The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009351	Bacillus thuringiensis HD1002 chromosome, complete genome	5491311	16574	146717	5491311	bacteriocin,tail,integrase,tRNA,terminase,coat,head,portal,protease,capsid,holin	Bacillus_phage(43.4%)	117	17323:17340	125735:125752
WP_000213007.1|16574_17879_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
17323:17340	attL	TGGAAGATCCAAAAACAG	NA	NA	NA	NA
WP_001101244.1|17944_18844_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.8	3.1e-35
WP_000526274.1|18886_19429_+|protease	ATP-dependent protease proteolytic subunit HslV	protease	NA	NA	NA	NA
WP_000550084.1|19451_20843_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.1e-47
WP_000421290.1|20920_21700_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_000111485.1|22047_22749_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_001018576.1|22852_23740_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000042669.1|23806_24529_+	UMP kinase	NA	NA	NA	NA	NA
WP_000531505.1|24531_25089_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000971296.1|25174_25951_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	9.0e-23
WP_000813589.1|25968_26760_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000790358.1|26783_27926_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001090241.1|27943_29200_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_000814295.1|29309_31010_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000059996.1|31134_35436_+	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	39.6	4.1e-24
WP_000359095.1|35769_36240_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000102611.1|36257_37364_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000071123.1|37375_37648_+	YlxR family protein	NA	NA	NA	NA	NA
WP_001286522.1|37648_37960_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000036346.1|37964_40031_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.9	1.9e-19
WP_000634349.1|40027_40309_+	DUF503 family protein	NA	NA	NA	NA	NA
WP_000776437.1|40324_40681_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000399363.1|40767_41691_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000766703.1|41734_42706_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	31.8	2.1e-05
WP_001229392.1|42806_43076_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_000076743.1|43236_45375_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000868223.1|45527_46427_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000593001.1|46514_47756_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	4.4e-56
WP_001239759.1|47891_48143_+	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000954735.1|48313_49216_+	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_000844788.1|49670_51218_-	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	54.0	1.8e-144
WP_001046154.1|51490_52294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000351864.1|52449_52884_-	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	79.0	5.1e-60
WP_000900757.1|52897_53335_-	helix-turn-helix domain-containing protein	NA	A0A2P1JU09	Anoxybacillus_phage	55.2	7.5e-35
WP_001060851.1|53508_53700_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001141265.1|53734_53983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537277.1|54073_54661_+	hypothetical protein	NA	D2XR41	Bacillus_phage	69.7	2.2e-74
WP_000215309.1|54674_54896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354295.1|55079_55295_+	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	69.0	1.0e-24
WP_000782004.1|55291_55591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998369.1|55774_56059_+	hypothetical protein	NA	D2XR42	Bacillus_phage	55.3	1.9e-23
WP_000312141.1|56338_57289_+	DnaD domain protein	NA	D2XR43	Bacillus_phage	61.2	7.7e-85
WP_000063910.1|57285_58608_+	replicative DNA helicase	NA	D2XR44	Bacillus_phage	95.0	5.1e-236
WP_000926798.1|58610_58799_+	hypothetical protein	NA	D2XR45	Bacillus_phage	85.5	9.7e-16
WP_001126004.1|58773_59136_+	hypothetical protein	NA	D2XR47	Bacillus_phage	88.3	1.6e-54
WP_000512856.1|59209_59401_+	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	63.5	6.4e-15
WP_000032820.1|60441_61758_-	collagen-like protein	NA	A0A285PWR0	Cedratvirus	62.6	4.4e-38
WP_000192854.1|63346_63811_+	ArpU family transcriptional regulator	NA	D2XR57	Bacillus_phage	92.2	1.1e-73
WP_001012125.1|63810_64353_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	8.6e-89
WP_000434817.1|64475_64676_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	72.7	6.3e-21
WP_001099642.1|66200_66641_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000778987.1|66919_67141_+	hypothetical protein	NA	B5LPQ8	Bacillus_virus	75.7	1.9e-23
WP_000877970.1|67137_67410_+	hypothetical protein	NA	A0A1B1P7D2	Bacillus_phage	47.8	1.8e-07
WP_001209624.1|67375_67711_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	4.7e-53
WP_000763336.1|67861_68218_+	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	100.0	3.6e-59
WP_000635288.1|68214_69870_+|terminase	terminase large subunit	terminase	A0A2H4JI41	uncultured_Caudovirales_phage	95.5	6.1e-311
WP_043333521.1|69935_71042_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.9	3.1e-186
WP_000216398.1|71025_71799_+|protease	Clp protease ClpP	protease	R9TLM7	Paenibacillus_phage	54.1	7.0e-60
WP_000152777.1|71818_72982_+|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	95.9	2.7e-209
WP_001243202.1|72994_73291_+	hypothetical protein	NA	D2XR19	Bacillus_phage	90.6	2.3e-43
WP_003310446.1|73292_73643_+|head	phage head closure protein	head	D2XR20	Bacillus_phage	86.2	2.1e-51
WP_000997535.1|73644_73989_+	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	79.6	6.3e-45
WP_000176454.1|73985_74321_+	hypothetical protein	NA	D2XR22	Bacillus_phage	90.8	2.0e-51
WP_001004907.1|74321_74909_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	82.1	5.1e-87
WP_000415912.1|74913_75276_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	2.4e-42
WP_000094137.1|79176_80646_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	78.3	2.3e-229
WP_001260218.1|80642_84962_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	62.6	0.0e+00
WP_001075307.1|84983_85349_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	69.7	2.8e-43
WP_001261076.1|85379_85616_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A2H4JGN9	uncultured_Caudovirales_phage	100.0	1.7e-25
WP_000540632.1|85615_86425_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	83.3	2.0e-134
WP_000722940.1|86626_87133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050864.1|87816_88305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002000636.1|88319_90026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085960240.1|90228_90465_+	dipicolinate synthase	NA	NA	NA	NA	NA
WP_000414846.1|90615_91662_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000692456.1|91685_92918_+	aspartate kinase	NA	NA	NA	NA	NA
WP_000564763.1|92929_93808_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000823089.1|94734_96405_+	ribonuclease J	NA	NA	NA	NA	NA
WP_000139825.1|96509_97259_+	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_000605020.1|97255_97459_+	ribonuclease	NA	NA	NA	NA	NA
WP_001118795.1|97671_100053_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_000114182.1|100590_101316_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000725767.1|101408_102485_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	33.6	5.6e-47
WP_000456929.1|102602_104135_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	1.1e-11
WP_001085255.1|104127_105186_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000008857.1|105186_106146_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000772416.1|106355_107630_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.3	1.6e-56
WP_000411971.1|107630_108917_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.4	3.8e-10
WP_000759625.1|109017_109731_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000114444.1|109806_110055_+	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|110193_110979_+	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_000137465.1|111000_111915_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001052967.1|111980_112559_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000990684.1|112579_113818_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_001283853.1|113962_114994_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	71.5	3.2e-137
WP_000099770.1|115477_117043_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_001221092.1|117201_117996_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000404341.1|118145_118406_+	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_003309838.1|118428_119388_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_000625417.1|119613_121371_+	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_000190155.1|121357_122224_+	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_001005392.1|122652_124182_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000870460.1|124185_124617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288799.1|124743_125286_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_000195994.1|125466_128145_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	24.5	1.8e-33
125735:125752	attR	TGGAAGATCCAAAAACAG	NA	NA	NA	NA
WP_000516485.1|128153_130118_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.7	1.5e-61
WP_000461138.1|130395_130581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235297.1|131085_133869_+	HSR1-like GTP-binding protein	NA	NA	NA	NA	NA
WP_000791034.1|133966_135886_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	36.8	4.4e-95
WP_000272409.1|136390_137728_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_000771008.1|137993_138791_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	39.4	2.8e-35
WP_000689209.1|139085_140927_+	peptidase	NA	NA	NA	NA	NA
WP_001244684.1|141106_142087_+	phosphatidylinositol diacylglycerol-lyase	NA	NA	NA	NA	NA
WP_000008148.1|142286_144002_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.2	2.5e-09
WP_000006462.1|144515_144707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000454959.1|144893_146327_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000878483.1|146360_146717_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
>prophage 2
NZ_CP009351	Bacillus thuringiensis HD1002 chromosome, complete genome	5491311	200632	209889	5491311	bacteriocin	uncultured_Caudovirales_phage(40.0%)	13	NA	NA
WP_000708856.1|200632_201292_-	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	8.7e-35
WP_000283161.1|201453_201666_+	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.3e-11
WP_000531298.1|201862_202621_+	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	70.2	4.1e-97
WP_001189066.1|202632_202827_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	72.6	2.6e-16
WP_000511422.1|202979_203867_+	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	64.6	1.0e-94
WP_000464432.1|204275_204662_+	hypothetical protein	NA	A0A288WG73	Bacillus_phage	68.3	5.4e-45
WP_000981476.1|204896_205886_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	43.3	7.6e-35
WP_001051376.1|206009_206852_+	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	47.7	1.4e-32
WP_000392443.1|206913_207144_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	77.6	1.7e-25
WP_001102628.1|207515_207839_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000031383.1|207831_208374_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000976234.1|208374_209178_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000413739.1|209268_209889_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
>prophage 3
NZ_CP009351	Bacillus thuringiensis HD1002 chromosome, complete genome	5491311	325211	350952	5491311	integrase,capsid,terminase	Bacillus_phage(56.52%)	36	311108:311124	356493:356509
311108:311124	attL	ATACGTTAGAAGTAGAA	NA	NA	NA	NA
WP_000237495.1|325211_326303_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	79.8	2.5e-164
WP_000947503.1|327110_328331_+	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	50.9	1.1e-112
WP_003259427.1|328733_329078_-	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	40.6	1.4e-15
WP_000819158.1|329247_329454_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000549470.1|329519_329708_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	74.2	1.4e-17
WP_000187073.1|329728_330376_+	sigma-70 family RNA polymerase sigma factor	NA	W8CYN8	Bacillus_phage	89.3	6.0e-105
WP_000167563.1|330653_330956_+	hypothetical protein	NA	H0USU0	Bacillus_phage	66.7	9.5e-29
WP_000866208.1|330956_331220_+	hypothetical protein	NA	A0A2H4J4P5	uncultured_Caudovirales_phage	52.5	7.2e-17
WP_000572113.1|331212_331407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543065.1|331485_332421_+	hypothetical protein	NA	S6C475	Thermus_phage	58.5	2.2e-100
WP_000224585.1|332442_333249_+	recombination protein RecT	NA	S6AVW6	Thermus_phage	67.1	1.1e-95
WP_000611881.1|334397_335030_+	ATP-binding protein	NA	S6B1M2	Thermus_phage	52.5	2.7e-57
WP_000049348.1|335035_335515_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000049838.1|335527_335953_+	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	51.9	4.1e-30
WP_000323349.1|335968_336637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762586.1|336626_337349_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_003269482.1|337514_337781_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000973815.1|337764_338499_+	sigma-70 family RNA polymerase sigma factor	NA	C7DTL2	Bacillus_phage	51.2	2.1e-58
WP_000520931.1|339074_339257_+	hypothetical protein	NA	A0A1B1P7L7	Bacillus_phage	58.5	2.9e-09
WP_000164426.1|339291_340089_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	52.1	1.5e-73
WP_001072816.1|340758_341133_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	40.7	6.0e-17
WP_000876114.1|341494_341710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248554.1|341994_342150_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_003309811.1|342235_342418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003259446.1|342570_343143_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.1	4.9e-42
WP_000515245.1|343185_343722_+	hypothetical protein	NA	A5GYP7	Lactococcus_phage	56.3	9.5e-40
WP_014895320.1|343735_345151_+|terminase	phage terminase large subunit	terminase	U5PVG8	Bacillus_phage	69.3	9.1e-191
WP_000222862.1|345147_345378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124815.1|345391_345592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000467413.1|345649_347773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366285.1|347773_348049_+	DUF2829 domain-containing protein	NA	A0A0A7AQX0	Bacillus_phage	59.0	9.2e-23
WP_003269488.1|348048_348300_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	54.2	3.3e-19
WP_000668389.1|348299_348560_+	DUF2829 domain-containing protein	NA	S5MAK7	Bacillus_phage	70.6	4.3e-30
WP_000791086.1|348559_348814_+	hypothetical protein	NA	A0A1B1P7N4	Bacillus_phage	86.6	6.5e-39
WP_000917220.1|348897_349746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014895319.1|349761_350952_+|capsid	phage major capsid protein	capsid	A0A1B1IV93	uncultured_Mediterranean_phage	28.2	2.3e-33
356493:356509	attR	TTCTACTTCTAACGTAT	NA	NA	NA	NA
>prophage 4
NZ_CP009351	Bacillus thuringiensis HD1002 chromosome, complete genome	5491311	355392	365741	5491311	bacteriocin	Bacillus_phage(100.0%)	11	NA	NA
WP_014895315.1|355392_359664_+	hypothetical protein	NA	A0A0A0RPU4	Bacillus_phage	37.2	4.2e-138
WP_003261708.1|359763_359988_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	75.0	5.9e-20
WP_000392441.1|360054_360285_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	87.8	1.6e-28
WP_000405770.1|360284_360989_+	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	84.4	2.9e-113
WP_001171598.1|361378_361963_-	type IV secretory system conjugative DNA transfer family protein	NA	A0A288WFT6	Bacillus_phage	74.3	1.1e-81
WP_001009469.1|361967_362171_-	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	56.1	2.2e-13
WP_001256514.1|362376_362694_+	hypothetical protein	NA	H0USY0	Bacillus_phage	97.1	3.2e-51
WP_000170774.1|362690_362873_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.0e-22
WP_014895314.1|362988_364170_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	95.7	1.2e-217
WP_003262705.1|364111_364732_+	hypothetical protein	NA	H0USY2	Bacillus_phage	95.6	1.1e-111
WP_000730121.1|364757_365741_-	helix-turn-helix domain-containing protein	NA	A0A0S2MVF4	Bacillus_phage	74.9	1.1e-134
>prophage 5
NZ_CP009351	Bacillus thuringiensis HD1002 chromosome, complete genome	5491311	425247	516991	5491311	tail,terminase,coat,head,holin,portal,integrase,capsid,protease	Bacillus_phage(81.82%)	87	418939:418955	477052:477068
418939:418955	attL	AAGAAGTGAAAAAAGTA	NA	NA	NA	NA
WP_000237490.1|425247_426309_-|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	100.0	7.6e-198
WP_042992861.1|427413_427644_+	hypothetical protein	NA	H0UST5	Bacillus_phage	100.0	7.9e-36
WP_000466635.1|427785_429039_+	hypothetical protein	NA	H0UST6	Bacillus_phage	100.0	1.9e-216
WP_000005254.1|429459_429789_-	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	100.0	1.3e-52
WP_000368958.1|430035_430281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277643.1|430425_430614_+	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	2.6e-21
WP_000348892.1|430831_431611_+	phage regulatory protein	NA	H0UST9	Bacillus_phage	100.0	6.2e-141
WP_000176229.1|431773_432088_+	hypothetical protein	NA	H0USU0	Bacillus_phage	100.0	2.4e-51
WP_000123129.1|432361_433009_+	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	100.0	5.2e-117
WP_014895311.1|433253_434258_+	hypothetical protein	NA	H0USU2	Bacillus_phage	100.0	4.6e-189
WP_000705175.1|434220_435033_+	ATP-binding protein	NA	W8CZ50	Bacillus_phage	100.0	1.6e-155
WP_000436950.1|435074_435341_+	hypothetical protein	NA	W8CYZ5	Bacillus_phage	100.0	2.7e-43
WP_000817807.1|435412_435577_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_001025406.1|435594_435810_+	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000705117.1|435806_436106_-	hypothetical protein	NA	H0USU6	Bacillus_phage	100.0	3.3e-50
WP_003259886.1|436478_436676_+	hypothetical protein	NA	H0USU7	Bacillus_phage	100.0	6.6e-31
WP_001092479.1|436837_437146_+	hypothetical protein	NA	H0USU8	Bacillus_phage	100.0	5.1e-54
WP_001270306.1|437173_437566_+	hypothetical protein	NA	H0USU9	Bacillus_phage	100.0	2.1e-76
WP_000362234.1|437606_437810_+	hypothetical protein	NA	A0A1B1P8C8	Bacillus_phage	55.2	7.5e-14
WP_000055205.1|438177_438441_+	hypothetical protein	NA	H0USV0	Bacillus_phage	100.0	1.0e-42
WP_000074683.1|438640_438835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000965619.1|439770_440052_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000166145.1|440411_440897_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	100.0	6.1e-86
WP_001012129.1|440893_441436_+|integrase	site-specific integrase	integrase	H0USV4	Bacillus_phage	100.0	1.9e-96
WP_000930963.1|441651_441876_+	hypothetical protein	NA	H0USV5	Bacillus_phage	100.0	1.5e-34
WP_000017441.1|442305_442593_+	hypothetical protein	NA	H0USV6	Bacillus_phage	100.0	8.6e-48
WP_000443967.1|442627_442849_+	hypothetical protein	NA	H0USV7	Bacillus_phage	100.0	1.9e-31
WP_000002724.1|442841_443120_+	hypothetical protein	NA	H0USV8	Bacillus_phage	100.0	1.2e-41
WP_000778970.1|443116_443329_+	hypothetical protein	NA	H0USV9	Bacillus_phage	100.0	7.1e-31
WP_001198488.1|443462_443717_+	hypothetical protein	NA	H0USW0	Bacillus_phage	100.0	1.1e-43
WP_001139462.1|443706_444084_+	HNH endonuclease	NA	H0USW1	Bacillus_phage	100.0	4.0e-69
WP_000940125.1|444212_444716_+|terminase	phage terminase small subunit P27 family	terminase	H0USW2	Bacillus_phage	100.0	8.0e-89
WP_000621122.1|444717_446412_+|terminase	terminase large subunit	terminase	H0USW3	Bacillus_phage	99.6	0.0e+00
WP_000577485.1|446600_447854_+|portal	phage portal protein	portal	H0USW4	Bacillus_phage	100.0	1.2e-242
WP_001259161.1|447840_448551_+|protease	Clp protease ClpP	protease	H0USW5	Bacillus_phage	100.0	3.2e-128
WP_003263053.1|448588_449755_+|capsid	phage major capsid protein	capsid	H0USW6	Bacillus_phage	100.0	3.3e-210
WP_000244597.1|449775_450063_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	100.0	1.8e-45
WP_001068030.1|450049_450373_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	100.0	1.1e-56
WP_000763219.1|450365_450800_+	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	100.0	1.8e-76
WP_000609192.1|450796_451156_+	DUF3168 domain-containing protein	NA	H0USX0	Bacillus_phage	100.0	4.5e-62
WP_000896770.1|451156_451765_+|tail	tail protein	tail	W8CYT6	Bacillus_phage	100.0	5.8e-102
WP_000779154.1|451813_452131_+	hypothetical protein	NA	H0USX2	Bacillus_phage	100.0	1.1e-54
WP_001262739.1|452351_456383_+|tail	phage tail tape measure protein	tail	H0USX3	Bacillus_phage	100.0	0.0e+00
WP_000900857.1|456394_457879_+	hypothetical protein	NA	H0USX4	Bacillus_phage	100.0	2.2e-296
WP_001260181.1|457875_461901_+	hypothetical protein	NA	H0USX5	Bacillus_phage	100.0	0.0e+00
WP_000389535.1|462024_462249_+	hypothetical protein	NA	H0USX6	Bacillus_phage	100.0	8.3e-30
WP_014895309.1|462324_462750_+|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	100.0	5.7e-72
WP_001068398.1|462808_463450_+	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	88.9	2.3e-109
WP_000924202.1|464060_464642_-	hypothetical protein	NA	H0USX8	Bacillus_phage	100.0	1.8e-100
WP_000043393.1|464930_465509_-	type IV secretory system conjugative DNA transfer family protein	NA	H0USX9	Bacillus_phage	100.0	2.6e-107
WP_001033468.1|465478_465697_-	hypothetical protein	NA	A0A288WFV9	Bacillus_phage	48.3	5.6e-07
WP_000834294.1|465693_465894_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	47.7	1.0e-07
WP_001257567.1|466067_466385_+	hypothetical protein	NA	H0USY0	Bacillus_phage	100.0	9.9e-53
WP_000170782.1|466381_466564_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	3.0e-22
WP_014895307.1|466679_467861_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	100.0	7.3e-226
WP_000548071.1|467802_468423_+	hypothetical protein	NA	H0USY2	Bacillus_phage	100.0	6.5e-117
WP_000745810.1|468432_469263_-	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.6	6.7e-101
WP_000520485.1|470737_471343_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003310157.1|471623_472970_-	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	23.8	1.9e-20
WP_025989074.1|473995_476725_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	26.6	8.6e-12
WP_002162674.1|476876_477107_+	hypothetical protein	NA	NA	NA	NA	NA
477052:477068	attR	AAGAAGTGAAAAAAGTA	NA	NA	NA	NA
WP_033795298.1|477619_478888_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_000527920.1|479347_481555_+	S-layer protein	NA	NA	NA	NA	NA
WP_000819434.1|481880_482429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524430.1|483968_484304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088964.1|484561_484936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000481863.1|485956_487939_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.7	7.9e-15
WP_000116956.1|488250_489366_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	56.1	1.3e-112
WP_000934343.1|490528_491617_-	CDP-glucose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	27.9	3.3e-15
WP_000633065.1|491645_492605_-	NAD(P)-dependent oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	26.2	3.3e-19
WP_001087534.1|492659_494729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000864426.1|494749_495499_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_001046794.1|496062_496737_-	papain-like cysteine peptidase	NA	NA	NA	NA	NA
WP_000619983.1|497147_498275_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_000527367.1|498271_499375_-	endospore germination permease	NA	NA	NA	NA	NA
WP_000055704.1|499376_500870_-	spore germination protein	NA	NA	NA	NA	NA
WP_001204206.1|501689_502733_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_000769023.1|504045_505422_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	36.2	1.3e-21
WP_001033598.1|505694_507110_-	phosphatidylinositol-specific phospholipase C	NA	NA	NA	NA	NA
WP_000782791.1|507524_508094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001183018.1|508846_510133_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001124407.1|510416_511184_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.8	1.1e-07
WP_001280560.1|511188_512592_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_000465155.1|512805_513831_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	34.2	1.3e-37
WP_000699376.1|513827_514790_+	NAD-dependent epimerase/dehydratase family protein	NA	M1IGU2	Acanthocystis_turfacea_Chlorella_virus	31.8	7.7e-32
WP_000251480.1|514789_515995_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2P1ELT3	Moumouvirus	34.5	1.6e-47
WP_000679359.1|515995_516991_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP009351	Bacillus thuringiensis HD1002 chromosome, complete genome	5491311	1809854	1816764	5491311		uncultured_Caudovirales_phage(33.33%)	8	NA	NA
WP_000783172.1|1809854_1811750_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	25.5	2.8e-46
WP_000165966.1|1811746_1812394_-	HD domain-containing protein	NA	S4W232	Pandoravirus	28.3	2.5e-10
WP_000499713.1|1812503_1813331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709202.1|1813650_1813776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000109862.1|1813772_1814846_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.0	6.9e-74
WP_000541075.1|1815032_1815380_+	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	27.1	2.5e-09
WP_000478848.1|1816026_1816290_-	hypothetical protein	NA	A0A218KBU4	Bacillus_phage	38.9	3.4e-06
WP_000427801.1|1816488_1816764_-	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	41.2	2.9e-08
>prophage 7
NZ_CP009351	Bacillus thuringiensis HD1002 chromosome, complete genome	5491311	2002938	2011793	5491311		Bacillus_phage(71.43%)	8	NA	NA
WP_001258546.1|2002938_2003808_-	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	44.6	5.6e-66
WP_002083265.1|2003937_2004192_-	hypothetical protein	NA	W8CYN0	Bacillus_phage	100.0	4.5e-40
WP_000818985.1|2004904_2005624_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001231613.1|2005851_2006925_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	99.7	3.7e-192
WP_000612415.1|2006921_2007599_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.6	3.0e-123
WP_000453881.1|2007639_2009400_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	99.2	1.5e-275
WP_001194308.1|2009636_2010401_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755524.1|2010500_2011793_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.3	2.9e-10
>prophage 8
NZ_CP009351	Bacillus thuringiensis HD1002 chromosome, complete genome	5491311	3193552	3201710	5491311		Bacillus_phage(66.67%)	8	NA	NA
WP_000487912.1|3193552_3195004_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	54.2	1.7e-139
WP_000831286.1|3195436_3195781_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	78.1	8.5e-42
WP_000277057.1|3195793_3196324_-	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	34.3	8.6e-17
WP_000738865.1|3196457_3197705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565487.1|3197880_3198558_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	2.9e-33
WP_000822548.1|3198569_3199961_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	2.6e-33
WP_000085772.1|3200126_3200648_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_114365429.1|3200723_3201710_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.4	4.2e-17
>prophage 9
NZ_CP009351	Bacillus thuringiensis HD1002 chromosome, complete genome	5491311	3540345	3548721	5491311		Synechococcus_phage(33.33%)	8	NA	NA
WP_000088579.1|3540345_3540933_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
WP_001262424.1|3540929_3541970_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.3	5.5e-68
WP_000879034.1|3542075_3543491_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.0	7.3e-55
WP_000055594.1|3543475_3545695_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	3.3e-163
WP_000666782.1|3545678_3546362_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|3546358_3546613_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170545.1|3546605_3547325_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000625687.1|3547413_3548721_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	1.1e-20
>prophage 10
NZ_CP009351	Bacillus thuringiensis HD1002 chromosome, complete genome	5491311	4801057	4808745	5491311		uncultured_Caudovirales_phage(16.67%)	9	NA	NA
WP_001036830.1|4801057_4802041_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	4.2e-17
WP_000403765.1|4802030_4802801_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	1.7e-13
WP_002162479.1|4802833_4803598_+	class B sortase	NA	NA	NA	NA	NA
WP_000587818.1|4803670_4803994_-	heme oxygenase	NA	NA	NA	NA	NA
WP_001255945.1|4804288_4805488_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	6.1e-71
WP_001014310.1|4805527_4805722_-	YwbE family protein	NA	NA	NA	NA	NA
WP_000018046.1|4806066_4806759_+	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	26.9	6.8e-06
WP_000247674.1|4806760_4807696_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.4e-24
WP_000221121.1|4807821_4808745_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	2.6e-45
>prophage 11
NZ_CP009351	Bacillus thuringiensis HD1002 chromosome, complete genome	5491311	4850946	4906667	5491311	protease,transposase,coat,tRNA	Klosneuvirus(25.0%)	51	NA	NA
WP_085960238.1|4850946_4852103_-|transposase	IS3-like element ISBt2 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	43.1	4.9e-33
WP_000475213.1|4852220_4852835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001983650.1|4853354_4853603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000358275.1|4853800_4854799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105215.1|4855108_4856386_+	trigger factor	NA	NA	NA	NA	NA
WP_000472289.1|4856649_4857909_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	1.0e-148
WP_000119171.1|4858015_4859686_+|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.5	8.7e-15
WP_000097281.1|4859868_4862199_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	7.3e-177
WP_000869118.1|4862195_4862792_+	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000359773.1|4862826_4863243_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000133913.1|4863245_4863698_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000547856.1|4864114_4865449_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000009002.1|4865466_4866300_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_001226404.1|4866315_4867245_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000992324.1|4867247_4868000_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001087080.1|4868020_4869010_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000712938.1|4869009_4870296_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_003256548.1|4870376_4871378_+	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000350651.1|4871412_4872438_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_000072243.1|4872921_4875567_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.0	5.5e-165
WP_000582072.1|4875660_4876962_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000360995.1|4877126_4878077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000720491.1|4878309_4878885_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_001013396.1|4878931_4879609_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000466736.1|4879766_4880786_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_001135484.1|4880827_4881679_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000975762.1|4881693_4882239_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000391514.1|4882274_4882961_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000503309.1|4882963_4883761_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000797477.1|4883894_4884641_+	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000599047.1|4884633_4885494_+	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_000855475.1|4885561_4886953_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000270907.1|4887118_4887427_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002082112.1|4887438_4887783_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000944957.1|4887786_4888077_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001003585.1|4888140_4888683_+	sporulation protein	NA	NA	NA	NA	NA
WP_000497121.1|4888687_4889974_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_002082113.1|4890162_4890870_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000865417.1|4890859_4891942_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000114530.1|4892035_4892812_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.6e-19
WP_001011408.1|4892786_4894709_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001026364.1|4894758_4896669_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000621701.1|4896765_4897617_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_000796367.1|4897794_4898265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000511662.1|4898456_4899104_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000812273.1|4899185_4899728_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000973781.1|4899727_4900870_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	29.2	8.5e-30
WP_001138541.1|4901022_4902552_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001092241.1|4902571_4903405_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_000025282.1|4903435_4904542_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_043333502.1|4904768_4906667_+|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
>prophage 12
NZ_CP009351	Bacillus thuringiensis HD1002 chromosome, complete genome	5491311	5049107	5071597	5491311	integrase,terminase	Bacillus_phage(75.0%)	25	5043422:5043437	5057053:5057068
5043422:5043437	attL	TATTGGTGGAATGTTT	NA	NA	NA	NA
WP_000237492.1|5049107_5050169_-|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	81.9	6.5e-165
WP_000466631.1|5051509_5052763_+	hypothetical protein	NA	H0UST6	Bacillus_phage	80.2	2.6e-173
WP_000351012.1|5053244_5053583_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	35.2	1.4e-09
WP_000817630.1|5053761_5054082_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001025461.1|5054277_5054475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277639.1|5054486_5054675_+	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	75.8	9.4e-19
WP_000801520.1|5054695_5055340_+	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	64.2	4.9e-75
WP_001175895.1|5055387_5056623_+	DEAD/DEAH box helicase	NA	A0A1B1P7L4	Bacillus_phage	86.5	8.2e-212
WP_001132421.1|5056612_5056930_+	hypothetical protein	NA	A0A1B1P7L0	Bacillus_phage	43.7	1.1e-11
WP_000665151.1|5056930_5057209_+	nuclease	NA	A0A1B1P7M6	Bacillus_phage	87.0	2.1e-43
5057053:5057068	attR	TATTGGTGGAATGTTT	NA	NA	NA	NA
WP_000195964.1|5057208_5059128_+	AAA family ATPase	NA	A0A1B1P7N0	Bacillus_phage	83.0	3.4e-281
WP_000268681.1|5059151_5059469_+	hypothetical protein	NA	A0A1B1P7N6	Bacillus_phage	75.2	5.1e-33
WP_000818339.1|5059468_5059960_+	DUF669 domain-containing protein	NA	A0A1B1P7N3	Bacillus_phage	93.9	2.8e-86
WP_014895342.1|5060023_5061712_+	hypothetical protein	NA	A0A1B1P7M5	Bacillus_phage	87.5	3.4e-301
WP_000417045.1|5061713_5061965_+	hypothetical protein	NA	A0A0A7AQI9	Bacillus_phage	38.7	7.1e-06
WP_000276479.1|5062172_5064038_+	DNA primase	NA	A0A1B1P7L5	Bacillus_phage	91.0	0.0e+00
WP_000483565.1|5064483_5064879_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	66.4	5.7e-42
WP_042992867.1|5065930_5066503_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.1	1.7e-42
WP_000161455.1|5066544_5067051_+	hypothetical protein	NA	A0A090DCM3	Clostridium_phage	51.6	2.9e-38
WP_042992865.1|5067094_5068510_+|terminase	phage terminase large subunit	terminase	U5PVG8	Bacillus_phage	70.2	9.8e-193
WP_000222861.1|5068506_5068737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124816.1|5068750_5068951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000467411.1|5069009_5071133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009041.1|5071133_5071346_+	hypothetical protein	NA	A0A1C8E971	Bacillus_phage	94.3	5.2e-34
WP_014895339.1|5071345_5071597_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	56.6	2.3e-20
>prophage 13
NZ_CP009351	Bacillus thuringiensis HD1002 chromosome, complete genome	5491311	5078478	5089721	5491311	bacteriocin	Bacillus_phage(100.0%)	11	NA	NA
WP_014895334.1|5078478_5083134_+	hypothetical protein	NA	A0A0A0RPU4	Bacillus_phage	33.6	4.7e-159
WP_000389432.1|5083232_5083457_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	76.4	2.7e-20
WP_000392441.1|5083523_5083754_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	87.8	1.6e-28
WP_000405774.1|5083753_5084458_+	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	86.1	2.0e-114
WP_000110514.1|5085371_5085965_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000403528.1|5085961_5086183_-	helix-turn-helix transcriptional regulator	NA	A0A0S2SXH7	Bacillus_phage	35.9	2.3e-08
WP_003256223.1|5086368_5086674_+	hypothetical protein	NA	A0A288WG38	Bacillus_phage	46.9	2.5e-21
WP_000170776.1|5086670_5086853_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	2.3e-22
WP_000891527.1|5086968_5088150_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	80.9	6.3e-185
WP_001025806.1|5088091_5088712_+	hypothetical protein	NA	H0USY2	Bacillus_phage	83.5	2.8e-99
WP_000730122.1|5088737_5089721_-	helix-turn-helix domain-containing protein	NA	A0A0S2MVF4	Bacillus_phage	75.8	4.5e-136
>prophage 1
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	0	3946	359439		Bacillus_phage(100.0%)	2	NA	NA
WP_000232874.1|1694_2879_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_000655504.1|3289_3946_-	hypothetical protein	NA	A0A223LKM8	Bacillus_phage	32.7	3.8e-14
>prophage 2
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	7982	10081	359439		Planktothrix_phage(50.0%)	2	NA	NA
WP_000706738.1|7982_8753_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	3.6e-32
WP_000410775.1|9877_10081_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.6	1.5e-17
>prophage 3
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	15462	17136	359439		Lactobacillus_phage(50.0%)	2	NA	NA
WP_001020813.1|15462_16350_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.4	3.5e-07
WP_000933896.1|16473_17136_+	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	43.8	2.4e-40
>prophage 4
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	25408	26107	359439		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000137754.1|25408_26107_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.9	8.1e-15
>prophage 5
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	38720	40268	359439		Clostridium_botulinum_phage(100.0%)	1	NA	NA
WP_000767377.1|38720_40268_-	hypothetical protein	NA	Q38196	Clostridium_botulinum_phage	37.6	3.3e-08
>prophage 6
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	43759	46417	359439		Streptococcus_phage(100.0%)	1	NA	NA
WP_000520755.1|43759_46417_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	26.1	3.3e-32
>prophage 7
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	54095	57740	359439		Bacillus_phage(66.67%)	3	NA	NA
WP_000289092.1|54095_54572_-	C40 family peptidase	NA	A0A0A0RPZ1	Bacillus_phage	53.4	3.7e-27
WP_001191655.1|54683_56507_-	maturase	NA	A0A0U4J920	Pseudomonas_phage	28.8	1.2e-28
WP_000550849.1|57077_57740_-	hypothetical protein	NA	A0A223LKM8	Bacillus_phage	40.6	1.0e-14
>prophage 8
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	74072	75992	359439		Lactobacillus_phage(50.0%)	2	NA	NA
WP_000615757.1|74072_74465_+	helix-turn-helix domain-containing protein	NA	A0A0P0IZG9	Lactobacillus_phage	38.3	8.6e-06
WP_003310553.1|74861_75992_-	hypothetical protein	NA	H0UST6	Bacillus_phage	36.9	6.0e-68
>prophage 9
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	97431	99743	359439		Clostridium_phage(50.0%)	2	NA	NA
WP_000867049.1|97431_97881_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0A8WJI9	Clostridium_phage	51.7	1.1e-36
WP_001097636.1|97877_99743_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2R2ZH54	Clostridioides_phage	45.4	8.4e-160
>prophage 10
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	105852	179155	359439	transposase,protease	Bacillus_phage(35.0%)	53	NA	NA
WP_000762743.1|105852_106251_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.2	2.6e-50
WP_000166246.1|106262_107375_+	helix-turn-helix domain-containing protein	NA	A0A286QQB7	Streptococcus_phage	45.5	5.1e-80
WP_001188811.1|107860_108607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001231608.1|108789_109722_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000893014.1|110350_111199_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_001038827.1|111986_112931_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001243463.1|113485_114538_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_000082758.1|114713_116069_-	amino acid permease	NA	NA	NA	NA	NA
WP_000690460.1|116732_117845_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_000628924.1|117841_118843_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_001284904.1|118937_120320_+	amino acid permease	NA	NA	NA	NA	NA
WP_000700712.1|120753_121779_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003256157.1|122338_124579_+	hypothetical protein	NA	G1FGA4	Mycobacterium_phage	47.3	1.2e-11
WP_043333206.1|125106_127473_+	DUF3472 domain-containing protein	NA	NA	NA	NA	NA
WP_043333208.1|127577_130313_+	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	25.9	4.4e-16
WP_000821353.1|130935_131097_+	six-cysteine peptide SCIFF	NA	NA	NA	NA	NA
WP_000581828.1|131157_132564_+	thioether cross-link-forming SCIFF peptide maturase	NA	A0A1L7N0Q5	Ralstonia_phage	23.0	1.9e-10
WP_000491774.1|132708_133104_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_000167466.1|133417_134323_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_085960238.1|134384_135541_-|transposase	IS3-like element ISBt2 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.7	3.5e-47
WP_000871007.1|135752_136727_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_000467334.1|137169_137400_-	helix-turn-helix transcriptional regulator	NA	S5MBY6	Brevibacillus_phage	43.2	9.4e-13
WP_043320231.1|138223_139681_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.2	4.4e-23
WP_000800736.1|139694_140360_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	5.1e-35
WP_000494781.1|141299_142493_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	32.3	5.1e-25
WP_001009326.1|142976_144407_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447831.1|144418_145105_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	1.1e-24
WP_001043921.1|145257_145530_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	60.0	3.5e-22
WP_000853266.1|145919_146162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000723694.1|146880_147225_+	BlaI/MecI/CopY family transcriptional regulator	NA	A0A0A8WJP7	Clostridium_phage	34.2	7.0e-12
WP_003255930.1|147284_148763_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000721293.1|149347_150658_-	phosphatidylinositol-specific phospholipase C	NA	NA	NA	NA	NA
WP_000726947.1|151374_151938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000686199.1|153480_154131_+	sugar phosphate isomerase	NA	NA	NA	NA	NA
WP_001194338.1|154504_155500_-	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_000619726.1|155766_157770_-	endochitinase	NA	M1H4X6	Acanthocystis_turfacea_Chlorella_virus	40.0	6.9e-43
WP_000586190.1|158504_159626_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.8	5.6e-175
WP_000439701.1|159977_161108_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000713538.1|162104_163103_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_000276016.1|163113_163767_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_001217721.1|164138_164390_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000074462.1|164407_165112_+	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	36.3	3.5e-34
WP_000232811.1|166313_167300_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000103758.1|167335_168136_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000818327.1|168154_169066_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_000250783.1|169267_169642_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_001021941.1|170038_171652_+	SH3 domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	54.3	4.3e-43
WP_000599693.1|172245_172548_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000616115.1|172861_173278_+	FosB family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	85.3	7.6e-53
WP_001053998.1|173736_175170_+|transposase	IS4-like element IS231F family transposase	transposase	NA	NA	NA	NA
WP_001086889.1|175889_176291_+	BlaI/MecI/CopY family transcriptional regulator	NA	A0A0A8WJP7	Clostridium_phage	30.4	5.0e-09
WP_000468909.1|176293_177430_+	peptidase M56	NA	NA	NA	NA	NA
WP_003254688.1|177976_179155_+	CapA family protein	NA	A0A0N9SJ77	Staphylococcus_phage	34.9	7.7e-58
>prophage 11
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	183137	253789	359439	transposase,protease	Bacillus_phage(72.22%)	56	NA	NA
WP_000053755.1|183137_183731_-|protease	cell envelope-bound metalloprotease (camelysin)	protease	NA	NA	NA	NA
WP_085961348.1|184995_186337_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	5.7e-33
WP_043320313.1|186707_186890_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1B1P7U8	Bacillus_phage	88.3	2.6e-21
WP_000141883.1|187596_187845_-	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	92.7	1.1e-35
WP_000981141.1|188508_189597_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	78.8	3.3e-164
WP_000196759.1|189854_190247_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_043320300.1|190384_190582_+	hypothetical protein	NA	A0A0A0RMG9	Bacillus_phage	45.5	5.6e-06
WP_000059259.1|192083_192491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000389273.1|193038_193287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001079532.1|193662_194016_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_000151822.1|194445_194664_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001080993.1|194656_195130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262251.1|195177_195717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001214614.1|195803_197567_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.4	5.5e-36
WP_000064032.1|197667_198108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536399.1|198109_198460_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000864837.1|200243_200645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954710.1|200978_201785_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000483139.1|202117_204097_+	DUF3472 domain-containing protein	NA	G1FGA4	Mycobacterium_phage	40.2	9.3e-08
WP_000424048.1|204818_205055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000264559.1|205177_205408_-	XRE family transcriptional regulator	NA	A0A1B1P883	Bacillus_phage	41.5	5.9e-07
WP_000958230.1|205627_205822_+	hypothetical protein	NA	W8CYN5	Bacillus_phage	56.2	2.7e-13
WP_000511835.1|205834_207001_+	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	83.2	3.7e-190
WP_001245886.1|206990_207602_+	hypothetical protein	NA	W8CZ47	Bacillus_phage	74.3	8.5e-85
WP_157453536.1|207705_207849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043333212.1|208022_209135_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_000064087.1|209131_210133_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_043333214.1|210480_213042_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_001033628.1|214274_215258_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_001224400.1|215605_216055_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001097425.1|216619_218566_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_000770306.1|218714_220670_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_000138688.1|220687_221635_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_000610358.1|222096_223329_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.1	1.0e-20
WP_000362061.1|223333_224026_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000454406.1|225543_226257_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	7.9e-34
WP_000581945.1|226253_228722_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110937.1|228757_228919_+	S-layer protein	NA	NA	NA	NA	NA
WP_000428522.1|230084_231494_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000066234.1|231468_232446_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000204906.1|233409_233703_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043333216.1|234291_234846_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003256943.1|235454_235733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805753.1|235771_236278_+	DUF3902 family protein	NA	NA	NA	NA	NA
WP_003256947.1|236687_237026_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	68.8	6.8e-36
WP_000160158.1|237274_237571_-|transposase	IS3 family transposase	transposase	A0A1B1P776	Bacillus_phage	32.0	1.5e-07
WP_001019437.1|237654_238299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001152303.1|238399_240055_-	aspartate aminotransferase family protein	NA	M1HWX9	Paramecium_bursaria_Chlorella_virus	31.1	2.8e-05
WP_000456654.1|240541_241468_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000659072.1|241833_249441_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.7	2.4e-160
WP_000720470.1|249680_250307_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_000273030.1|250503_250758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000517954.1|250822_251290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868981.1|251725_252115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077538.1|252331_253006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003258988.1|253552_253789_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	57.7	1.2e-07
>prophage 12
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	260573	261668	359439		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000681821.1|260573_261668_-	phosphodiester glycosidase family protein	NA	A0A1X9I9K5	Staphylococcus_phage	28.0	2.3e-08
>prophage 13
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	265613	266651	359439		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001057951.1|265613_266651_-	serine hydrolase	NA	A0A2P1N568	Mycobacterium_phage	21.9	3.5e-06
>prophage 14
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	280168	283474	359439		Enterobacteria_phage(50.0%)	4	NA	NA
WP_000697861.1|280168_281017_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.0	6.8e-32
WP_000770927.1|281062_282019_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	44.5	2.1e-77
WP_001226088.1|282015_282582_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	44.0	1.4e-36
WP_000676108.1|282607_283474_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.9	9.8e-103
>prophage 15
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	292351	297648	359439		Trichoplusia_ni_ascovirus(33.33%)	6	NA	NA
WP_000481737.1|292351_293098_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	1.1e-20
WP_000627588.1|293090_294041_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000281616.1|294037_294457_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000649291.1|294466_295624_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000129817.1|295643_296591_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.1	2.3e-28
WP_000848165.1|296625_297648_-	glycosyl transferase	NA	A0A1V0SDW6	Indivirus	29.8	1.5e-38
>prophage 16
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	304606	305316	359439		Marinitoga_camini_virus(50.0%)	2	NA	NA
WP_001033051.1|304606_304804_-	helix-turn-helix transcriptional regulator	NA	A0A142LP09	Marinitoga_camini_virus	44.1	5.6e-06
WP_000753230.1|304956_305316_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WFJ2	Clostridium_phage	50.6	5.4e-15
>prophage 17
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	314126	322922	359439		Klosneuvirus(25.0%)	6	NA	NA
WP_000276743.1|314126_315689_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	20.8	3.7e-07
WP_000987035.1|315690_317391_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.1	1.9e-25
WP_000405656.1|317956_319114_-	radical SAM protein	NA	NA	NA	NA	NA
WP_000260424.1|319249_319945_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_000333843.1|320239_322147_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1X9VNR2	Mimivirus	32.4	7.3e-34
WP_003257883.1|322163_322922_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.2	8.2e-21
>prophage 18
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	326883	329869	359439		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000262983.1|326883_328371_-	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	4.4e-26
WP_000429540.1|328387_329869_-	acyl--CoA ligase	NA	A0A2K9KZV5	Tupanvirus	26.0	2.4e-24
>prophage 19
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	336016	341495	359439	transposase	Bacillus_phage(75.0%)	7	NA	NA
WP_000792433.1|336016_337414_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	1.6e-25
WP_000722050.1|337403_338048_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	8.2e-30
WP_043320168.1|338173_338521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000473547.1|338654_339023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709194.1|339686_340106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167052.1|340175_340391_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	71.6	1.3e-19
WP_000712401.1|340787_341495_-|transposase	IS6-like element IS240C family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.9	6.0e-42
>prophage 20
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	344611	345292	359439		Planktothrix_phage(100.0%)	1	NA	NA
WP_000447828.1|344611_345292_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.3e-21
>prophage 21
NZ_CP009349	Bacillus thuringiensis HD1002 plasmid 1, complete sequence	359439	351940	357184	359439		Sinorhizobium_phage(50.0%)	3	NA	NA
WP_000435488.1|351940_352474_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	25.9	4.4e-05
WP_000598100.1|353345_353549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000822719.1|354937_357184_-	hypothetical protein	NA	G1FGA4	Mycobacterium_phage	44.0	6.0e-11
>prophage 1
NZ_CP009348	Bacillus thuringiensis HD1002 plasmid 2, complete sequence	349602	117203	127003	349602		Bacillus_phage(83.33%)	15	NA	NA
WP_003298979.1|117203_120497_+	DNA polymerase I	NA	S4U8J4	Listeria_phage	23.2	1.7e-25
WP_001198496.1|120544_120925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000565922.1|121276_121495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000727297.1|121681_122767_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_003298982.1|122855_123176_+	hypothetical protein	NA	R4JDU4	Bacillus_phage	40.0	4.0e-09
WP_000442474.1|123419_123818_+	hypothetical protein	NA	U5J9G1	Bacillus_phage	39.3	2.4e-16
WP_000032377.1|123835_124033_+	hypothetical protein	NA	A0A218KBS9	Bacillus_phage	40.7	3.0e-07
WP_000085609.1|124039_124603_+	hypothetical protein	NA	A0A218KBS9	Bacillus_phage	48.2	2.0e-11
WP_003298987.1|124728_125208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000257080.1|125224_125569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000834751.1|125584_125884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033408.1|125897_126086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404429.1|126096_126612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135708.1|126624_126831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004734.1|126817_127003_+	hypothetical protein	NA	F8WPL1	Bacillus_phage	60.3	3.6e-15
>prophage 1
NZ_CP009347	Bacillus thuringiensis HD1002 plasmid 3, complete sequence	235425	79840	90817	235425		Bacillus_phage(55.56%)	14	NA	NA
WP_001031181.1|79840_81457_+	hypothetical protein	NA	A0A0K2FMB2	Brevibacillus_phage	41.0	1.4e-131
WP_000691718.1|81568_82648_+	ATP-binding protein	NA	A0A0E3D9S6	Bacillus_phage	77.4	2.9e-160
WP_000398537.1|82697_83087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173852.1|83155_84016_+	thymidylate synthase	NA	A0A0H3V0R8	Geobacillus_virus	47.7	1.3e-75
WP_000624473.1|84012_84531_+	dihydrofolate reductase	NA	A0A0E3D9G3	Bacillus_phage	40.4	1.5e-21
WP_000945823.1|84533_84743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000487831.1|84836_85727_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	48.1	1.8e-30
WP_003254307.1|85856_86054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000881565.1|86203_88165_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.4	9.6e-106
WP_001023489.1|88195_88678_+	dUTP diphosphatase	NA	Q332E8	Clostridium_botulinum_C_phage	43.0	2.4e-26
WP_000583728.1|88674_89289_+	dTMP kinase	NA	A0A1V0QGB5	Shearwaterpox_virus	29.9	6.0e-14
WP_001068334.1|89292_89772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000156298.1|89796_90075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000548555.1|90067_90817_+	hypothetical protein	NA	A7KV01	Bacillus_phage	40.7	1.6e-16
>prophage 2
NZ_CP009347	Bacillus thuringiensis HD1002 plasmid 3, complete sequence	235425	108794	144508	235425		Bacillus_phage(60.71%)	53	NA	NA
WP_000180796.1|108794_109610_+	phage repressor protein/antirepressor Ant	NA	A0A2D1GQG9	Lysinibacillus_phage	58.1	2.0e-20
WP_003254024.1|109685_110297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003310322.1|110391_110535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003254025.1|110540_110813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001146641.1|110838_111474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000477626.1|111486_111810_+	hypothetical protein	NA	A0A1I9S626	Bacillus_phage	61.9	1.7e-20
WP_000642957.1|111784_112018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000500661.1|112017_112272_+	hypothetical protein	NA	A0A076G7F3	Bacillus_phage	67.5	2.1e-29
WP_001208820.1|112614_113049_+	hypothetical protein	NA	A0A127AXQ6	Bacillus_phage	46.2	1.1e-17
WP_000504037.1|113089_113281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000483063.1|113391_113679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284343.1|113740_114169_+	nucleoside deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	38.1	3.1e-17
WP_000342987.1|114219_114429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000687311.1|114451_115279_+	metallophosphoesterase	NA	O64184	Bacillus_phage	66.9	4.2e-119
WP_001053438.1|115389_115581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186693.1|115619_116045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000161131.1|116070_116874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000568325.1|117118_117373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000386129.1|117709_118150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001064689.1|118270_118993_+	hypothetical protein	NA	A7KUV4	Bacillus_phage	33.3	9.9e-16
WP_000499887.1|118967_120083_+	hypothetical protein	NA	A7XX66	Thermus_virus	28.9	9.3e-13
WP_003310329.1|120109_121315_+	AAA family ATPase	NA	A7KUV6	Bacillus_phage	44.7	1.9e-67
WP_000733263.1|121332_121581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427813.1|121583_122021_+	hypothetical protein	NA	A7KV30	Bacillus_phage	39.4	2.3e-23
WP_000209660.1|122042_122477_+	GatB/YqeY domain-containing protein	NA	NA	NA	NA	NA
WP_000593824.1|122531_123497_+	hypothetical protein	NA	A0A173GBG1	Bacillus_phage	46.1	6.9e-57
WP_000220506.1|123523_125059_+	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	67.8	4.0e-192
WP_014895378.1|125166_126048_+	nucleotide excision repair endonuclease	NA	A0A218KC00	Bacillus_phage	41.7	9.9e-18
WP_003254066.1|126178_126640_+	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	67.1	3.4e-54
WP_001008937.1|126636_126846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000996769.1|126861_127512_+	tellurium resistance protein TerE	NA	S5M8H7	Bacillus_phage	38.2	1.4e-29
WP_000290289.1|127563_128166_+	TerD family protein	NA	A0A2I7QY15	Vibrio_phage	40.6	7.4e-25
WP_001207091.1|128170_128398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000429546.1|128531_129281_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	42.0	1.6e-40
WP_003310334.1|129300_130371_+	phosphoesterase	NA	NA	NA	NA	NA
WP_000886924.1|130390_131116_+	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	32.5	1.7e-31
WP_000260123.1|131325_131847_+	hypothetical protein	NA	G3MBS8	Bacillus_virus	33.8	3.0e-14
WP_000145790.1|131932_133117_+	NupC family nucleoside transporter	NA	NA	NA	NA	NA
WP_000394584.1|133350_134247_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	46.6	1.1e-61
WP_000013355.1|134376_135015_+	sigma-70 family RNA polymerase sigma factor	NA	Q0SPI3	Clostridium_phage	35.9	9.3e-10
WP_000393454.1|135343_135730_+	Replication termination protein	NA	NA	NA	NA	NA
WP_000469986.1|135747_136026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001235407.1|136064_137162_-	tyrosine recombinase XerS	NA	A0A166YH27	Gordonia_phage	30.8	2.0e-07
WP_000634706.1|137346_137709_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	51.3	1.7e-29
WP_000019971.1|137690_139775_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	G3MBF2	Bacillus_virus	64.6	2.3e-267
WP_000626116.1|139793_140822_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	G3MBF3	Bacillus_virus	59.6	5.4e-108
WP_000404326.1|140854_141106_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_014895379.1|141105_141288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000386879.1|141553_141859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000138198.1|141851_142142_+	hypothetical protein	NA	A0A0S2SXU6	Bacillus_phage	60.2	1.5e-23
WP_000337749.1|142143_142398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130747.1|142394_143156_+	hypothetical protein	NA	X2JMW4	Bacillus_phage	62.2	7.3e-86
WP_000107146.1|143275_144508_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	58.4	2.1e-66
>prophage 1
NZ_CP009350	Bacillus thuringiensis HD1002 plasmid 4, complete sequence	107443	18330	73701	107443	transposase,integrase,protease	Bacillus_phage(33.33%)	38	54612:54631	74655:74674
WP_000070870.1|18330_19227_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_001179520.1|19839_20349_+	DUF4367 domain-containing protein	NA	NA	NA	NA	NA
WP_000476188.1|20406_20784_-	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
WP_042993035.1|21822_23034_+	replication initiation protein	NA	E5FFJ0	Burkholderia_phage	25.2	1.1e-14
WP_000429665.1|24047_24713_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_100910529.1|24830_24968_+	SapB/AmfS family lantipeptide	NA	NA	NA	NA	NA
WP_000370432.1|25036_27640_+	protein kinase/lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_000995328.1|28296_30003_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	37.4	2.1e-80
WP_000993663.1|30306_30660_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072051.1|30622_31189_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000984699.1|31185_31785_+	NDxxF motif lipoprotein	NA	NA	NA	NA	NA
WP_000235461.1|31905_34887_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	45.5	3.1e-257
WP_000690668.1|34899_35451_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	53.3	3.2e-43
WP_001196890.1|35751_36612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001064652.1|36687_37737_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_103656266.1|37895_38624_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_080548773.1|38611_39037_+	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_001053998.1|39363_40797_-|transposase	IS4-like element IS231F family transposase	transposase	NA	NA	NA	NA
WP_000278076.1|41647_42721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000898590.1|42739_44224_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	44.7	5.6e-114
WP_000414502.1|45933_52632_+	DNRLRE domain-containing protein	NA	NA	NA	NA	NA
WP_003310266.1|52649_53030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003263840.1|53046_53442_+	DUF4262 domain-containing protein	NA	NA	NA	NA	NA
WP_001284342.1|53666_54299_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	31.7	1.7e-16
54612:54631	attL	TAACGTACAATTTTCTTTTT	NA	NA	NA	NA
WP_001053998.1|54741_56175_+|transposase	IS4-like element IS231F family transposase	transposase	NA	NA	NA	NA
WP_000551390.1|57610_58693_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_001100118.1|58792_59683_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000503537.1|59868_61806_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_000164676.1|62530_63730_+	MFS transporter	NA	NA	NA	NA	NA
WP_000899477.1|64797_65373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006918384.1|65756_66191_+	DUF4879 domain-containing protein	NA	NA	NA	NA	NA
WP_014895382.1|66658_66970_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_042993006.1|67085_67793_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	45.1	2.5e-40
WP_001017689.1|67695_67944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156601.1|68217_69177_+	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_000406475.1|69333_70245_+	ETX/MTX2 family pore-forming toxin Cry60Aa	NA	NA	NA	NA	NA
WP_001143746.1|70384_73402_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	99.3	0.0e+00
WP_003254188.1|73473_73701_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	98.6	2.5e-34
74655:74674	attR	TAACGTACAATTTTCTTTTT	NA	NA	NA	NA
>prophage 1
NZ_CP009346	Bacillus thuringiensis HD1002 plasmid 5, complete sequence	14961	115	14578	14961		Bacillus_phage(100.0%)	22	NA	NA
WP_000538150.1|115_913_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A160LKP9	Bacillus_phage	100.0	1.5e-137
WP_001173934.1|928_1810_-	hypothetical protein	NA	A0A160LKP6	Bacillus_phage	100.0	1.7e-171
WP_000159134.1|1813_2728_-	hypothetical protein	NA	A0A161JRA8	Bacillus_phage	100.0	9.9e-146
WP_000819106.1|2740_3253_-	hypothetical protein	NA	A0A160LKQ7	Bacillus_phage	100.0	1.3e-91
WP_001162469.1|3200_3953_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A160LKR7	Bacillus_phage	100.0	3.4e-136
WP_001113796.1|3952_4567_-	hypothetical protein	NA	A0A160LKP5	Bacillus_phage	100.0	7.7e-78
WP_000384937.1|4570_4846_-	hypothetical protein	NA	A0A169E435	Bacillus_phage	100.0	1.7e-48
WP_001057983.1|5173_5605_-	hypothetical protein	NA	A0A160LKQ5	Bacillus_phage	100.0	6.4e-55
WP_000339993.1|5684_5891_-	hypothetical protein	NA	A0A160LKQ4	Bacillus_phage	100.0	2.5e-12
WP_000523935.1|5894_6125_-	hypothetical protein	NA	A0A160LLA6	Bacillus_phage	100.0	7.2e-37
WP_000068587.1|6166_7237_-	hypothetical protein	NA	A0A160LKS4	Bacillus_phage	100.0	2.7e-203
WP_000558559.1|7236_7491_-	hypothetical protein	NA	A0A160LKS3	Bacillus_phage	100.0	1.9e-38
WP_001013356.1|7804_8443_-	hypothetical protein	NA	A0A161J814	Bacillus_phage	100.0	3.0e-125
WP_014905374.1|8423_8732_-	hypothetical protein	NA	A0A160LKS9	Bacillus_phage	100.0	5.8e-58
WP_003257741.1|8788_9373_-	hypothetical protein	NA	A0A160LKS6	Bacillus_phage	100.0	5.3e-76
WP_003310637.1|9360_9798_-	hypothetical protein	NA	A0A160LKS8	Bacillus_phage	100.0	1.4e-25
WP_000957403.1|10383_10584_-	LexA repressor	NA	A0A161ISH4	Bacillus_phage	100.0	1.9e-30
WP_014905375.1|10599_12804_-	hypothetical protein	NA	A0A160LKS5	Bacillus_phage	100.0	0.0e+00
WP_001284666.1|12790_13528_-	hypothetical protein	NA	A0A160LKS7	Bacillus_phage	100.0	1.1e-131
WP_000991481.1|13586_13811_-	hypothetical protein	NA	A0A160LLB3	Bacillus_phage	100.0	4.0e-32
WP_000430104.1|13882_14386_-	hypothetical protein	NA	A0A160LKT4	Bacillus_phage	100.0	2.4e-85
WP_000040626.1|14401_14578_-	helix-turn-helix domain-containing protein	NA	Q7WSG8	Bacillus_phage	100.0	1.5e-23
