71
WP_000587818.1|4675106_4675430_+	heme oxygenase	NA	NA	NA	NA	NA
WP_002162479.1|4675502_4676267_-	class B sortase	NA	NA	NA	NA	NA
WP_000403765.1|4676299_4677070_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	1.7e-13
WP_042595928.1|4677059_4678043_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.4	1.4e-17
>prophage 11
NZ_CP010577	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 chromosome, complete genome	5652292	5175493	5269748	5652292	tail,head,portal,terminase,tRNA,integrase,capsid,holin,protease	Bacillus_phage(83.61%)	102	5261319:5261369	5269977:5270027
WP_001021089.1|5175493_5176756_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	1.5e-88
WP_042596460.1|5177125_5178043_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000573651.1|5178426_5178822_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_000455073.1|5179018_5180521_-	DUF4077 domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.8	3.5e-07
WP_000714043.1|5180553_5181612_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000639338.1|5181957_5182362_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000568577.1|5182358_5182715_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000980956.1|5182744_5182984_-	DUF3947 family protein	NA	NA	NA	NA	NA
WP_000086300.1|5183063_5183297_-	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_001293768.1|5183456_5184650_-	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	32.6	3.2e-43
WP_042596467.1|5184655_5186203_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.3	4.0e-46
WP_001071085.1|5186639_5187155_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001222628.1|5187440_5187917_+	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_000834707.1|5187965_5188370_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_042596469.1|5189854_5190412_+	cysteine hydrolase	NA	A0A1V0SL12	Klosneuvirus	27.5	1.2e-05
WP_002083675.1|5190448_5190883_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_042596471.1|5191239_5192205_+	DUF4822 domain-containing protein	NA	NA	NA	NA	NA
WP_002008929.1|5192468_5192900_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000926482.1|5193067_5193649_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_042598534.1|5193704_5194154_+	cyanase	NA	NA	NA	NA	NA
WP_042596474.1|5194281_5195562_+	purine/pyrimidine permease	NA	NA	NA	NA	NA
WP_000576735.1|5195596_5197135_-	anthrolysin O/cereolysin O family cholesterol-dependent cytolysin	NA	NA	NA	NA	NA
WP_000590056.1|5197569_5198322_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000631243.1|5198318_5199383_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000041823.1|5199379_5200396_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	36.8	1.0e-58
WP_016078161.1|5200415_5201435_-	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042596480.1|5201820_5202498_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001123920.1|5203379_5203847_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_044798170.1|5204218_5206657_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
WP_042596484.1|5207149_5208226_+	hypothetical protein	NA	A0A0S2MVF4	Bacillus_phage	38.8	7.6e-12
WP_042596487.1|5208242_5208851_-	replication-relaxation family protein	NA	W8CZ47	Bacillus_phage	100.0	3.3e-113
WP_042596489.1|5208840_5210007_-	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	100.0	8.0e-225
WP_042596490.1|5210017_5210338_-	hypothetical protein	NA	W8CYN5	Bacillus_phage	100.0	7.1e-51
WP_127057661.1|5210357_5210489_-	hypothetical protein	NA	W8CYT8	Bacillus_phage	100.0	6.9e-21
WP_000264500.1|5210812_5211037_+	hypothetical protein	NA	A0A1B1P883	Bacillus_phage	74.3	1.3e-27
WP_042596492.1|5211984_5212686_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	92.8	1.6e-124
WP_042596494.1|5212685_5213111_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	97.9	1.4e-70
WP_042596496.1|5213185_5213410_-	hemolysin XhlA family protein	NA	A0A1B1P780	Bacillus_phage	94.6	1.4e-29
WP_042596497.1|5213533_5217595_-|tail	tail fiber domain-containing protein	tail	W8CYT7	Bacillus_phage	100.0	0.0e+00
WP_044798171.1|5217591_5219076_-|tail	phage tail family protein	tail	W8CYY9	Bacillus_phage	100.0	4.9e-296
WP_042596501.1|5219087_5223011_-|tail	phage tail tape measure protein	tail	W8CZ45	Bacillus_phage	100.0	0.0e+00
WP_000344049.1|5223025_5223202_-	hypothetical protein	NA	W8CYG0	Bacillus_phage	100.0	6.7e-27
WP_042596503.1|5223231_5223549_-	hypothetical protein	NA	W8CYN3	Bacillus_phage	100.0	1.2e-53
WP_000896770.1|5223595_5224204_-|tail	tail protein	tail	W8CYT6	Bacillus_phage	100.0	5.8e-102
WP_030022312.1|5224204_5224564_-	DUF3168 domain-containing protein	NA	W8CYY6	Bacillus_phage	100.0	5.9e-62
WP_044798172.1|5224560_5224995_-	HK97 gp10 family phage protein	NA	W8CZ44	Bacillus_phage	100.0	1.0e-76
WP_044798173.1|5224987_5225311_-|head	phage head closure protein	head	W8CYF9	Bacillus_phage	99.1	3.3e-56
WP_044798174.1|5225297_5225585_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	97.9	8.9e-45
WP_044798175.1|5225605_5226772_-|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	100.0	5.6e-210
WP_086405676.1|5226809_5227520_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	99.6	1.5e-128
WP_042596516.1|5227506_5228760_-|portal	phage portal protein	portal	H0USW4	Bacillus_phage	99.3	3.8e-241
WP_042596518.1|5228948_5230643_-|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	100.0	0.0e+00
WP_000233388.1|5230644_5231148_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	100.0	8.0e-89
WP_044798176.1|5231256_5231655_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	96.8	2.3e-67
WP_042597896.1|5231644_5231899_-	hypothetical protein	NA	W8CYT4	Bacillus_phage	100.0	1.5e-43
WP_000773601.1|5232033_5232246_-	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_044798177.1|5232262_5232502_-	hypothetical protein	NA	W8CZ42	Bacillus_phage	100.0	8.3e-20
WP_044798178.1|5232518_5232716_-	hypothetical protein	NA	W8CYF7	Bacillus_phage	100.0	9.8e-27
WP_044798179.1|5232761_5232989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017440.1|5233025_5233313_-	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_002179614.1|5233715_5233961_-	hypothetical protein	NA	W8CYG8	Bacillus_phage	100.0	6.9e-38
WP_042596530.1|5234167_5234710_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	100.0	8.6e-97
WP_042596531.1|5234706_5235192_-	ArpU family transcriptional regulator	NA	W8CYU4	Bacillus_phage	100.0	1.0e-85
WP_000866514.1|5235219_5235384_-	hypothetical protein	NA	W8CYZ7	Bacillus_phage	100.0	5.0e-16
WP_000965619.1|5235549_5235831_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000404183.1|5237248_5237647_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	100.0	1.7e-70
WP_042596535.1|5238000_5238300_-	hypothetical protein	NA	W8CZ51	Bacillus_phage	100.0	7.9e-52
WP_000705116.1|5238450_5238750_+	hypothetical protein	NA	W8CYG6	Bacillus_phage	100.0	1.1e-50
WP_042596537.1|5238746_5238962_-	aspartate ammonia-lyase	NA	W8CYN9	Bacillus_phage	100.0	1.1e-36
WP_000817807.1|5238979_5239144_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_000436950.1|5239215_5239482_-	hypothetical protein	NA	W8CYZ5	Bacillus_phage	100.0	2.7e-43
WP_000705175.1|5239523_5240336_-	ATP-binding protein	NA	W8CZ50	Bacillus_phage	100.0	1.6e-155
WP_042596539.1|5240298_5241315_-	hypothetical protein	NA	W8CYG5	Bacillus_phage	100.0	3.8e-191
WP_042596541.1|5241560_5242208_-	sigma-70 family RNA polymerase sigma factor	NA	W8CYN8	Bacillus_phage	100.0	2.3e-117
WP_042596543.1|5242482_5242797_-	hypothetical protein	NA	W8CYU1	Bacillus_phage	100.0	9.8e-53
WP_042596545.1|5242960_5243785_-	ORF6C domain-containing protein	NA	A0A0S2MV65	Bacillus_phage	77.0	1.9e-116
WP_042596547.1|5244002_5244191_-	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	100.0	2.5e-27
WP_000813894.1|5244223_5244460_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	100.0	4.3e-37
WP_000511081.1|5244608_5244953_+	helix-turn-helix transcriptional regulator	NA	W8CZ48	Bacillus_phage	100.0	1.9e-57
WP_042596549.1|5245353_5246592_-	hypothetical protein	NA	W8CYT9	Bacillus_phage	100.0	3.1e-235
WP_042596551.1|5247575_5248637_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	75.9	5.9e-158
WP_000761986.1|5248698_5249439_-	carboxylesterase	NA	NA	NA	NA	NA
WP_042596553.1|5249600_5249834_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000078304.1|5249928_5250621_-	LrgB family protein	NA	NA	NA	NA	NA
WP_000673222.1|5250617_5250986_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_001125040.1|5251338_5252289_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000103951.1|5252339_5253635_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	1.1e-182
WP_001231141.1|5253665_5255195_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001231042.1|5255191_5255947_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001036332.1|5255979_5257164_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000161234.1|5257301_5258306_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001258185.1|5258332_5259361_-	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000869737.1|5259497_5259743_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_000647951.1|5259752_5261060_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
5261319:5261369	attL	ACGCGCCCAGAGGGATTCGAACCCCCGGCAGACGTGGTACCGGAAACCACC	NA	NA	NA	NA
WP_044798180.1|5261709_5262192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798181.1|5263618_5263978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798182.1|5263996_5264602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798184.1|5264623_5265019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798185.1|5265018_5265285_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044798186.1|5267397_5267601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798188.1|5267712_5267985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798191.1|5268767_5269748_-|integrase	tyrosine-type recombinase/integrase	integrase	A7XX23	Thermus_virus	25.9	1.9e-09
5269977:5270027	attR	ACGCGCCCAGAGGGATTCGAACCCCCGGCAGACGTGGTACCGGAAACCACC	NA	NA	NA	NA
>prophage 1
NZ_CP010578	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB232, complete sequence	232994	168487	230111	232994	transposase,integrase	Bacillus_phage(30.0%)	58	203972:203987	215768:215783
WP_044798413.1|168487_169201_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000817909.1|170067_170703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175581942.1|170753_171332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798415.1|171351_171936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798416.1|172061_172445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016078686.1|172461_173100_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	35.1	4.8e-22
WP_044798417.1|173685_174405_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_044798418.1|174859_177523_+	type IA DNA topoisomerase	NA	A0A1V0SIB2	Klosneuvirus	20.1	1.4e-11
WP_044798419.1|177682_178213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044798420.1|178235_178883_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_001014125.1|178915_179116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016078682.1|179191_179479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044798421.1|179502_180258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044798422.1|180291_180726_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_044798423.1|180811_181105_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044798424.1|181627_182041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044798425.1|182650_182836_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_175581941.1|182977_183118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798426.1|183114_184209_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	48.8	5.6e-95
WP_044798427.1|184445_184895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044798428.1|184925_185246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044798429.1|185963_186983_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_044798430.1|187722_188169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798431.1|189246_189594_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	56.9	2.0e-27
WP_044798432.1|189669_190512_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_044798434.1|193245_194070_+	ADP-ribosyltransferase	NA	A0A1V0E017	Clostridioides_phage	29.4	1.7e-16
WP_086405554.1|194420_196142_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.1	2.1e-11
WP_044798436.1|197069_198416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044798437.1|199382_200198_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_127057735.1|200262_200454_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_127057734.1|200512_200599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052574936.1|200974_201256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080893310.1|202012_205012_+	hypothetical protein	NA	A0A1V0E026	Clostridioides_phage	31.4	8.1e-88
203972:203987	attL	ACAGGGAAAAATCAAT	NA	NA	NA	NA
WP_175581936.1|206303_206441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052574937.1|206572_208069_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000275580.1|208722_210018_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|210007_210760_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_044798439.1|211533_212046_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044798440.1|212067_212418_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_044798442.1|212649_213693_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.4	5.3e-10
WP_044798443.1|213905_214232_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	50.0	7.1e-22
WP_000734602.1|214563_214719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798444.1|214715_215939_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	62.4	2.8e-143
215768:215783	attR	ATTGATTTTTCCCTGT	NA	NA	NA	NA
WP_044798445.1|216146_217790_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016078649.1|218179_219271_-	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	38.6	1.8e-21
WP_044798446.1|219267_219678_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_044798448.1|220431_221643_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	35.9	6.4e-68
WP_044798449.1|221781_223161_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_044798450.1|223309_223720_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_044798451.1|224263_224542_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	3.0e-13
WP_002083794.1|224879_225074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043956.1|225292_225565_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	68.9	7.5e-25
WP_044798452.1|226034_227300_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.6	3.8e-103
WP_016078646.1|227296_227638_+	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	37.5	6.1e-08
WP_044798453.1|227686_228061_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	52.5	1.1e-29
WP_000417392.1|228281_228533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798454.1|228585_228825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016078644.1|229037_230111_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	44.2	1.0e-77
>prophage 1
NZ_CP010581	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB68, complete sequence	68444	0	1971	68444	transposase	Lactococcus_phage(100.0%)	1	NA	NA
WP_000275580.1|675_1971_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
>prophage 2
NZ_CP010581	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB68, complete sequence	68444	9170	9428	68444		Bacillus_phage(100.0%)	1	NA	NA
WP_044798560.1|9170_9428_+	hypothetical protein	NA	A0A1B1P771	Bacillus_phage	94.3	2.1e-21
>prophage 3
NZ_CP010581	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB68, complete sequence	68444	23980	25474	68444		Clostridium_phage(100.0%)	1	NA	NA
WP_044798574.1|23980_25474_+	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	29.6	1.4e-24
>prophage 4
NZ_CP010581	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB68, complete sequence	68444	47541	48468	68444	integrase	Brevibacillus_phage(100.0%)	1	46655:46669	52530:52544
46655:46669	attL	TCAAAAATATATATT	NA	NA	NA	NA
WP_044798598.1|47541_48468_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	34.2	2.2e-36
WP_044798598.1|47541_48468_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	34.2	2.2e-36
52530:52544	attR	TCAAAAATATATATT	NA	NA	NA	NA
>prophage 5
NZ_CP010581	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB68, complete sequence	68444	57097	58204	68444		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_044798604.1|57097_58204_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	48.3	1.9e-90
>prophage 6
NZ_CP010581	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB68, complete sequence	68444	63065	67720	68444	transposase,integrase	Bacillus_phage(100.0%)	4	56778:56792	67275:67289
56778:56792	attL	GAGCAATTGGAGAAT	NA	NA	NA	NA
WP_024086119.1|63065_63329_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A125RQ76	Bacillus_phage	100.0	3.4e-43
WP_024086118.1|63297_63555_-	hypothetical protein	NA	A0A125RQ77	Bacillus_phage	100.0	1.4e-41
WP_024086117.1|63710_64631_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	100.0	3.6e-172
WP_044797901.1|64702_67720_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	99.9	0.0e+00
67275:67289	attR	GAGCAATTGGAGAAT	NA	NA	NA	NA
>prophage 1
NZ_CP010579	Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB92, complete sequence	92619	8138	84811	92619	transposase,integrase	Bacillus_phage(33.33%)	51	22160:22177	72079:72096
WP_044798485.1|8138_8852_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_044798405.1|12230_12458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798486.1|12473_13565_-	methyltransferase	NA	NA	NA	NA	NA
WP_175581940.1|13667_13805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798410.1|13826_14240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798403.1|15190_16993_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_044798473.1|17218_18817_-	S-layer homology domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	57.5	2.7e-45
WP_000282327.1|19434_20628_-	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
22160:22177	attL	TTATATTTTTTAAAAAAT	NA	NA	NA	NA
WP_000440576.1|22898_24626_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044798401.1|24953_26087_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D9J0Y9	Brochothrix_phage	73.8	1.3e-160
WP_044798487.1|27199_28909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044798488.1|30136_31108_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	31.4	1.6e-37
WP_016078900.1|31138_31534_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WJ60	Clostridium_phage	38.1	6.0e-07
WP_044798489.1|31735_32245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000914670.1|32967_34380_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_044798491.1|35884_36298_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000282360.1|36284_36671_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_042596280.1|36692_37064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798323.1|38993_40973_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.4	3.1e-27
WP_052574930.1|41714_42233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798324.1|42248_42764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798325.1|42807_43173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798326.1|43247_43517_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_044798327.1|43513_43897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757467.1|44058_44634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798328.1|45679_47503_-	maturase	NA	A0A0U4J920	Pseudomonas_phage	34.3	3.8e-24
WP_044798329.1|49376_53396_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_044798330.1|53426_55535_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_044798331.1|55537_56452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021728120.1|56452_56803_-	PrgI family protein	NA	NA	NA	NA	NA
WP_044798332.1|56869_57289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798333.1|57402_57591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000869334.1|57647_57851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502626.1|57964_58234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001098031.1|58323_59259_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_044798334.1|59370_60684_-	DUF3854 domain-containing protein	NA	NA	NA	NA	NA
WP_052574931.1|60673_60883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000784045.1|62946_63498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798492.1|63551_64262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798336.1|64686_65406_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044798338.1|66276_67047_-	ANT(4')-I family aminoglycoside nucleotidyltransferase	NA	NA	NA	NA	NA
WP_044798340.1|69700_70870_+	MFS transporter	NA	NA	NA	NA	NA
WP_044798339.1|70948_71812_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
WP_044798338.1|75967_76738_+	ANT(4')-I family aminoglycoside nucleotidyltransferase	NA	NA	NA	NA	NA
72079:72096	attR	TTATATTTTTTAAAAAAT	NA	NA	NA	NA
WP_044798336.1|77608_78328_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044798410.1|78709_79123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175581940.1|79144_79282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044798486.1|79384_80476_+	methyltransferase	NA	NA	NA	NA	NA
WP_044798405.1|80491_80719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044798493.1|80790_84081_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_044798485.1|84097_84811_+|transposase	transposase	transposase	NA	NA	NA	NA
