The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010876	Escherichia coli strain MNCRE44 chromosome, complete genome	5010884	926085	1035876	5010884	plate,terminase,tail,capsid,portal,head,transposase,integrase,tRNA,holin,protease	Enterobacteria_phage(43.16%)	130	1021474:1021489	1040795:1040810
WP_000520781.1|926085_926406_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|926436_928713_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|929397_929616_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|929900_930605_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|930646_932368_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|932368_934135_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|934257_935223_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|935766_936261_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|936395_940502_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|940660_941272_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|941282_942626_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|942716_944009_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078916.1|944314_944455_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|944646_944907_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|944947_946057_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|946214_947399_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|947398_947911_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|947966_948341_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|948349_948505_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|948491_951299_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000979945.1|951311_951800_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|951828_952428_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_032142265.1|952646_953204_+	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
WP_001554335.1|953767_954295_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_032140708.1|954296_956519_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	3.8e-183
WP_000071703.1|956521_957052_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|957044_957941_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_001067543.1|957944_958274_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	8.4e-55
WP_001295912.1|958291_958858_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	6.6e-100
WP_000356366.1|958869_959505_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|959497_959965_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|959988_961866_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|962004_962400_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|962396_962789_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|962785_963109_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|963111_963312_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|963311_963806_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|963907_964708_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|964753_965806_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|965829_966666_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|966820_968572_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|968571_969618_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|969632_970157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|970880_971378_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|971417_972260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|972343_972658_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|972662_973622_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|973698_976521_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|976527_976893_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_023142408.1|976889_977507_-	ash family protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000104290.1|977518_977818_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|977814_978081_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|978077_978281_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|978304_978715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|978808_978922_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|978918_979161_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|979172_979451_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|979461_979812_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|979949_980141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|980147_980570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|980574_981096_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|981200_981542_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|981611_982604_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|982903_985348_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|985358_985976_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|985977_986841_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|986876_987503_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|987816_988965_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|989061_989802_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|989993_992276_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|992330_993188_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|993593_995354_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|995483_996176_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|996374_997463_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|997533_998817_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|999072_999645_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_063269479.1|999704_1000229_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
WP_000072165.1|1000228_1000843_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|1000849_1001311_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_023363137.1|1001321_1002569_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
WP_000138756.1|1002571_1003150_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|1003142_1004246_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|1004236_1004584_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|1004638_1005235_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|1005231_1006386_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000478224.1|1006373_1006586_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|1006585_1007470_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|1007469_1010421_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|1010496_1010655_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|1010578_1010914_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|1011011_1011293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162832341.1|1011295_1011820_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000729834.1|1011816_1013244_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000666499.1|1013233_1013485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|1013484_1013949_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|1013948_1014395_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|1014396_1014735_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|1014744_1015698_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|1015712_1016828_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|1017042_1017501_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|1017503_1018325_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|1018305_1019802_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_169542415.1|1019801_1021343_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.3e-185
WP_000124060.1|1021393_1021939_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
1021474:1021489	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|1021938_1022250_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|1022249_1022576_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|1022572_1023223_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|1023206_1023947_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|1023949_1024300_-|holin	putative holin	holin	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|1024430_1025159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295927.1|1025134_1025536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|1025537_1025753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|1025943_1026708_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|1026824_1027181_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|1027274_1027463_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|1027515_1027824_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|1027834_1028755_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|1028754_1029072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|1029087_1030857_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|1030867_1032034_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|1032036_1032306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|1032333_1032864_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|1033152_1033425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|1033434_1033731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|1033745_1033961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|1033957_1034641_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|1034637_1034868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|1034857_1035064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|1035065_1035515_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|1035486_1035876_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
1040795:1040810	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 2
NZ_CP010876	Escherichia coli strain MNCRE44 chromosome, complete genome	5010884	1247202	1313011	5010884	tail,capsid,lysis,portal,head,transposase,integrase,tRNA,holin,terminase	Enterobacteria_phage(53.7%)	83	1239838:1239853	1300706:1300721
1239838:1239853	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
WP_001295972.1|1247202_1248309_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1248362_1248824_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|1248833_1249487_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1249658_1250909_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1251022_1252165_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1252154_1252391_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1252530_1252770_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1252753_1253080_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1253079_1253301_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|1253399_1253681_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|1253691_1253883_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1253855_1254038_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1254034_1254715_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1254711_1255497_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|1255502_1255799_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|1255874_1256081_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|1256676_1257366_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|1257470_1257701_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|1257770_1258310_+	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000147894.1|1258306_1259326_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
WP_000788794.1|1259322_1260024_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|1260273_1264539_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|1264575_1265619_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|1265968_1266070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|1266066_1266522_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|1266521_1266692_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|1266684_1266975_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|1266971_1267334_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|1267330_1267471_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|1267467_1268157_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|1268478_1268784_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|1268770_1269247_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|1269463_1269646_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1269736_1270030_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1270510_1270837_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1271043_1271226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|1271789_1272335_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|1272309_1274235_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198149.1|1274231_1274438_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|1274434_1276036_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|1276016_1277336_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|1277345_1277678_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|1277733_1278759_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|1278800_1279199_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|1279210_1279564_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|1279575_1280154_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|1280150_1280546_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|1280553_1281294_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|1281309_1281732_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|1281713_1282148_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|1282140_1284702_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|1284698_1285028_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|1285027_1285726_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|1285730_1286474_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|1286410_1287013_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|1287073_1290556_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|1290614_1292636_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|1292632_1292911_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000355360.1|1292923_1293217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968127.1|1293308_1294166_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101732.1|1294162_1295020_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983716.1|1295016_1295844_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	29.0	1.9e-07
WP_000555630.1|1295843_1296758_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001304451.1|1297456_1298215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539892.1|1298686_1298839_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_023146274.1|1298922_1299048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373104.1|1299100_1299505_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332288.1|1299725_1300457_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	2.1e-53
WP_001311624.1|1300661_1301873_-	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
1300706:1300721	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
WP_000554153.1|1302186_1302423_+	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_000858012.1|1302465_1302738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000888771.1|1302766_1303033_+	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_001531618.1|1303922_1304171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001065862.1|1305493_1305712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167734.1|1305794_1305947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000979977.1|1307674_1308010_-	YmgD family protein	NA	NA	NA	NA	NA
WP_001304448.1|1308013_1308298_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000120100.1|1308359_1308533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001131456.1|1308778_1308898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185665.1|1309640_1309907_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000101055.1|1309910_1310723_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001295990.1|1310746_1311442_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_085949154.1|1311863_1313011_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
>prophage 3
NZ_CP010876	Escherichia coli strain MNCRE44 chromosome, complete genome	5010884	1436216	1505780	5010884	protease,tail,capsid,portal,head,integrase,holin,terminase	Stx2-converting_phage(26.42%)	75	1432391:1432405	1438300:1438314
1432391:1432405	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|1436216_1437347_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1437324_1437573_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|1437637_1440109_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
1438300:1438314	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|1440201_1440393_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|1440389_1440578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|1441143_1441362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1441521_1441677_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|1441949_1442666_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|1442715_1442931_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|1442927_1443353_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|1443375_1444338_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|1444344_1445091_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|1445112_1445883_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|1445898_1446324_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|1446498_1447164_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|1447344_1447557_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|1447724_1447997_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|1447998_1449054_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|1449054_1449435_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|1449431_1450253_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|1450479_1450677_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|1450828_1451878_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|1452679_1452811_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|1453091_1453427_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|1453687_1455541_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|1455691_1455907_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|1455911_1456256_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|1456221_1456494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|1456599_1457133_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|1457687_1457774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1457995_1458181_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_033557025.1|1458177_1458270_+	endopeptidase	NA	Q9ZXB6	Enterobacteria_phage	89.3	2.3e-07
WP_000736382.1|1458266_1458482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|1458680_1458881_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|1458922_1459288_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|1459578_1460142_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|1460138_1461800_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|1461863_1463801_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|1463845_1464067_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|1464012_1466598_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|1466594_1466921_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1466930_1467281_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1467277_1467724_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1467720_1468065_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|1468131_1468848_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|1468862_1469237_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|1469332_1469542_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_193366003.1|1469589_1470072_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	97.5	2.6e-73
WP_193366004.1|1470107_1470740_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	77.3	2.2e-67
WP_000807937.1|1472817_1473159_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_158413865.1|1477287_1477446_+	hypothetical protein	NA	Q687E8	Enterobacteria_phage	96.4	1.1e-07
WP_000972097.1|1485092_1485626_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|1485656_1486184_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_001513292.1|1486199_1487168_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001421220.1|1487293_1487476_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|1487674_1488343_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1488399_1488669_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1488783_1488954_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001348267.1|1489080_1489638_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|1489634_1489910_-	ash family protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|1490285_1491092_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1491091_1492285_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|1492296_1493655_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|1493658_1495254_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|1495253_1496816_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1496907_1496952_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|1497089_1497971_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1497967_1498588_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|1498615_1500511_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1500723_1501599_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000622024.1|1501768_1502791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|1502800_1503109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|1503165_1503756_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|1503752_1504511_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|1504730_1505780_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NZ_CP010876	Escherichia coli strain MNCRE44 chromosome, complete genome	5010884	2002672	2087075	5010884	plate,tail,capsid,portal,transposase,integrase,tRNA,holin,terminase	Escherichia_phage(24.39%)	98	2042632:2042691	2087137:2087261
WP_001258676.1|2002672_2004445_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|2004754_2005321_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|2005317_2006136_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2006188_2006584_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2006624_2007368_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|2007364_2008336_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|2008371_2010801_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|2010825_2011926_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|2012313_2013060_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|2013073_2013640_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2013855_2015589_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|2015641_2016034_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|2016033_2018112_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|2018104_2019253_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|2019441_2020086_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2020096_2020486_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2020500_2021550_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|2021552_2022413_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|2022703_2024365_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2024509_2025013_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|2025033_2026998_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|2027002_2027929_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|2027925_2028813_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2028939_2029518_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2029520_2029871_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|2030650_2031079_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|2031085_2032510_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|2032484_2033285_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|2033451_2034438_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|2034452_2035967_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|2036036_2037026_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2037820_2038324_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2038401_2038653_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2038767_2038854_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|2039117_2039441_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|2039612_2040110_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2040147_2040387_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|2040577_2041789_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2041839_2042505_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2042632:2042691	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|2042976_2043396_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|2044610_2044835_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_001531768.1|2044996_2045386_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|2045421_2047062_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|2047170_2047452_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|2047464_2047977_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000117510.1|2047994_2049497_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|2049493_2049883_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|2049882_2051067_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|2051059_2051686_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|2051688_2052609_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|2052605_2052947_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|2052949_2053852_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|2053832_2054369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2054365_2055046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|2055077_2055458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|2055454_2055874_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|2055908_2056943_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|2057001_2057331_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|2057330_2058638_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|2058637_2060212_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|2060208_2060442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|2060441_2062304_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|2062290_2062857_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|2063225_2063471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|2063530_2063725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|2063732_2064212_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|2064211_2064484_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|2064483_2064867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|2064979_2065651_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|2065650_2065944_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|2065940_2066537_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|2066614_2066794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343765.1|2066856_2068077_-|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_000115885.1|2068095_2068614_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000847617.1|2068838_2069480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|2069723_2069957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2070355_2070844_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|2070853_2071459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|2071921_2072620_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|2073808_2074732_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_044343551.1|2074906_2075695_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000466605.1|2075967_2076189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661082.1|2076376_2076601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2076597_2076909_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|2076905_2077142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|2077143_2077554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|2077592_2079008_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|2078997_2079753_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|2079749_2079974_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|2080013_2080490_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|2080548_2080779_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|2080877_2081291_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|2082301_2082622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|2082652_2084869_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|2084865_2085435_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|2085434_2085617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|2085826_2086090_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|2086058_2087075_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2087137:2087261	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 5
NZ_CP010876	Escherichia coli strain MNCRE44 chromosome, complete genome	5010884	2231216	2237668	5010884	transposase	Acidithiobacillus_phage(16.67%)	9	NA	NA
WP_001298859.1|2231216_2232758_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2232772_2233519_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|2233967_2234378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|2234598_2235417_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|2235416_2235662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|2235755_2236229_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|2236244_2236721_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2236783_2237005_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|2237023_2237668_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
>prophage 6
NZ_CP010876	Escherichia coli strain MNCRE44 chromosome, complete genome	5010884	2268471	2274774	5010884		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|2268471_2269014_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|2269018_2269897_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|2269954_2270854_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|2270853_2271939_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|2272311_2273205_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|2273379_2274774_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 7
NZ_CP010876	Escherichia coli strain MNCRE44 chromosome, complete genome	5010884	2368950	2378395	5010884		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|2368950_2370087_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|2370083_2372087_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|2372211_2372673_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2372713_2373184_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2373230_2373950_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2373946_2375632_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|2375853_2376585_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|2376644_2376752_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|2376732_2377464_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|2377468_2378395_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 8
NZ_CP010876	Escherichia coli strain MNCRE44 chromosome, complete genome	5010884	2586147	2657053	5010884	protease,lysis,portal,head,holin,integrase,tRNA,coat,terminase	Enterobacteria_phage(56.92%)	93	2615995:2616015	2667504:2667524
WP_001283598.1|2586147_2586960_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2586959_2587973_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699128.1|2588038_2589175_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	8.5e-22
WP_000615816.1|2589273_2590269_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127789.1|2590265_2591444_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817178.1|2591708_2592929_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683761.1|2593087_2595094_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|2595214_2595493_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|2595526_2596075_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|2596074_2596884_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043795.1|2596883_2597708_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001296258.1|2597711_2598797_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001296259.1|2598831_2599764_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2599929_2600481_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001527383.1|2600540_2601365_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000054000.1|2601366_2601894_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000819140.1|2601890_2602370_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000679363.1|2602366_2602858_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000499462.1|2602874_2603627_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001296260.1|2603646_2606295_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000032632.1|2606375_2606942_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001195810.1|2607500_2607986_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425017.1|2608188_2610333_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|2610332_2611643_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2611823_2612108_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296262.1|2612479_2613820_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|2613881_2614637_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|2614930_2615863_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
2615995:2616015	attL	ATTCCTGCAGGGGACACCATT	NA	NA	NA	NA
WP_023156993.1|2616174_2617332_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.4e-221
WP_052808506.1|2617440_2619618_-	hypothetical protein	NA	A0A2D1GLP5	Escherichia_phage	71.7	5.6e-62
WP_001407254.1|2619720_2620008_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	64.2	7.9e-25
WP_001085227.1|2620022_2620244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021575671.1|2620243_2620972_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	66.4	3.4e-80
WP_044342074.1|2621059_2621782_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	91.3	2.6e-117
WP_024191015.1|2621771_2621945_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.3	4.3e-18
WP_032152582.1|2622068_2622320_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	68.6	2.1e-10
WP_001334102.1|2622387_2622756_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	98.4	2.9e-64
WP_044342076.1|2622780_2624619_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	74.9	1.4e-247
WP_044342077.1|2624618_2626034_-	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	80.0	2.4e-199
WP_044342079.1|2626043_2626736_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	97.4	6.4e-113
WP_000614042.1|2626738_2627194_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	5.2e-87
WP_044342082.1|2627193_2628147_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	80.1	5.0e-92
WP_044342083.1|2628146_2629565_-	packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	99.2	1.7e-274
WP_032216290.1|2629574_2630036_-|head	head DNA stabilization protein	head	A0A088CQ08	Enterobacteria_phage	100.0	1.9e-84
WP_001389518.1|2630016_2630205_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_044342088.1|2630246_2631500_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	97.1	1.0e-230
WP_044342089.1|2631518_2632412_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	86.5	9.7e-122
WP_044342091.1|2632502_2634701_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.5	0.0e+00
WP_000200761.1|2634702_2636118_-|terminase	PBSX family phage terminase large subunit	terminase	A0A088CQ06	Enterobacteria_phage	100.0	4.0e-279
WP_000113731.1|2636114_2636555_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807785.1|2636557_2636800_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_000999689.1|2636903_2637260_-	hypothetical protein	NA	Q716B1	Shigella_phage	75.4	2.7e-43
WP_000877024.1|2637447_2637978_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	95.5	3.4e-90
WP_001543881.1|2638183_2638336_-	hypothetical protein	NA	C6ZR68	Salmonella_phage	100.0	1.2e-21
WP_044342105.1|2638323_2638791_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	96.8	9.4e-76
WP_000229389.1|2638787_2639264_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|2639247_2639571_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_044342106.1|2640108_2640597_-	antiterminator	NA	M1FPN0	Enterobacteria_phage	98.8	1.7e-88
WP_000994516.1|2640593_2640782_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_044342107.1|2640778_2641141_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	96.7	7.3e-60
WP_044342108.1|2641141_2641666_-	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	44.0	2.5e-32
WP_044342110.1|2641662_2641953_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	99.0	8.4e-51
WP_001286917.1|2641945_2642158_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_096099000.1|2642150_2642321_-	ninF	NA	NA	NA	NA	NA
WP_044342114.1|2642680_2642866_-	protein ninF	NA	Q76H71	Enterobacteria_phage	84.4	1.4e-14
WP_001544373.1|2642858_2643218_-	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	74.2	3.4e-41
WP_001254220.1|2643220_2643397_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_044342121.1|2643393_2643834_-	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	97.9	1.1e-78
WP_044342123.1|2644047_2644374_-	hypothetical protein	NA	I6RSP8	Salmonella_phage	99.1	9.5e-59
WP_044342126.1|2644449_2645886_-	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	99.2	8.8e-274
WP_016042224.1|2645875_2646766_-	hypothetical protein	NA	G5DA89	Enterobacteria_phage	100.0	1.5e-159
WP_000166961.1|2646752_2646914_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_044342134.1|2646948_2647227_-	lambda phage CII family protein	NA	Q8VNP9	Enterobacteria_phage	98.9	3.1e-42
WP_001194218.1|2647346_2647562_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028392.1|2647665_2648298_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_044342143.1|2648294_2648699_+	hypothetical protein	NA	Q716D7	Shigella_phage	97.8	4.8e-68
WP_072256486.1|2648949_2649330_+	antitermination protein N	NA	A4KWR0	Enterobacteria_phage	100.0	3.1e-53
WP_042098811.1|2649338_2649662_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	97.2	7.2e-59
WP_000065354.1|2649842_2650211_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	1.0e-64
WP_044342151.1|2650245_2651214_+	cell envelope integrity/translocation protein TolA	NA	K7P7J7	Enterobacteria_phage	99.4	3.8e-55
WP_000638547.1|2651238_2651370_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243353.1|2651354_2651507_+	host cell division inhibitory peptide Kil	NA	K7P837	Enterobacteria_phage	100.0	4.7e-21
WP_000050554.1|2651582_2651753_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031367.1|2651763_2652369_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000951325.1|2652368_2652752_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
WP_044342165.1|2652775_2653069_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	97.9	9.4e-50
WP_000773124.1|2653088_2653370_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	9.7e-44
WP_001214453.1|2653366_2653534_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
WP_044342168.1|2654050_2654719_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.5	1.6e-52
WP_000022062.1|2654833_2655115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545735.1|2655203_2655371_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	1.3e-27
WP_001163428.1|2655428_2655629_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000926944.1|2655877_2657053_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	63.0	2.8e-145
2667504:2667524	attR	ATTCCTGCAGGGGACACCATT	NA	NA	NA	NA
>prophage 9
NZ_CP010876	Escherichia coli strain MNCRE44 chromosome, complete genome	5010884	2996232	3003372	5010884		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|2996232_2998794_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|2998899_2999556_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001296319.1|2999606_3000374_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|3000569_3001478_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|3001474_3002737_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|3002733_3003372_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 10
NZ_CP010876	Escherichia coli strain MNCRE44 chromosome, complete genome	5010884	3252641	3314731	5010884	lysis,transposase,integrase,tRNA,protease	Staphylococcus_phage(50.0%)	52	3253850:3253867	3314128:3314145
WP_001296354.1|3252641_3253400_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|3253829_3254750_-	agmatinase	NA	NA	NA	NA	NA
3253850:3253867	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|3254885_3255617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3255762_3257739_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3257747_3257879_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|3258014_3258230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3258533_3259688_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3260123_3261518_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|3261594_3262092_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3262186_3262894_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3262973_3263705_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|3263717_3264668_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3264776_3265340_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3265339_3265756_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|3265870_3266851_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3266868_3267573_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3267590_3268157_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|3268153_3268444_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|3268451_3269045_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|3269037_3270174_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|3270488_3271475_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|3271519_3272023_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|3272022_3273324_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|3273379_3274387_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|3274503_3275550_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3275725_3276445_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|3276465_3276606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|3276628_3276955_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3276954_3277674_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|3277834_3278887_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3278914_3279190_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3279254_3280334_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|3280535_3281792_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839781.1|3281840_3283976_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|3284368_3285076_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|3285454_3286720_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|3286975_3288019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|3289712_3290264_-	HTH-type transcriptional regulator PapX	NA	NA	NA	NA	NA
WP_000006213.1|3292755_3292989_+	major pilus subunit operon transcriptional regulator PapI	NA	NA	NA	NA	NA
WP_001513409.1|3294856_3294970_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|3296803_3297064_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|3297105_3297666_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|3297705_3298134_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|3298851_3300045_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|3300180_3301905_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|3301905_3302853_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|3302852_3304595_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|3304591_3305869_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|3305950_3308152_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_011076574.1|3308702_3308846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044342682.1|3309095_3312983_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.5e-227
WP_001254932.1|3313579_3314731_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3314128:3314145	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 11
NZ_CP010876	Escherichia coli strain MNCRE44 chromosome, complete genome	5010884	4367103	4441344	5010884	protease,plate,tail,capsid,lysis,portal,head,integrase,tRNA,holin,terminase	Escherichia_phage(45.65%)	88	4396176:4396222	4425365:4425411
WP_000560981.1|4367103_4367541_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4367585_4368527_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001385591.1|4368590_4369499_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897302.1|4369727_4370039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4370039_4370330_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001296612.1|4370688_4370967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251293.1|4371363_4371582_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_032140890.1|4371766_4372216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038650.1|4372531_4373380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068514.1|4373669_4373912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027696.1|4374093_4375023_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4375019_4375655_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331383.1|4375651_4376554_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077633686.1|4376566_4379617_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|4379810_4380644_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000749934.1|4381639_4383034_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000619499.1|4383074_4383389_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179746.1|4383398_4384223_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001296617.1|4384489_4385749_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144100.1|4385745_4387215_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217147.1|4387502_4388339_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|4388322_4389261_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063507.1|4389257_4390292_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001296619.1|4390576_4391197_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
WP_001166063.1|4391456_4392440_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270242.1|4392588_4393263_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4393433_4394807_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|4394803_4395502_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4395651_4396152_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4396176:4396222	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_006822081.1|4396338_4397319_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	99.7	8.0e-186
WP_016237179.1|4397388_4397682_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	99.0	1.0e-48
WP_001308179.1|4397818_4398091_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217681.1|4398260_4398761_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.0e-91
WP_000557703.1|4398824_4399049_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277897.1|4399048_4399351_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_001113163.1|4399350_4399575_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	5.0e-35
WP_000027664.1|4399571_4399847_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_016240308.1|4399836_4402113_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.2	0.0e+00
WP_016237182.1|4403195_4404230_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.2e-200
WP_000156861.1|4404229_4406002_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_016240309.1|4406175_4407030_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MK3	Enterobacteria_phage	100.0	1.1e-135
WP_016237184.1|4407088_4408162_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
WP_000203462.1|4408165_4408909_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
WP_000988633.1|4409008_4409518_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001668220.1|4409517_4409721_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|4409724_4410006_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|4410005_4410503_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_016237185.1|4410517_4410943_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	93.6	4.4e-56
WP_016237186.1|4410930_4411356_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	94.3	1.5e-64
WP_001300730.1|4411327_4411501_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917188.1|4411463_4411931_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.1e-81
WP_001001780.1|4411923_4412376_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_016240310.1|4412442_4413078_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.4e-111
WP_000127163.1|4413074_4413422_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121498.1|4413426_4414335_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	1.7e-161
WP_001285307.1|4414327_4414939_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.4e-116
WP_044343225.1|4414935_4416231_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.0	1.8e-177
WP_016240347.1|4416230_4416839_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	96.0	1.3e-106
WP_000978829.1|4416810_4417254_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	63.1	1.9e-46
WP_096976489.1|4417253_4417628_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	49.4	4.8e-14
WP_016237189.1|4417655_4417838_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.9	1.6e-10
WP_016240311.1|4417897_4419088_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	4.0e-224
WP_016240312.1|4419100_4419619_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	1.2e-92
WP_001031303.1|4419674_4419950_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4419982_4420102_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_016240313.1|4420094_4422542_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.5	0.0e+00
WP_000978916.1|4422556_4423036_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_016240314.1|4423035_4424199_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	6.3e-206
WP_021545831.1|4424281_4424500_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	98.6	1.0e-37
WP_000416606.1|4424640_4425282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076748.1|4425489_4426392_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4425365:4425411	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4426572_4427535_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758732.1|4427854_4428844_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001296622.1|4428950_4429706_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4429760_4430528_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802235.1|4430635_4431235_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155252.1|4431335_4431776_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4431987_4432287_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|4432313_4432742_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796342.1|4432746_4433493_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4433589_4434600_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136804.1|4434770_4436279_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4436301_4437147_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4437571_4437817_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4437901_4438387_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|4438479_4439406_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|4439472_4440804_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4440813_4441344_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 1
NZ_CP010881	Escherichia coli strain MNCRE44 plasmid pMNCRE44_5, complete sequence	116803	397	36874	116803	integrase,transposase	Escherichia_phage(26.32%)	34	3392:3405	23563:23576
WP_001568038.1|397_1369_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_020805749.1|1601_2033_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_022644881.1|2032_3304_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	1.6e-149
WP_022644882.1|3385_4360_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.0	9.4e-86
3392:3405	attL	ACTCAAATTTCTTT	NA	NA	NA	NA
WP_015632469.1|4359_5565_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_007372134.1|6346_6751_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_000612626.1|6747_7095_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_022644883.1|7143_8682_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
WP_012539983.1|8769_9525_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_032072094.1|10154_10268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408936.1|10396_10654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644886.1|10711_11497_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	1.9e-52
WP_022644887.1|11499_12138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072060.1|12186_12507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|13051_13282_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|13278_13695_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001348075.1|13768_14005_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|14051_14756_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|16652_17657_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|17838_18015_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|18344_19160_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|19220_20024_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|20023_20860_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000027057.1|21580_22441_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000722315.1|23140_23965_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
23563:23576	attR	ACTCAAATTTCTTT	NA	NA	NA	NA
WP_001206315.1|24024_24813_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_065187201.1|24882_25437_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|25670_26228_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_004152391.1|27342_29058_-	Tn3-like element Tn4401 family resolvase TnpR	NA	NA	NA	NA	NA
WP_004152392.1|29167_32197_+|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|32303_33329_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|33325_34105_+	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|34423_35305_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|35554_36874_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
>prophage 2
NZ_CP010881	Escherichia coli strain MNCRE44 plasmid pMNCRE44_5, complete sequence	116803	69548	105632	116803	integrase,transposase	Escherichia_phage(40.0%)	26	72113:72126	86051:86064
WP_000516402.1|69548_70211_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001549893.1|70591_71254_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_001549892.1|71340_71580_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001067855.1|71972_72677_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
72113:72126	attL	ATCCCAGCGTGGCG	NA	NA	NA	NA
WP_002904004.1|72813_73674_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|73694_74456_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|74717_75620_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004199413.1|76828_79846_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_004217980.1|80665_82084_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|82489_85519_+|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|85625_86651_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
86051:86064	attR	CGCCACGCTGGGAT	NA	NA	NA	NA
WP_004152394.1|86647_87427_+	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|87745_88627_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|88876_90196_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004196359.1|91107_91479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|91541_92462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196325.1|92515_93274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196314.1|93507_94806_+	nickel resistance membrane nickel efflux protein NirA	NA	NA	NA	NA	NA
WP_004196355.1|94911_95181_+	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196366.1|95193_96324_+	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_032072095.1|96485_96908_+	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196353.1|97163_98504_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_015065592.1|98592_100125_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_162859354.1|100558_102841_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_022644891.1|103046_104087_-	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_087439983.1|104256_105632_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
