The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010525	Bacillus coagulans strain HM-08 chromosome, complete genome	3624641	12631	20694	3624641	protease	Staphylococcus_phage(66.67%)	10	NA	NA
WP_017550665.1|12631_13255_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	38.5	3.6e-22
WP_014096615.1|13469_14381_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_013860891.1|14370_14571_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_014096616.1|14731_15832_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_142010213.1|16153_17275_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.0	2.9e-54
WP_035183081.1|17255_17903_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.8	2.6e-39
WP_035183084.1|17920_19114_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.8	2.1e-111
WP_014096620.1|19126_19597_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.9	2.2e-40
WP_014096621.1|19850_20138_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_014096622.1|20199_20694_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	67.7	2.8e-54
>prophage 2
NZ_CP010525	Bacillus coagulans strain HM-08 chromosome, complete genome	3624641	90734	155848	3624641	coat,tRNA,bacteriocin,transposase,holin,protease	Enterobacteria_phage(15.38%)	58	NA	NA
WP_043052461.1|90734_92255_-|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
WP_172653422.1|92399_93104_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_017552045.1|93530_95255_+	ubiquinone-dependent pyruvate dehydrogenase	NA	G8DDL3	Micromonas_pusilla_virus	23.4	1.1e-36
WP_014096666.1|95462_96743_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	3.9e-63
WP_014096667.1|97864_99367_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_035183142.1|99887_101120_-	peptidase T	NA	NA	NA	NA	NA
WP_035183143.1|101182_101977_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_035183145.1|102170_103520_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_035183146.1|103936_105115_+	ParM/StbA family protein	NA	A0A1B1P792	Bacillus_phage	35.3	5.5e-56
WP_014096674.1|105126_105699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183148.1|105760_106540_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.3	4.6e-11
WP_014096676.1|106802_107843_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	3.1e-34
WP_014096677.1|107832_108495_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014096678.1|108556_109399_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035183149.1|109634_111416_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	32.0	7.2e-68
WP_035183151.1|111390_112107_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_035183153.1|112237_114040_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014096682.1|114379_115453_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_014096683.1|115906_116656_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_014096684.1|116731_117178_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_014096933.1|117950_119312_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_035183159.1|120162_121176_-	DUF1646 family protein	NA	NA	NA	NA	NA
WP_035183161.1|121529_123377_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	27.0	1.3e-30
WP_014096689.1|123525_124467_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183163.1|124569_124947_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_026684575.1|124936_125620_+	LrgB family protein	NA	NA	NA	NA	NA
WP_164931356.1|125689_125836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183165.1|125943_126423_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_164931355.1|126499_126676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183167.1|127547_128414_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035183170.1|128669_129518_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183171.1|129644_130916_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_035183173.1|131018_133193_+	DNA helicase RecQ	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	37.4	1.0e-84
WP_035183175.1|133197_134064_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_014096699.1|134174_134858_-	bacillithiol biosynthesis deacetylase BshB2	NA	NA	NA	NA	NA
WP_013860797.1|134871_135219_-	YojF family protein	NA	NA	NA	NA	NA
WP_014096700.1|135338_136157_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_014096701.1|136522_137716_+	MFS transporter	NA	NA	NA	NA	NA
WP_157660066.1|138067_138742_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.6	1.9e-16
WP_035183181.1|138747_139392_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_013860793.1|139783_139951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080738159.1|139947_140634_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.8	3.3e-13
WP_013860791.1|141194_142820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017550351.1|142894_143122_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_017550349.1|143601_143874_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_026684561.1|143998_144346_-	general stress protein	NA	NA	NA	NA	NA
WP_026684560.1|144495_145182_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	45.1	3.4e-50
WP_014096710.1|145631_145889_+	YwdI family protein	NA	NA	NA	NA	NA
WP_014096711.1|146060_146432_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_014096712.1|146474_146921_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_014096713.1|147081_147837_-	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_035183186.1|148006_148978_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_035183189.1|149768_150602_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_014096716.1|151784_152495_-	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	50.0	4.1e-06
WP_014096717.1|152987_154304_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.7	5.1e-26
WP_014096718.1|154321_154840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071646869.1|154854_155070_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_026685123.1|155185_155848_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 3
NZ_CP010525	Bacillus coagulans strain HM-08 chromosome, complete genome	3624641	369379	377692	3624641		Synechococcus_phage(33.33%)	8	NA	NA
WP_017550741.1|369379_370675_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.8	6.5e-18
WP_026684440.1|370763_371474_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SS43	Cyanophage	42.8	7.4e-48
WP_026684441.1|371466_371721_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_026684442.1|371717_372401_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_026684443.1|372384_374634_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	44.1	7.8e-168
WP_026684444.1|374618_376043_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	4.6e-49
WP_026684445.1|376062_377106_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.6	8.6e-61
WP_026684446.1|377098_377692_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.3	6.4e-29
>prophage 4
NZ_CP010525	Bacillus coagulans strain HM-08 chromosome, complete genome	3624641	395416	447873	3624641	transposase,tRNA	Catovirus(20.0%)	40	NA	NA
WP_014096920.1|395416_395707_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_035183337.1|395719_397177_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_014096922.1|397189_398623_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_013860577.1|398725_398932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183339.1|399168_399555_-	general stress protein	NA	NA	NA	NA	NA
WP_014096925.1|401952_402753_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_014096926.1|403098_404013_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.6	3.9e-25
WP_035183348.1|404452_405910_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_014096928.1|406122_407496_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	49.0	6.5e-125
WP_014096929.1|408782_409805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013860569.1|410026_410533_-	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_017550765.1|410717_411254_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_014096932.1|411268_411472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013860568.1|411727_411952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013858393.1|415026_416250_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.5	3.7e-79
WP_014096937.1|416660_417101_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_014095824.1|417605_418916_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_014096939.1|419333_420134_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_014096940.1|420130_420952_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_014096941.1|420974_421652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013858128.1|421837_423148_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_014096943.1|423322_424942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014096944.1|425079_425478_+	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_014096945.1|425589_427275_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_014096946.1|427357_428062_+	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_014096947.1|428332_429163_-	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_014096948.1|429684_430458_-	acetoin reductase	NA	NA	NA	NA	NA
WP_035183368.1|430820_431984_-	MFS transporter	NA	NA	NA	NA	NA
WP_017551570.1|432152_433055_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017551571.1|433232_433607_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_017551572.1|434284_435070_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.4	2.5e-20
WP_017551575.1|436353_436719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035183363.1|436918_437941_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	23.9	6.3e-24
WP_035183364.1|438867_439989_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_035183366.1|440032_440638_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014095824.1|441203_442514_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_035185348.1|442841_443705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052042185.1|443688_444495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048339785.1|444500_444869_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014095824.1|446562_447873_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP010525	Bacillus coagulans strain HM-08 chromosome, complete genome	3624641	542110	598707	3624641	transposase	Streptococcus_phage(33.33%)	45	NA	NA
WP_014097043.1|542110_543100_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_017550090.1|543101_543365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097045.1|543563_544052_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_014097049.1|545677_545830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183435.1|546216_547194_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_014097051.1|547196_548078_+	ribokinase	NA	NA	NA	NA	NA
WP_035183437.1|548077_548470_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_014097053.1|548516_550016_+	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.8	1.1e-11
WP_035183438.1|549999_550944_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_035183439.1|550959_551880_+	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_035183440.1|552737_554033_+	GntP family permease	NA	NA	NA	NA	NA
WP_035183442.1|554045_555191_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.6	1.0e-46
WP_052042148.1|555430_556456_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035183443.1|556904_557954_+	2,3-butanediol dehydrogenase	NA	NA	NA	NA	NA
WP_035183444.1|558088_559168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183445.1|559946_561818_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	45.8	6.5e-160
WP_035183446.1|561814_562291_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0A8WJI9	Clostridium_phage	49.0	1.9e-36
WP_035183448.1|563384_564641_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_035183449.1|564940_565690_+	glucose 1-dehydrogenase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	28.9	3.9e-15
WP_017551449.1|565914_567090_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.6	3.6e-84
WP_035183461.1|567879_568776_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183453.1|569031_570678_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_035183455.1|572296_573040_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183457.1|573437_575045_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_035183458.1|575067_576393_+	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_043052472.1|576821_578183_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017551180.1|578388_578877_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_017551179.1|579149_579623_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_035183467.1|580953_582285_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_035183470.1|582274_582559_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_035183472.1|582560_583592_-	MsnO8 family LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_035183474.1|583607_584363_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	1.7e-34
WP_035183477.1|584359_585067_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_026104591.1|585079_585799_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_017551171.1|585813_586611_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017551170.1|586626_587427_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035183480.1|587423_587990_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035183483.1|588004_588559_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_100183701.1|588705_589659_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043052461.1|590041_591562_+|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
WP_017551166.1|591635_592637_+	cysteine synthase family protein	NA	A0A1X9I5F1	Streptococcus_phage	40.6	2.0e-54
WP_017551165.1|592846_593044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017551163.1|593463_593913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043052461.1|594445_595966_+|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
WP_017550355.1|597393_598707_+|transposase	IS1380-like element ISBco1 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	48.8	7.1e-113
>prophage 6
NZ_CP010525	Bacillus coagulans strain HM-08 chromosome, complete genome	3624641	855024	934245	3624641	transposase	Streptococcus_phage(11.11%)	58	NA	NA
WP_013858393.1|855024_856248_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.5	3.7e-79
WP_035183866.1|856658_856976_+	YfhH family protein	NA	NA	NA	NA	NA
WP_026684724.1|859662_860781_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_014097361.1|860959_861940_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_014097362.1|862026_862185_+	small, acid-soluble spore protein K	NA	NA	NA	NA	NA
WP_035183873.1|862515_863388_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.3	1.4e-19
WP_043052472.1|863350_864712_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_035183880.1|865579_865864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097366.1|865993_867451_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_035183882.1|867729_872292_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_014097368.1|872416_873331_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.4	4.8e-07
WP_014097369.1|873613_874363_+	enoyl-[acyl-carrier-protein] reductase FabL	NA	NA	NA	NA	NA
WP_014097370.1|874458_874689_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_014097371.1|874835_875090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097372.1|875244_875775_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_014097373.1|875875_877624_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.2	1.2e-54
WP_035183885.1|877955_879035_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_035183889.1|879025_879913_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_014097376.1|879930_881400_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_035183891.1|881399_882269_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014097379.1|883741_884020_+	YqhV family protein	NA	NA	NA	NA	NA
WP_035183893.1|884270_884651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035183895.1|884784_886053_+	MFS transporter	NA	NA	NA	NA	NA
WP_014097382.1|886157_886799_-	YitT family protein	NA	NA	NA	NA	NA
WP_014097383.1|887313_888102_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	38.3	2.0e-33
WP_014097384.1|888118_888901_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_026684815.1|888897_889923_-	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017551390.1|890608_891901_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_014097387.1|892044_892449_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_017551388.1|892758_893313_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_014097390.1|893524_893974_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_014097391.1|894168_895056_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	2.5e-08
WP_035183899.1|895249_896938_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_017551385.1|897023_897773_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_035183901.1|897884_898244_-	YgzB family protein	NA	NA	NA	NA	NA
WP_017551383.1|898382_899255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017550137.1|906770_907790_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017550136.1|908376_909504_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_017550135.1|909914_910799_+	DMT family transporter	NA	NA	NA	NA	NA
WP_061577275.1|910927_911200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183911.1|911546_912932_+	MFS transporter	NA	NA	NA	NA	NA
WP_035183913.1|913053_914280_+	MFS transporter	NA	NA	NA	NA	NA
WP_080738167.1|914758_914893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183915.1|915001_917248_+	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
WP_043052479.1|917473_918889_+|transposase	ISLre2-like element ISBco6 family transposase	transposase	NA	NA	NA	NA
WP_061466630.1|919191_919725_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.0	2.6e-21
WP_035185129.1|920078_920561_+	DUF2243 domain-containing protein	NA	NA	NA	NA	NA
WP_035185124.1|920569_921385_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_082188820.1|921761_923099_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_035183918.1|923244_923709_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183920.1|925668_926172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043052461.1|926444_927965_+|transposase	IS5-like element ISBco3 family transposase	transposase	NA	NA	NA	NA
WP_080738183.1|927980_928586_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.3	1.5e-09
WP_052042183.1|928575_928767_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_088775936.1|929139_930267_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_035185271.1|930292_931804_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	40.2	1.2e-76
WP_035185274.1|931936_932659_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014095824.1|932934_934245_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP010525	Bacillus coagulans strain HM-08 chromosome, complete genome	3624641	1356301	1405965	3624641	protease,coat,transposase,tRNA	Staphylococcus_phage(20.0%)	48	NA	NA
WP_043052491.1|1356301_1357525_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_014097792.1|1358088_1359450_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_035184435.1|1359451_1359877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097794.1|1359903_1360116_-	small acid-soluble spore protein SspI	NA	NA	NA	NA	NA
WP_035184438.1|1360220_1360976_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_035184439.1|1361621_1362659_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.1	5.4e-31
WP_035184441.1|1362671_1365086_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_035184443.1|1365478_1366414_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_013859878.1|1366514_1366805_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_080738175.1|1366791_1367328_+	CvpA family protein	NA	NA	NA	NA	NA
WP_035184447.1|1367606_1369325_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A0N9R450	Chrysochromulina_ericina_virus	26.2	2.6e-14
WP_014097802.1|1369400_1371755_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	49.6	2.6e-20
WP_014097803.1|1371991_1373689_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.7	2.5e-41
WP_014097804.1|1373831_1374425_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035184449.1|1374458_1375232_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_035184451.1|1375294_1376068_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_035184453.1|1376098_1377079_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_043052479.1|1377295_1378711_+|transposase	ISLre2-like element ISBco6 family transposase	transposase	NA	NA	NA	NA
WP_014097808.1|1379096_1379411_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	42.7	2.6e-21
WP_035184458.1|1379516_1381289_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_035184460.1|1381706_1382936_+	aspartate kinase	NA	NA	NA	NA	NA
WP_014097811.1|1382969_1383434_-	YslB family protein	NA	NA	NA	NA	NA
WP_035184462.1|1383862_1384471_+	succinate dehydrogenase cytochrome b558 subunit	NA	NA	NA	NA	NA
WP_017551099.1|1384542_1386294_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_014097814.1|1386366_1387134_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_043052492.1|1387198_1387708_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014097816.1|1388067_1388292_+	response regulator transcription factor	NA	A0A290GJH9	Caldibacillus_phage	77.0	6.1e-17
WP_035184465.1|1388577_1388763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026684041.1|1389029_1389329_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_014097818.1|1389341_1390430_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_035184467.1|1390422_1390947_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_035184469.1|1391388_1391841_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017551093.1|1391851_1392661_+	glutamate racemase	NA	NA	NA	NA	NA
WP_014097822.1|1392752_1392968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097823.1|1392964_1393333_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_017551092.1|1393342_1394479_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	3.2e-13
WP_014097825.1|1394625_1394928_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014097826.1|1394924_1395125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014097827.1|1395268_1396309_+	GerMN domain-containing protein	NA	NA	NA	NA	NA
WP_014097828.1|1396416_1397025_+	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	33.3	8.1e-11
WP_014097829.1|1397021_1397531_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_035184472.1|1398334_1398736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014097831.1|1398974_1399271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014097832.1|1399405_1399849_+	YndM family protein	NA	NA	NA	NA	NA
WP_043052493.1|1400301_1401711_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.5	2.0e-36
WP_014097833.1|1401885_1402878_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014097834.1|1403041_1404328_+	trigger factor	NA	NA	NA	NA	NA
WP_014097835.1|1404696_1405965_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	67.4	5.4e-150
>prophage 8
NZ_CP010525	Bacillus coagulans strain HM-08 chromosome, complete genome	3624641	1754281	1820755	3624641	tail,tRNA,head,terminase,portal,capsid,holin,integrase,protease	Bacillus_phage(29.41%)	76	1782858:1782917	1818665:1818763
WP_035184709.1|1754281_1755574_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	30.8	2.7e-56
WP_043052469.1|1755659_1757069_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.5	2.0e-36
WP_014098190.1|1757578_1758274_+	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	48.7	2.3e-25
WP_014098191.1|1758321_1758981_+	endonuclease III	NA	NA	NA	NA	NA
WP_035184715.1|1759068_1761804_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_014098194.1|1761896_1762502_-	Holliday junction resolvase RecU	NA	NA	NA	NA	NA
WP_014098196.1|1763058_1763298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014098197.1|1763365_1763728_+	YppE family protein	NA	NA	NA	NA	NA
WP_014098198.1|1763799_1764294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014098199.1|1764359_1764803_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_035184719.1|1764952_1767253_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	32.5	1.5e-09
WP_014098201.1|1767233_1768532_+	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_014098202.1|1768870_1769122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014098203.1|1769191_1769743_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_013859462.1|1769823_1770126_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_014098204.1|1770855_1772001_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_172653411.1|1772076_1773603_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_014098206.1|1774149_1774737_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014098207.1|1774733_1776047_+	purine permease	NA	NA	NA	NA	NA
WP_014098209.1|1777056_1777260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017550446.1|1777425_1781025_+	dynamin family protein	NA	NA	NA	NA	NA
WP_014098211.1|1781117_1781507_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014098212.1|1781576_1782914_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
1782858:1782917	attL	ATGTTCCGCACACAAGTCCACCAATGGGAACGCGACCAGTATATCGAAATGTATTAAGCA	NA	NA	NA	NA
WP_172653412.1|1783022_1784156_-|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	71.9	2.0e-71
WP_035184723.1|1784198_1784708_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_035184725.1|1784812_1785079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035184727.1|1785082_1787083_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	32.5	1.3e-20
WP_052042163.1|1787128_1788091_-	3'-5' exoribonuclease	NA	A0A0A8WJ41	Clostridium_phage	39.2	1.9e-30
WP_035184729.1|1788120_1789038_-	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_035184731.1|1789166_1789586_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	51.7	3.0e-09
WP_035184732.1|1789731_1789959_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035184735.1|1790247_1790769_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035184739.1|1790793_1791063_+	group-specific protein	NA	A0A1B1P7U4	Bacillus_phage	62.8	3.5e-27
WP_043052499.1|1791075_1791357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184741.1|1791443_1791635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184742.1|1791798_1792164_+	hypothetical protein	NA	S6BFM8	Thermus_phage	32.4	1.7e-08
WP_035184743.1|1792176_1793139_+	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	60.3	1.6e-37
WP_080738177.1|1793135_1793528_+	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	60.0	2.0e-39
WP_035184744.1|1793722_1793932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184746.1|1794064_1794253_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_035184748.1|1794521_1794704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184750.1|1794718_1795021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184753.1|1795026_1795227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184755.1|1795244_1795484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184757.1|1795546_1796233_+	phage antirepressor KilAC domain-containing protein	NA	A0A2P1JTZ2	Anoxybacillus_phage	39.1	4.8e-36
WP_035184760.1|1796335_1796791_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	54.9	1.5e-38
WP_035184762.1|1796787_1797330_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	8.7e-57
WP_035184764.1|1797491_1797791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184766.1|1798114_1798333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184768.1|1798338_1798710_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	52.3	1.5e-31
WP_035184770.1|1798817_1799354_+	hypothetical protein	NA	A0A2I7SBY3	Paenibacillus_phage	34.3	1.1e-16
WP_088775930.1|1799343_1800912_+|terminase	terminase large subunit	terminase	A0A2I7SBY8	Paenibacillus_phage	74.7	2.6e-247
WP_035184772.1|1800930_1802217_+|portal	phage portal protein	portal	Q0SPK2	Clostridium_phage	54.3	7.4e-131
WP_035184773.1|1802203_1802920_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	54.1	2.8e-55
WP_052042165.1|1802934_1804083_+|capsid	phage major capsid protein	capsid	A0A0A7S154	Clostridium_phage	43.2	9.4e-77
WP_035184775.1|1804096_1804381_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A6M953	Geobacillus_virus	61.4	6.6e-24
WP_035184777.1|1804383_1804716_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_035184779.1|1804715_1805147_+	HK97 gp10 family phage protein	NA	A0A1B1P9Z7	Enterococcus_phage	33.3	4.8e-10
WP_035184781.1|1805143_1805530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184783.1|1805542_1806151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184785.1|1806204_1806531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052498231.1|1806699_1810878_+|tail	phage tail tape measure protein	tail	A8ATA7	Listeria_phage	37.0	9.9e-92
WP_035184787.1|1810885_1811710_+|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	33.2	8.9e-29
WP_052042168.1|1811718_1813125_+|tail	phage tail protein	tail	Q9T1A5	Listeria_phage	41.4	7.7e-73
WP_052042170.1|1813124_1814594_+	metallophosphoesterase	NA	A0A0U4JVA9	Exiguobacterium_phage	43.4	4.5e-15
WP_035184789.1|1814603_1815332_+	hypothetical protein	NA	A0A2P0ZL22	Lactobacillus_phage	38.2	4.8e-34
WP_035184791.1|1815347_1815638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164931350.1|1815640_1815808_+	hypothetical protein	NA	I1TLF8	Bacillus_phage	52.3	4.0e-05
WP_035184794.1|1815878_1816133_+	hypothetical protein	NA	A0A2H4J8H2	uncultured_Caudovirales_phage	41.5	5.5e-06
WP_035184860.1|1816266_1816524_+	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_172653413.1|1816535_1816775_+|holin	phage holin	holin	M4ZR48	Bacillus_phage	67.1	1.0e-22
WP_052042174.1|1816829_1817669_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5ILA1	Bacillus_phage	29.8	4.8e-14
WP_035184796.1|1817773_1818490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014098213.1|1818939_1819560_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	2.5e-15
1818665:1818763	attR	ATGTTCCGCACACAAGTCCACCAATGGGAACGCGACCAGTATATCGAAATGTATTAAGCAAGAAACCCCTTGAAGCGTAAGGCTTTGAGGGGTTTTTGT	NA	NA	NA	NA
WP_014098214.1|1819766_1820105_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014098215.1|1820101_1820755_+	recombinase family protein	NA	D7RWL2	Brochothrix_phage	25.3	3.2e-05
>prophage 9
NZ_CP010525	Bacillus coagulans strain HM-08 chromosome, complete genome	3624641	2622120	2628302	3624641		Streptococcus_phage(33.33%)	7	NA	NA
WP_035182139.1|2622120_2622705_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.0	1.3e-53
WP_014095819.1|2622791_2623061_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_013858691.1|2623171_2624125_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	9.2e-54
WP_017551710.1|2624205_2625186_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	44.6	1.2e-67
WP_017551709.1|2625182_2626073_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	4.3e-05
WP_014095823.1|2626109_2626568_-	8-oxo-dGTP diphosphatase	NA	K4F7D9	Cronobacter_phage	33.3	6.9e-07
WP_017551707.1|2627354_2628302_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.1	4.1e-86
>prophage 10
NZ_CP010525	Bacillus coagulans strain HM-08 chromosome, complete genome	3624641	3317947	3358709	3624641	protease,transposase	Streptococcus_phage(42.86%)	31	NA	NA
WP_017551449.1|3317947_3319123_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.6	3.6e-84
WP_014096394.1|3320092_3320314_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_035182737.1|3320335_3322279_-	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.8	1.9e-109
WP_035182739.1|3322481_3323234_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_052042116.1|3323478_3324564_-	excinuclease ABC subunit C	NA	NA	NA	NA	NA
WP_014096398.1|3324560_3325022_-	flavodoxin	NA	NA	NA	NA	NA
WP_035182744.1|3325788_3326697_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	M1T2E7	Synechococcus_phage	36.1	6.7e-54
WP_017550602.1|3326757_3327450_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035182746.1|3327600_3329157_+	gluconokinase	NA	NA	NA	NA	NA
WP_014096403.1|3329558_3330887_+	2-keto-3-deoxygluconate permease	NA	NA	NA	NA	NA
WP_014096404.1|3330980_3331700_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_014096405.1|3331740_3333417_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_035182749.1|3333545_3334964_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_014096407.1|3334994_3335477_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_014096408.1|3336009_3337539_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_043052528.1|3337531_3338488_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	2.6e-24
WP_017551449.1|3339264_3340440_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.6	3.6e-84
WP_035182760.1|3343270_3344248_-	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.2	2.6e-19
WP_035182763.1|3344410_3344869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014096413.1|3344998_3345337_+	DsrE family protein	NA	NA	NA	NA	NA
WP_014096414.1|3345573_3346752_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_043052495.1|3347199_3348615_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_043052529.1|3349012_3350698_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_014096420.1|3351253_3351490_+	hypothetical protein	NA	A0A2I6QQV7	Streptococcus_phage	69.0	6.1e-07
WP_014096421.1|3351560_3352301_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014096422.1|3352496_3353288_-	DUF2837 family protein	NA	NA	NA	NA	NA
WP_014096423.1|3353500_3353941_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014096424.1|3354138_3355407_-	MFS transporter	NA	NA	NA	NA	NA
WP_017550280.1|3355619_3356240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014096426.1|3356564_3356711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014095824.1|3357398_3358709_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP010525	Bacillus coagulans strain HM-08 chromosome, complete genome	3624641	3384805	3446176	3624641	tail,integrase,terminase,transposase	Bacillus_phage(17.14%)	73	3407740:3407788	3446262:3446310
WP_014095824.1|3384805_3386116_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_048339794.1|3386419_3386824_+	glycine-rich domain-containing protein-like	NA	A0A2I2L429	Orpheovirus	34.7	9.4e-08
WP_082188825.1|3387031_3388369_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_035182800.1|3388450_3388735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014096450.1|3388827_3390039_+	MFS transporter	NA	NA	NA	NA	NA
WP_014095824.1|3390578_3391889_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_035182807.1|3393835_3394762_+	oxidoreductase	NA	NA	NA	NA	NA
WP_035182809.1|3394758_3395622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182811.1|3395816_3396569_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_026683804.1|3396764_3397280_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_026683805.1|3397372_3397798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182814.1|3399003_3400806_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	39.6	3.2e-108
WP_014096454.1|3401270_3402623_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_014096455.1|3402659_3403910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014096456.1|3403902_3404730_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_014096457.1|3404876_3405491_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_014096458.1|3405503_3406067_-	RNA polymerase sigma factor SigW	NA	NA	NA	NA	NA
WP_014096459.1|3406242_3406416_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_014096460.1|3406520_3407420_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	2.1e-23
3407740:3407788	attL	AAGCGGAAGACGGGACTCGAACCCGCGACCCACACCTTGGGAAGGTGTT	NA	NA	NA	NA
WP_048339792.1|3408235_3409522_-	LysM peptidoglycan-binding domain-containing protein	NA	V5UQT2	Oenococcus_phage	29.8	1.4e-28
WP_080738157.1|3409939_3410146_-	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_035182826.1|3410358_3411183_-	SGNH/GDSL hydrolase family protein	NA	A0A2H4J9Z4	uncultured_Caudovirales_phage	33.5	3.0e-24
WP_035182828.1|3411277_3411541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182831.1|3411552_3413058_-	hypothetical protein	NA	M4M9L1	Vibrio_phage	30.7	3.4e-34
WP_035182834.1|3413057_3413411_-	hypothetical protein	NA	A0A142KA97	Gordonia_phage	61.2	1.4e-07
WP_052042118.1|3413403_3414510_-|tail	phage tail protein	tail	A6M966	Geobacillus_virus	32.2	8.0e-41
WP_043052531.1|3414519_3415365_-|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	44.6	1.5e-55
WP_167336723.1|3415361_3416822_-	transglycosylase SLT domain-containing protein	NA	A0A182BQ85	Lactococcus_phage	51.9	4.0e-72
WP_142743400.1|3418504_3418798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182840.1|3418860_3419265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182843.1|3419278_3420094_-	hypothetical protein	NA	A0A1B1P7D9	Bacillus_phage	41.2	5.9e-49
WP_035182846.1|3420105_3420465_-	hypothetical protein	NA	A0A1B1P7D3	Bacillus_phage	40.7	5.1e-21
WP_052042122.1|3420477_3420882_-	HK97 gp10 family phage protein	NA	A0A1B1P7D0	Bacillus_phage	33.3	5.9e-10
WP_035182847.1|3420883_3421240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182849.1|3421236_3421647_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_155375943.1|3421648_3421819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182850.1|3421831_3422914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182852.1|3422929_3423316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182854.1|3423315_3424506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052042124.1|3424506_3426789_-	hypothetical protein	NA	M4R217	Salicola_phage	38.5	2.0e-09
WP_048339823.1|3426794_3428246_-|terminase	phage terminase large subunit	terminase	A8ATG0	Listeria_phage	60.3	3.1e-162
WP_035182859.1|3428235_3428820_-	hypothetical protein	NA	A0A1S5SAK3	Streptococcus_phage	53.7	3.6e-48
WP_035182861.1|3429012_3429444_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	34.6	2.6e-16
WP_035182863.1|3429440_3429647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155375944.1|3429776_3429935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155375945.1|3429972_3430134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182866.1|3430173_3430629_-	methyltransferase domain-containing protein	NA	A0A059T693	Listeria_phage	69.3	1.4e-60
WP_071646876.1|3430862_3431021_-	DUF3954 domain-containing protein	NA	A0A2P1JTX5	Anoxybacillus_phage	61.5	5.5e-12
WP_052498234.1|3431120_3431819_-	N-6 DNA methylase	NA	H7BVT3	unidentified_phage	40.5	2.1e-18
WP_172653418.1|3431827_3431998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043052534.1|3432273_3432735_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	79.3	8.7e-58
WP_035182875.1|3432744_3433377_-	dUTP diphosphatase	NA	A0A290GJJ6	Caldibacillus_phage	47.2	1.7e-43
WP_035182878.1|3433373_3433571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155375946.1|3433735_3433912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052042126.1|3433908_3435225_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	45.0	1.1e-94
WP_043052535.1|3435181_3435502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052042127.1|3435498_3436335_-	DUF4373 domain-containing protein	NA	A0A0H4TKJ7	Bacillus_phage	33.8	4.5e-12
WP_035182880.1|3436392_3437289_-	recombinase RecT	NA	A0A0B5CTU3	Listeria_phage	70.6	1.3e-94
WP_088775933.1|3437288_3438236_-	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	63.3	6.9e-110
WP_052042129.1|3438333_3438540_-	hypothetical protein	NA	A0A290GDU5	Caldibacillus_phage	42.0	5.0e-05
WP_035182881.1|3438536_3438773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155375947.1|3439447_3439588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182885.1|3439657_3439942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182887.1|3439941_3440460_-	hypothetical protein	NA	A0A290FZK9	Caldibacillus_phage	36.7	1.5e-21
WP_035182888.1|3440523_3440709_-	helix-turn-helix domain-containing protein	NA	U5P0W4	Brevibacillus_phage	61.8	6.0e-10
WP_035182890.1|3440709_3441495_-	phage antirepressor KilAC domain-containing protein	NA	R9VWW9	Paenibacillus_phage	45.8	9.3e-52
WP_035182893.1|3441495_3441723_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035182898.1|3441884_3442313_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	66.0	1.8e-41
WP_052042130.1|3442325_3442739_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	78.1	3.2e-59
WP_035182902.1|3442841_3443189_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_035182903.1|3443253_3443586_+	membrane protein	NA	S5MNN8	Brevibacillus_phage	66.0	4.2e-14
WP_080738156.1|3443603_3444845_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	73.5	5.6e-67
WP_029142701.1|3444949_3446176_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	47.6	1.0e-92
3446262:3446310	attR	AAGCGGAAGACGGGACTCGAACCCGCGACCCACACCTTGGGAAGGTGTT	NA	NA	NA	NA
