The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010247	Yersinia pestis Pestoides G chromosome, complete genome	4529728	1344187	1423557	4529728	transposase,tRNA,plate	Yellowstone_lake_phycodnavirus(18.18%)	58	NA	NA
WP_002210509.1|1344187_1347004_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.1	1.0e-63
WP_002210508.1|1347003_1347513_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_002228112.1|1347580_1348039_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210506.1|1348019_1348973_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_002210504.1|1349554_1350376_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_002224759.1|1350848_1352024_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	6.9e-51
WP_011191702.1|1352039_1355273_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_002210501.1|1355500_1356115_-	LysE family translocator	NA	NA	NA	NA	NA
WP_002210499.1|1356438_1357239_+	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_002210498.1|1357235_1357691_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002210497.1|1357840_1358323_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.6	4.7e-30
WP_071525509.1|1358711_1359026_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_011906415.1|1359152_1359617_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002210492.1|1359706_1360576_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	NA	NA	NA	NA
WP_002210491.1|1360592_1360970_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_002210490.1|1360983_1361802_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002210489.1|1361794_1362790_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_002210488.1|1362773_1364078_-	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_016674007.1|1364145_1366488_-	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_002210486.1|1366672_1367506_+	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_002210485.1|1367803_1368424_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_002214747.1|1369646_1370390_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_002210482.1|1370719_1371733_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002210481.1|1371743_1372304_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002210480.1|1372312_1373815_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002210479.1|1373977_1374496_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002210478.1|1374569_1375013_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002210477.1|1375045_1376890_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210476.1|1376882_1377866_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210475.1|1377883_1380472_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210474.1|1380575_1382924_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002224087.1|1382936_1385156_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|1385181_1386285_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|1386277_1386895_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214737.1|1386900_1387266_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210471.1|1387258_1387750_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002210470.1|1387869_1389225_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011906413.1|1389221_1390811_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210468.1|1394335_1394689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220588.1|1394944_1397851_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210466.1|1398295_1400665_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002210465.1|1400860_1401628_+	DedA family protein	NA	NA	NA	NA	NA
WP_002210464.1|1401696_1402407_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002214276.1|1402393_1404001_-	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002214274.1|1403976_1404969_-	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002210461.1|1405908_1407570_-	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002224086.1|1408233_1409415_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210456.1|1409655_1410258_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002210455.1|1410272_1411703_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210454.1|1411704_1412796_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210453.1|1412798_1414361_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210452.1|1414683_1414899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002216434.1|1415577_1416534_+	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002216437.1|1417087_1418893_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002209743.1|1418967_1420176_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_011906411.1|1420675_1422403_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	2.3e-58
WP_002424260.1|1422375_1422900_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002213775.1|1423098_1423557_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP010247	Yersinia pestis Pestoides G chromosome, complete genome	4529728	1602020	1681754	4529728	transposase,tRNA,plate	Escherichia_phage(25.0%)	54	NA	NA
WP_002209448.1|1602020_1604648_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.3	1.8e-78
WP_002209449.1|1604897_1605083_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_002209450.1|1606179_1606746_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_002209451.1|1606742_1607171_+	DedA family protein	NA	NA	NA	NA	NA
WP_002228236.1|1607253_1608813_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_002209453.1|1608980_1609496_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_002354744.1|1609584_1610865_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002209455.1|1610936_1611728_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002209456.1|1611893_1613255_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002209458.1|1613482_1613731_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011906406.1|1613752_1614301_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002222284.1|1614339_1615080_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002209461.1|1615160_1615508_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002209462.1|1615769_1616537_-	YdiY family protein	NA	NA	NA	NA	NA
WP_002223245.1|1618633_1619350_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_011901829.1|1620556_1621579_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|1621578_1622358_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002209465.1|1622624_1623746_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002228330.1|1623850_1625008_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_144406013.1|1625290_1625755_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_002209468.1|1626079_1626442_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_002209469.1|1626796_1627528_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002231132.1|1627663_1628641_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_002209471.1|1628642_1629374_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002217405.1|1629503_1632077_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	2.4e-128
WP_002218887.1|1632402_1632588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212076.1|1638782_1639712_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002212077.1|1640132_1641731_+	malate synthase A	NA	NA	NA	NA	NA
WP_002212078.1|1641777_1643085_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_002212079.1|1643340_1645068_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_002230619.1|1645187_1646030_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_011906136.1|1646244_1649940_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	4.6e-24
WP_032485879.1|1655013_1656702_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_011906137.1|1657269_1658655_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_002212085.1|1659024_1660671_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_011906138.1|1660805_1661213_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_002212087.1|1661355_1662246_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_002212088.1|1662259_1663837_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_011906139.1|1664023_1665235_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_002221973.1|1665822_1666059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212091.1|1666062_1667172_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	5.0e-27
WP_002212092.1|1667242_1668514_+	maltoporin	NA	NA	NA	NA	NA
WP_002212093.1|1668754_1669666_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_002212095.1|1670136_1670415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212097.1|1670566_1671085_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002212098.1|1671608_1672106_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002230616.1|1672173_1673655_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002212100.1|1673661_1674102_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_100067904.1|1675217_1676572_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002228704.1|1676622_1677366_+	type VI secretion protein ImpG	NA	NA	NA	NA	NA
WP_002213885.1|1677329_1678418_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002212103.1|1678543_1679860_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_002212104.1|1679859_1680405_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002212105.1|1680407_1681754_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 3
NZ_CP010247	Yersinia pestis Pestoides G chromosome, complete genome	4529728	1772721	1835045	4529728	transposase,protease,tail	uncultured_Mediterranean_phage(18.18%)	55	NA	NA
WP_002210082.1|1772721_1774167_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002210083.1|1774369_1777228_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210084.1|1777252_1780084_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210086.1|1780284_1780644_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_016674138.1|1780640_1781063_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	53.6	7.0e-30
WP_002214300.1|1781075_1781378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210089.1|1781511_1786002_-	toxin	NA	NA	NA	NA	NA
WP_002220204.1|1786058_1789652_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002210090.1|1789692_1792194_-	toxin	NA	NA	NA	NA	NA
WP_002214297.1|1792429_1793296_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210092.1|1793556_1794468_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002210093.1|1794770_1794974_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002210094.1|1794981_1795917_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210095.1|1795918_1797874_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002214288.1|1799803_1800277_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210098.1|1800281_1800563_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002210099.1|1800674_1801223_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210100.1|1801403_1802744_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011055205.1|1802992_1803637_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210102.1|1803844_1804231_+	cytochrome b562	NA	NA	NA	NA	NA
WP_002210103.1|1804470_1804881_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210104.1|1805233_1806901_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002215779.1|1806995_1808411_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210106.1|1808821_1809775_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002210107.1|1810008_1810485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210109.1|1810783_1811170_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|1811307_1811772_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|1811783_1812719_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|1813056_1813329_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|1813325_1814180_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|1814485_1814968_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|1815396_1816830_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_011906149.1|1816891_1817617_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|1817623_1818169_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|1818152_1818716_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|1818712_1819276_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|1819384_1820371_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_038893343.1|1820481_1821456_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|1821720_1822539_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|1822756_1823539_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|1823543_1824101_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|1824113_1824737_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|1824772_1825075_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|1825221_1825476_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|1825629_1826892_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|1827072_1828161_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002213775.1|1828386_1828845_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002218066.1|1828961_1830335_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002210130.1|1830605_1831010_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002210131.1|1831233_1832361_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210132.1|1832673_1833102_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210133.1|1833116_1833509_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002230558.1|1833505_1833703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210135.1|1833882_1834524_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002216203.1|1834529_1835045_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 4
NZ_CP010247	Yersinia pestis Pestoides G chromosome, complete genome	4529728	2070086	2151070	4529728	transposase,protease,tRNA,plate	Staphylococcus_phage(22.22%)	59	NA	NA
WP_002215902.1|2070086_2070737_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215900.1|2071187_2071583_+	lipoprotein	NA	NA	NA	NA	NA
WP_002213014.1|2073858_2074359_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_041175540.1|2074401_2075952_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|2075963_2077316_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|2077312_2077999_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|2077998_2079735_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|2079738_2080230_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002210013.1|2080647_2083296_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_011906172.1|2083292_2085641_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	1.2e-17
WP_002210009.1|2085656_2087954_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|2087940_2088708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016632.1|2088803_2089500_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210005.1|2090108_2090744_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|2092072_2094235_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210001.1|2094790_2095750_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210000.1|2095795_2097295_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002209999.1|2097327_2098311_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209998.1|2098393_2100427_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209997.1|2100530_2101631_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209995.1|2101947_2103024_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002230648.1|2103206_2103479_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002228057.1|2103656_2104772_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209991.1|2105109_2105829_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002209990.1|2105828_2106155_+	YggL family protein	NA	NA	NA	NA	NA
WP_002209989.1|2106265_2107192_+	glutaminase B	NA	NA	NA	NA	NA
WP_038905510.1|2108532_2117865_+	pore forming RTX toxin family protein	NA	NA	NA	NA	NA
WP_002209987.1|2118054_2119185_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002215614.1|2119177_2119771_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002215612.1|2119870_2120161_-	YggU family protein	NA	NA	NA	NA	NA
WP_002209984.1|2120157_2120712_-	YggT family protein	NA	NA	NA	NA	NA
WP_002209983.1|2120999_2121821_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002215609.1|2121953_2122652_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209981.1|2122671_2123796_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002209980.1|2123904_2125020_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209979.1|2125023_2125908_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209978.1|2126087_2126510_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209977.1|2126509_2127073_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209976.1|2127188_2128148_-	glutathione synthase	NA	NA	NA	NA	NA
WP_002209975.1|2128173_2128905_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209973.1|2129156_2129864_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002228653.1|2129961_2130474_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|2130666_2131821_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|2133027_2135007_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209968.1|2135166_2135487_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_071525520.1|2135520_2135631_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209967.1|2135776_2136529_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209965.1|2137019_2139014_+	transketolase	NA	NA	NA	NA	NA
WP_002213759.1|2139321_2139780_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209964.1|2140120_2141137_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002209963.1|2141239_2142403_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_002209962.1|2142522_2143602_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002209961.1|2144039_2144909_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_002209960.1|2145171_2145789_+	arginine exporter ArgO	NA	NA	NA	NA	NA
WP_002209959.1|2145978_2146758_+	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_002209958.1|2146768_2147677_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_002209957.1|2148018_2148675_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_002209956.1|2148981_2150223_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
WP_002213775.1|2150611_2151070_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP010247	Yersinia pestis Pestoides G chromosome, complete genome	4529728	2461110	2529845	4529728	transposase,protease,plate	Escherichia_phage(28.57%)	53	NA	NA
WP_002213775.1|2461110_2461569_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_001297096.1|2462729_2463509_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901829.1|2463508_2464531_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_002211286.1|2465164_2465353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220006.1|2465618_2466137_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_032485934.1|2466205_2467957_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002226586.1|2468167_2468623_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002213066.1|2469439_2470501_-	porin OmpA	NA	NA	NA	NA	NA
WP_002213065.1|2470858_2471365_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213064.1|2471593_2472229_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213063.1|2472330_2474469_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213062.1|2474498_2474945_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002221095.1|2475138_2477193_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213060.1|2477253_2477718_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213058.1|2477896_2478577_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213056.1|2478892_2479309_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213054.1|2479417_2479735_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213052.1|2479795_2480986_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213049.1|2481079_2481358_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002213046.1|2481409_2481739_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213039.1|2485384_2487802_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213038.1|2487955_2488702_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213036.1|2489432_2489651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213034.1|2489914_2490439_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213032.1|2490428_2491712_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|2491713_2492451_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011906264.1|2492466_2493705_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213026.1|2493697_2494417_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213025.1|2494418_2495171_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213024.1|2495173_2495962_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002228570.1|2496048_2496489_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213017.1|2496526_2496775_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002213016.1|2496873_2497722_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213014.1|2498710_2499211_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002214707.1|2499253_2500804_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213011.1|2500815_2502168_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|2502164_2502851_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002214568.1|2502850_2504587_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|2504590_2505082_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_042659392.1|2505469_2508112_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	2.8e-92
WP_002211928.1|2508114_2510463_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_013060322.1|2510478_2512779_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211930.1|2512775_2513549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211931.1|2513702_2513963_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002211932.1|2513978_2516162_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002214564.1|2516334_2516805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016674153.1|2518969_2520202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211936.1|2520198_2523621_+	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211937.1|2523664_2525266_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002211938.1|2525283_2526342_+	PAAR domain protein	NA	NA	NA	NA	NA
WP_002211939.1|2526356_2526812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211940.1|2527032_2528796_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_016674055.1|2528759_2529845_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP010247	Yersinia pestis Pestoides G chromosome, complete genome	4529728	3025533	3120554	4529728	transposase,terminase,lysis,tail,tRNA,integrase	Escherichia_phage(12.5%)	94	3036080:3036110	3075891:3075921
WP_002211184.1|3025533_3026232_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_087768167.1|3026969_3027077_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002220632.1|3027611_3029300_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_002211181.1|3029459_3030581_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|3030817_3031087_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211179.1|3031090_3031903_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002220631.1|3031927_3032614_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211743.1|3033334_3033607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215627.1|3033747_3034833_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211740.1|3034903_3035560_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211739.1|3035662_3036109_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
3036080:3036110	attL	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211738.1|3036135_3037374_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_011901829.1|3037443_3038466_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|3038465_3039245_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215632.1|3039412_3039673_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_071525537.1|3039972_3040722_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002211736.1|3040697_3041144_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_002211735.1|3041217_3041823_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002215636.1|3041823_3042213_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002215638.1|3042216_3042435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|3042483_3043047_+	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002211731.1|3043470_3043680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215644.1|3043676_3043952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002430108.1|3044197_3044395_+	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002211730.1|3044425_3044938_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002211729.1|3044922_3045381_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211727.1|3045926_3046640_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211725.1|3047096_3047732_+	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211724.1|3047762_3048212_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_011906214.1|3048221_3049712_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	76.5	7.8e-225
WP_002228445.1|3049711_3050440_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002228446.1|3050458_3051100_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002211721.1|3051100_3052213_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002211720.1|3052334_3053108_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211719.1|3053121_3054327_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211718.1|3054374_3054857_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211717.1|3054853_3055108_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211716.1|3055109_3055460_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211715.1|3055461_3056046_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|3056042_3056450_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|3056515_3057436_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|3057448_3057760_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071525538.1|3057807_3058068_+	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_011906212.1|3058068_3061584_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_002211710.1|3061586_3061928_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002213759.1|3062233_3062692_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002213775.1|3062943_3063402_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002211709.1|3063521_3064274_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002211708.1|3064276_3064987_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211706.1|3065969_3066401_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211705.1|3066524_3066692_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211704.1|3066765_3067773_+	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002214482.1|3067871_3068423_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211701.1|3068565_3068781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|3068836_3069457_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002359202.1|3069631_3069853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|3070028_3073232_+	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211697.1|3073231_3074230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211696.1|3074246_3075164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097608205.1|3075225_3075594_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002214492.1|3076004_3077177_-	MFS transporter	NA	NA	NA	NA	NA
3075891:3075921	attR	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211693.1|3077180_3078380_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002211692.1|3078396_3079137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214494.1|3080228_3080585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227934.1|3081001_3081532_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002211689.1|3081767_3083342_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002211688.1|3083585_3084305_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211687.1|3084522_3086058_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_011906208.1|3086523_3087828_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002216508.1|3087843_3089046_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211685.1|3089310_3090180_-	pirin family protein	NA	NA	NA	NA	NA
WP_002211684.1|3090377_3091283_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211683.1|3091317_3092436_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002216501.1|3092543_3093818_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_011906207.1|3093967_3095902_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002430110.1|3096345_3097095_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211679.1|3097167_3098043_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_011906206.1|3098356_3099352_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211677.1|3099699_3100113_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002217933.1|3100183_3100456_+	YeaC family protein	NA	NA	NA	NA	NA
WP_002211676.1|3100589_3101237_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002211675.1|3101251_3102268_-	asparaginase	NA	NA	NA	NA	NA
WP_011192431.1|3102384_3104235_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211673.1|3104397_3104949_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211670.1|3106180_3108106_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211669.1|3108102_3108393_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211668.1|3108405_3108792_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211667.1|3108889_3109696_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211665.1|3110505_3111366_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002230891.1|3113429_3114278_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	7.0e-13
WP_002210666.1|3114361_3114826_-	YchJ family protein	NA	NA	NA	NA	NA
WP_002210665.1|3116159_3117176_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210664.1|3117482_3118829_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002209743.1|3119345_3120554_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 7
NZ_CP010247	Yersinia pestis Pestoides G chromosome, complete genome	4529728	3391994	3450815	4529728	transposase,tRNA,protease,coat	Tupanvirus(18.18%)	52	NA	NA
WP_011906184.1|3391994_3394382_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002211832.1|3394395_3395379_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_152328947.1|3395735_3395783_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002211833.1|3395877_3396234_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016674119.1|3396271_3396469_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002227898.1|3396565_3397117_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_002211836.1|3397120_3399049_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.1e-127
WP_002216696.1|3399439_3399652_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_002211839.1|3400410_3400662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211840.1|3400980_3401664_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_002216686.1|3401785_3402448_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_002211842.1|3402659_3403628_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_002211843.1|3403624_3404515_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
WP_002211844.1|3404514_3405399_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_002211845.1|3405395_3406289_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_002216683.1|3406356_3406569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211846.1|3406593_3407469_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002211847.1|3407597_3408152_-	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_002220277.1|3408562_3409228_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_002209743.1|3409462_3410671_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|3410718_3411069_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|3411404_3412241_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|3412332_3413094_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210831.1|3413429_3415097_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210832.1|3415137_3416028_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|3416020_3416941_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|3416954_3418082_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|3418097_3419390_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|3419687_3420398_+	porin	NA	NA	NA	NA	NA
WP_016674211.1|3420931_3421480_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	5.2e-09
WP_002210838.1|3421683_3423075_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|3423289_3424141_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|3424525_3425317_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|3425503_3426670_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|3426996_3428364_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|3428417_3429221_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|3429217_3430381_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210844.1|3430377_3432990_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|3433071_3433851_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|3434003_3434546_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|3435203_3436085_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|3436539_3438612_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|3438631_3439345_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|3439440_3439938_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|3440169_3441417_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002216616.1|3441385_3444037_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|3444516_3445071_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|3445076_3445607_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|3445627_3446185_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210856.1|3446215_3446968_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210857.1|3447172_3449620_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011906287.1|3449825_3450815_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 8
NZ_CP010247	Yersinia pestis Pestoides G chromosome, complete genome	4529728	3765520	3835902	4529728	transposase,tRNA,plate	Escherichia_phage(53.85%)	55	NA	NA
WP_002209686.1|3765520_3766000_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002209685.1|3766080_3766887_-	ImpE family protein	NA	NA	NA	NA	NA
WP_002354537.1|3766906_3767749_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_002209684.1|3767754_3768015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011906308.1|3768113_3770393_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	2.9e-29
WP_002209681.1|3774521_3775358_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_001297096.1|3775373_3776153_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3776152_3777175_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211571.1|3777853_3779203_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002211572.1|3779206_3779746_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211573.1|3780019_3780505_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211574.1|3780830_3782333_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211575.1|3782356_3782881_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016674143.1|3782985_3783594_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211577.1|3783578_3784769_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|3784793_3786002_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002231031.1|3786023_3787574_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211579.1|3787701_3788463_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002211580.1|3788619_3789165_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002215317.1|3789365_3792041_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211582.1|3792823_3794704_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211584.1|3795822_3797004_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002215319.1|3797010_3798042_+	fimbrial protein	NA	NA	NA	NA	NA
WP_002211586.1|3798081_3799419_+	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
WP_016583104.1|3799415_3800081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211588.1|3800081_3801764_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011906313.1|3801760_3802243_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_002211590.1|3802600_3803203_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211594.1|3804464_3805559_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_002211596.1|3805887_3806907_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002215840.1|3806962_3808549_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211598.1|3808545_3809595_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
WP_002211599.1|3809667_3810192_-	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_002354621.1|3810658_3811138_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211601.1|3811367_3812216_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002211602.1|3813046_3815473_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.4	1.1e-255
WP_002211603.1|3815484_3816102_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211604.1|3816103_3816880_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002228419.1|3817237_3817834_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_002211606.1|3817830_3818400_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_002211607.1|3818645_3819302_-	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_002215846.1|3819298_3819655_-	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_002215847.1|3819681_3820353_-	lipoprotein	NA	NA	NA	NA	NA
WP_002211610.1|3820942_3821374_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002211611.1|3821468_3821993_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_011906314.1|3822218_3823454_-	alanine transaminase	NA	NA	NA	NA	NA
WP_002211614.1|3823719_3824967_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_002211615.1|3825044_3826016_-	glucokinase	NA	NA	NA	NA	NA
WP_002211616.1|3826196_3826673_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_002211617.1|3826775_3827654_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016674232.1|3827789_3828779_+	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002354622.1|3829048_3829363_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002211621.1|3829455_3830685_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002222185.1|3833540_3834956_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002213775.1|3835443_3835902_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP010247	Yersinia pestis Pestoides G chromosome, complete genome	4529728	4192632	4263214	4529728	transposase,coat,plate,tail	Vibrio_phage(16.67%)	59	NA	NA
WP_002213759.1|4192632_4193091_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208786.1|4193289_4194801_-	amino acid permease	NA	NA	NA	NA	NA
WP_002208788.1|4195058_4195931_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208790.1|4196588_4197677_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_002208791.1|4197840_4198698_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.0	6.9e-24
WP_002208792.1|4198768_4201240_-	fimbrial biogenesis usher protein PsaC	NA	NA	NA	NA	NA
WP_002208793.1|4201323_4202145_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002208794.1|4202271_4202748_-	adhesin PsaA	NA	NA	NA	NA	NA
WP_002216523.1|4203292_4203781_-	protein PsaF	NA	NA	NA	NA	NA
WP_002208796.1|4203777_4204422_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002208797.1|4204746_4206447_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002208798.1|4206461_4207400_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002208799.1|4207396_4208530_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_002208801.1|4208791_4209247_+	NUDIX domain-containing protein	NA	D9ICN3	Escherichia_virus	44.3	2.9e-05
WP_002208802.1|4209359_4210358_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208803.1|4210393_4211968_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	2.9e-12
WP_002208804.1|4212076_4213165_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208805.1|4213272_4213983_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_002208806.1|4214002_4215556_-	xylulokinase	NA	NA	NA	NA	NA
WP_016674066.1|4215559_4217044_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002208808.1|4217394_4218537_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002230767.1|4218533_4219499_+	C-terminal binding protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.3	5.2e-28
WP_002208810.1|4219509_4220325_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.6	8.8e-13
WP_002208811.1|4220393_4220648_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002208812.1|4221022_4222267_+	tryptophan permease	NA	NA	NA	NA	NA
WP_002228019.1|4222370_4222943_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_002208813.1|4223082_4224276_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002224659.1|4224860_4226333_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.5	4.9e-46
WP_002208819.1|4228013_4228997_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_002208820.1|4229055_4229757_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002208822.1|4230198_4230783_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	2.8e-13
WP_071525527.1|4231433_4232951_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_002208825.1|4233032_4234841_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208826.1|4234850_4235951_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_002208827.1|4235950_4236979_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002208828.1|4236980_4238573_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.3e-20
WP_002208829.1|4238633_4238978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208831.1|4239962_4241162_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.3e-23
WP_002208832.1|4241265_4241973_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002208833.1|4242506_4244264_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	2.3e-98
WP_002208834.1|4244425_4244710_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_002213775.1|4244848_4245307_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208835.1|4245507_4246512_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002208836.1|4246689_4246917_+	YejL family protein	NA	NA	NA	NA	NA
WP_002208837.1|4246944_4248741_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002230704.1|4248971_4249355_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208839.1|4249711_4250860_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_002208840.1|4250872_4251361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208841.1|4252060_4252423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208842.1|4252548_4253985_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208843.1|4254275_4255016_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208845.1|4255313_4256093_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208846.1|4256189_4256537_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002215458.1|4256533_4256794_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208847.1|4256790_4257927_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002208848.1|4257930_4258386_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208850.1|4258995_4260051_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208852.1|4260047_4261454_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208853.1|4261720_4263214_-|coat	coat protein	coat	NA	NA	NA	NA
>prophage 10
NZ_CP010247	Yersinia pestis Pestoides G chromosome, complete genome	4529728	4266392	4276422	4529728		Escherichia_phage(42.86%)	10	NA	NA
WP_002208859.1|4266392_4266683_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208860.1|4267279_4268074_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208861.1|4268049_4268862_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_116463120.1|4268864_4269560_-	aldolase	NA	A0A077SK32	Escherichia_phage	55.4	5.9e-58
WP_002208862.1|4269592_4270897_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002215470.1|4271107_4271587_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208864.1|4271860_4272583_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002208866.1|4272788_4273031_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208867.1|4273202_4274138_+	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_011906348.1|4274634_4276422_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
>prophage 11
NZ_CP010247	Yersinia pestis Pestoides G chromosome, complete genome	4529728	4299515	4356102	4529728	transposase,protease,holin,tRNA	Enterobacteria_phage(16.67%)	46	NA	NA
WP_002210815.1|4299515_4300025_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210814.1|4300082_4301276_-	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_002221775.1|4301894_4303103_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_002210812.1|4303359_4303902_-	membrane protein	NA	NA	NA	NA	NA
WP_002228030.1|4304259_4305702_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	4.9e-99
WP_002210810.1|4305769_4307950_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.1e-44
WP_002210809.1|4308219_4309335_+	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	2.1e-110
WP_002210807.1|4309746_4310637_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002210806.1|4310761_4310965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042659403.1|4312189_4313398_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	1.2e-50
WP_002210804.1|4314781_4316116_-	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_002353933.1|4316611_4317310_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210802.1|4317444_4318383_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	8.6e-20
WP_002210801.1|4318379_4319534_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011191984.1|4319794_4320727_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210799.1|4321462_4322317_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_002210798.1|4322527_4323943_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002210797.1|4323966_4324824_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_002223523.1|4324938_4325637_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.4e-12
WP_032465620.1|4325730_4326501_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	3.9e-10
WP_002210794.1|4326563_4327640_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_002210793.1|4327639_4329241_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_002210792.1|4329364_4330633_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210791.1|4331060_4331534_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
WP_002210790.1|4331779_4332661_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210789.1|4332663_4333524_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_011906354.1|4333626_4334556_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210787.1|4334592_4335429_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.1e-17
WP_002210786.1|4335636_4335885_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002210785.1|4336069_4337173_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_011906355.1|4337485_4337827_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_002210782.1|4337852_4338392_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_002210781.1|4338601_4340314_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002210780.1|4340434_4341370_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_002210778.1|4341708_4341888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228612.1|4341961_4342900_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210776.1|4343199_4344129_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002213759.1|4344543_4345002_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002214195.1|4345929_4346793_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|4347138_4347987_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|4348024_4348918_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|4349149_4351198_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|4351562_4352159_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002218281.1|4352216_4353689_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011906357.1|4353711_4355415_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	1.0e-55
WP_011906358.1|4355643_4356102_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP010247	Yersinia pestis Pestoides G chromosome, complete genome	4529728	4426629	4435771	4529728	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_002210709.1|4426629_4426830_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|4426829_4427372_+	ash family protein	NA	NA	NA	NA	NA
WP_011906363.1|4427364_4428324_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	2.8e-50
WP_002210707.1|4428320_4429409_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|4429757_4430072_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|4430077_4430395_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_011901829.1|4430999_4432022_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|4432021_4432801_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215393.1|4433693_4433879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212204.1|4434041_4434293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215390.1|4435003_4435771_+	esterase	NA	G1DB77	Mycobacterium_phage	36.0	3.4e-06
>prophage 1
NZ_CP010246	Yersinia pestis Pestoides G plasmid pCD, complete sequence	71525	7805	57373	71525	transposase	Escherichia_phage(33.33%)	51	NA	NA
WP_002209743.1|7805_9014_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002212987.1|9556_10477_-	type III secretion system translocon subunit YopD	NA	NA	NA	NA	NA
WP_002212985.1|10495_11701_-	type III secretion system translocon subunit YopB	NA	NA	NA	NA	NA
WP_002222758.1|11678_12185_-	type III secretion system chaperone LcrH	NA	NA	NA	NA	NA
WP_002212981.1|12197_13178_-	type III secretion system protein LcrV	NA	NA	NA	NA	NA
WP_002212973.1|13179_13467_-	type III secretion protein LcrG	NA	NA	NA	NA	NA
WP_002220918.1|13508_13949_-	type III secretion system regulator LcrR	NA	NA	NA	NA	NA
WP_002212971.1|13945_16060_-	type III secretion system export apparatus subunit SctV	NA	NA	NA	NA	NA
WP_002229791.1|16046_16391_-	type III secretion system chaperone YscY	NA	NA	NA	NA	NA
WP_002212969.1|16387_16756_-	type III secretion system protein YscX	NA	NA	NA	NA	NA
WP_002229794.1|16752_17124_-	type III secretion chaperone SycN	NA	NA	NA	NA	NA
WP_002212965.1|17110_17389_-	type III secretion system gatekeeper subunit TyeA	NA	NA	NA	NA	NA
WP_002212958.1|17369_18251_-	type III secretion system gatekeeper subunit YopN	NA	NA	NA	NA	NA
WP_011901825.1|18448_19768_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_002212952.1|19764_20229_+	type III secretion system central stalk protein YscO	NA	NA	NA	NA	NA
WP_011901824.1|20228_21596_+	type III secretion system needle length determinant	NA	NA	NA	NA	NA
WP_002212948.1|21592_22516_+	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_002212947.1|22512_23166_+	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_002212945.1|23167_23434_+	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_002212938.1|23430_24216_+	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_011901823.1|24215_25280_+	type III secretion system export apparatus switch protein YscU	NA	NA	NA	NA	NA
WP_002212931.1|26374_27190_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002229797.1|27268_27367_+	type III secretion system protein YscA	NA	NA	NA	NA	NA
WP_002212925.1|27592_28006_+	type III secretion system chaperone YscB	NA	NA	NA	NA	NA
WP_002212923.1|28011_29835_+	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_002212919.1|29831_31091_+	type III secretion system inner membrane ring subunit SctD	NA	NA	NA	NA	NA
WP_002212917.1|31087_31288_+	EscE/YscE/SsaE family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_002212916.1|31288_31552_+	type III secretion system needle filament subunit SctF	NA	NA	NA	NA	NA
WP_011901822.1|31553_31901_+	YscG family type III secretion protein	NA	NA	NA	NA	NA
WP_002212915.1|31897_32395_+	YopR family type III secretion effector	NA	NA	NA	NA	NA
WP_002212914.1|32395_32743_+	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_002212912.1|32749_33484_+	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_002361471.1|33483_34113_+	type III secretion system sorting platform protein YscK	NA	NA	NA	NA	NA
WP_002212909.1|34091_34724_+	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_002212907.1|34948_35296_+	type III secretion system exported negative regulator LcrQ/YscM1	NA	NA	NA	NA	NA
WP_011906282.1|36828_37851_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.6e-200
WP_001297096.1|37850_38630_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901819.1|39344_40751_-	T3SS effector protein-tyrosine-phosphatase YopH	NA	NA	NA	NA	NA
WP_002213287.1|42433_43300_-	type III secretion system effector acetyltransferase YopJ	NA	NA	NA	NA	NA
WP_002213290.1|43695_45894_-	T3SS effector protein kinase YopO/YpkA	NA	NA	NA	NA	NA
WP_002233145.1|45911_46340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213291.1|47085_47325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213292.1|48497_49376_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_002233140.1|49356_49431_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_002229817.1|49672_49927_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_002233137.1|50064_50313_-	phospholipase	NA	A0A1B2LRT6	Wolbachia_phage	47.1	9.2e-06
WP_002213294.1|50729_51137_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	4.7e-07
WP_002213008.1|51160_51478_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|51649_52108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469136.1|52176_52446_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011901828.1|55057_57373_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.5	2.9e-279
>prophage 1
NZ_CP010248	Yersinia pestis Pestoides G plasmid pMT	136889	0	84732	136889	transposase,tail,terminase	Salmonella_phage(81.33%)	87	NA	NA
WP_042659405.1|0_938_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	58.4	2.3e-28
WP_002211756.1|1185_1461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215065.1|1483_2425_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211754.1|2490_3111_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215068.1|3310_3637_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211753.1|3636_3864_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002211752.1|4165_5371_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002215070.1|5367_6339_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002228775.1|6717_8115_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002211750.1|8276_8477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|8977_9655_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211748.1|9654_9876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|9886_10306_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211747.1|10359_11139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211746.1|11537_12044_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211745.1|12756_12987_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211744.1|13059_15069_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_011906282.1|15192_16215_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.6e-200
WP_001297096.1|16214_16994_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|17127_17736_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|18037_20926_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|21006_21585_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_011901830.1|21641_26273_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.7	0.0e+00
WP_002211773.1|26294_26882_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|26869_27667_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_011901831.1|27659_28358_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	6.4e-137
WP_000440566.1|28447_28783_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|28824_33402_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|33409_33634_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|33759_34077_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|34136_34883_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|34957_35341_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|35342_35816_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|35806_36151_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|36248_37082_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|37081_37516_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|37559_38222_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|38296_39172_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002231160.1|39198_40095_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_025476623.1|40117_41692_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.4	6.4e-302
WP_002211787.1|41725_42982_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|42984_43626_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|43821_44088_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|44097_44988_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|44993_45248_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|45240_45879_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|45875_46544_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|46543_47242_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|47318_48878_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|48880_49159_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|49218_49641_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|49645_50173_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|50496_51147_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|51231_51459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213759.1|51684_52143_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002211801.1|52818_53301_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|53506_53788_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213775.1|53987_54446_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_011901832.1|54684_55440_-	hypothetical protein	NA	J9Q742	Salmonella_phage	98.4	3.8e-135
WP_002231164.1|55638_56781_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_002231165.1|56888_59204_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	98.8	0.0e+00
WP_011201798.1|59281_59851_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	3.8e-103
WP_002213303.1|59863_60610_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_038918515.1|60599_60959_-	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213300.1|62745_63831_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002213298.1|64246_65269_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002389821.1|65628_65853_-	hypothetical protein	NA	J9Q739	Salmonella_phage	97.3	1.5e-34
WP_002214164.1|67037_68102_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|68670_68883_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|68882_69218_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|69214_69394_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|69434_69710_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|69777_70188_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|70171_70543_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|70696_71527_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|71530_71731_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|71821_72853_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|72900_73167_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|73166_74111_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|74171_75200_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|75319_75751_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|75971_76223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011201800.1|76295_76859_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	65.1	2.6e-64
WP_002425587.1|76888_77314_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|77328_80853_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
WP_002211767.1|81033_82269_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|82365_84732_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
