The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	0	4079	4742580		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_012105682.1|1730_4079_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
>prophage 2
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	16141	23640	4742580		uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_011191719.1|16141_19048_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	6.8e-23
WP_012105679.1|19528_21898_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002210465.1|22093_22861_+	DedA family protein	NA	NA	NA	NA	NA
WP_012105678.1|22929_23640_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.6	4.5e-21
>prophage 3
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	38347	42340	4742580		Catovirus(50.0%)	2	NA	NA
WP_012105674.1|38347_40153_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	6.1e-38
WP_002228103.1|40612_42340_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
>prophage 4
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	68284	71963	4742580		Rhizoctonia_fumigata_mycovirus(50.0%)	5	NA	NA
WP_002210424.1|68284_68671_+	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002209317.1|68840_69047_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_012105671.1|69254_70007_-	cell division protein ZapD	NA	NA	NA	NA	NA
WP_002209319.1|70003_70624_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002209320.1|70919_71963_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	6.3e-104
>prophage 5
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	86752	88177	4742580		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_002209332.1|86752_88177_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.0e-40
>prophage 6
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	95963	100335	4742580		Mamastrovirus(33.33%)	4	NA	NA
WP_042659412.1|95963_97565_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	45.3	8.9e-17
WP_011191748.1|97784_98321_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_002209342.1|98510_99173_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_011191749.1|99408_100335_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.7	5.9e-21
>prophage 7
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	105548	107544	4742580		Pandoravirus(50.0%)	2	NA	NA
WP_002209351.1|105548_106028_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	43.2	1.4e-18
WP_002228219.1|106035_107544_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	30.6	6.2e-28
>prophage 8
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	110872	117139	4742580		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_041175890.1|110872_113434_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.8	7.8e-39
WP_012105654.1|113542_116023_+	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_012105653.1|116344_117139_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	29.0	2.1e-14
>prophage 9
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	123769	124114	4742580		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_002209365.1|123769_124114_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.0	3.5e-27
>prophage 10
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	128550	132947	4742580	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_012105650.1|128550_129996_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.6	3.6e-25
WP_012105649.1|130154_132947_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.5	5.9e-48
>prophage 11
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	136858	141588	4742580		Only_Syngen_Nebraska_virus(25.0%)	4	NA	NA
WP_002209376.1|136858_138496_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	5.0e-156
WP_011191770.1|138576_139872_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.5	9.7e-131
WP_042659414.1|140243_140813_+	superoxide dismutase	NA	Q9MC02	Salmonella_phage	58.7	1.6e-56
WP_002209379.1|140916_141588_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	28.8	1.9e-13
>prophage 12
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	146977	147385	4742580		Haemophilus_virus(100.0%)	1	NA	NA
WP_002209383.1|146977_147385_-	HicB family protein	NA	Q775F5	Haemophilus_virus	40.0	5.4e-19
>prophage 13
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	150802	152882	4742580		Hokovirus(50.0%)	2	NA	NA
WP_042659813.1|150802_152239_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.7	4.2e-34
WP_012105644.1|152240_152882_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.3	5.9e-28
>prophage 14
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	156416	166743	4742580		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_011191778.1|156416_157181_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	4.2e-57
WP_002209395.1|157174_157801_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	9.1e-34
WP_012105642.1|157922_158906_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	2.3e-07
WP_011191780.1|158960_159959_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	3.6e-32
WP_011191781.1|160488_163044_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	3.4e-26
WP_002209402.1|163866_164322_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_002209403.1|164793_165909_+	erythritol/L-threitol dehydrogenase	NA	NA	NA	NA	NA
WP_002209404.1|165972_166743_+	D-threitol dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.9	2.5e-17
>prophage 15
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	170158	171874	4742580		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_011191783.1|170158_171448_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.8	2.0e-168
WP_002209409.1|171532_171874_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	1.3e-21
>prophage 16
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	176096	178193	4742580		Acinetobacter_phage(100.0%)	1	NA	NA
WP_002223222.1|176096_178193_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.9	7.6e-08
>prophage 17
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	188028	189543	4742580		Bacillus_virus(100.0%)	1	NA	NA
WP_012105632.1|188028_189543_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	3.3e-13
>prophage 18
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	193795	199365	4742580		Escherichia_phage(100.0%)	5	NA	NA
WP_012105630.1|193795_196246_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.6	2.8e-219
WP_002209428.1|196257_196875_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	1.8e-74
WP_012105629.1|196876_197737_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.3	1.4e-21
WP_012105628.1|197896_198577_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.1	3.5e-23
WP_011191798.1|198834_199365_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	42.1	1.6e-15
>prophage 19
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	204370	205894	4742580		Staphylococcus_phage(100.0%)	1	NA	NA
WP_042659417.1|204370_205894_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	9.1e-19
>prophage 20
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	215048	221230	4742580	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_002209445.1|215048_215537_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.0	2.6e-28
WP_011191806.1|215651_216722_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.3	4.1e-111
WP_011191807.1|217479_218028_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_012105619.1|218167_220795_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.5	7.9e-79
WP_002209449.1|221044_221230_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
>prophage 21
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	232069	232528	4742580	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_002213775.1|232069_232528_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 22
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	236646	237717	4742580		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_002228238.1|236646_237717_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	1.5e-89
>prophage 23
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	243898	246472	4742580		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002217405.1|243898_246472_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	2.4e-128
>prophage 24
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	258048	258486	4742580		Streptomyces_phage(100.0%)	1	NA	NA
WP_012105609.1|258048_258486_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	36.6	3.4e-11
>prophage 25
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	272270	273017	4742580		Planktothrix_phage(100.0%)	1	NA	NA
WP_002208732.1|272270_273017_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	3.4e-35
>prophage 26
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	296827	297409	4742580		Caulobacter_phage(100.0%)	1	NA	NA
WP_002208720.1|296827_297409_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	3.7e-13
>prophage 27
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	314155	321531	4742580	holin	Streptococcus_phage(50.0%)	7	NA	NA
WP_002208705.1|314155_315760_-	chitin-binding domain protein	NA	Q9J8B0	Spodoptera_exigua_multiple_nucleopolyhedrovirus	31.0	2.3e-20
WP_002216043.1|315956_316262_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	46.2	2.0e-10
WP_002208704.1|316688_317147_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002208703.1|317273_318521_+	esterase FrsA	NA	NA	NA	NA	NA
WP_002208702.1|318580_318982_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_002208701.1|319158_320262_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.6	1.5e-60
WP_011191846.1|320271_321531_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.6	2.7e-93
>prophage 28
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	326907	336763	4742580		Bacillus_phage(50.0%)	6	NA	NA
WP_002208691.1|326907_327819_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	65.5	7.9e-103
WP_002208690.1|328151_329066_+	fructokinase	NA	NA	NA	NA	NA
WP_012105590.1|329534_333224_-	AAA family ATPase	NA	G3MAB6	Bacillus_virus	26.1	2.2e-10
WP_012105589.1|333220_334465_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_002208685.1|334732_335422_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.1	1.7e-36
WP_012105588.1|335446_336763_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	29.2	2.1e-27
>prophage 29
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	346753	347212	4742580	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_002213759.1|346753_347212_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 30
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	350313	358681	4742580	tRNA	uncultured_Mediterranean_phage(60.0%)	8	NA	NA
WP_002208672.1|350313_351438_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	3.2e-90
WP_002208671.1|351549_351885_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.6	6.4e-10
WP_002208670.1|351912_353760_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002208669.1|353770_354739_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.7	1.9e-46
WP_032466145.1|355720_356314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208668.1|356384_356834_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_012105578.1|356965_358075_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	1.2e-49
WP_002208666.1|358210_358681_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.7	3.5e-30
>prophage 31
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	381447	386587	4742580	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_002208642.1|381447_382071_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	1.7e-64
WP_002208641.1|382276_383548_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.2	7.3e-131
WP_002208640.1|383742_386097_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.9	4.5e-227
WP_002208639.1|386314_386587_+	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	59.6	3.5e-22
>prophage 32
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	390206	390905	4742580		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_002208635.1|390206_390905_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	70.5	2.1e-87
>prophage 33
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	395771	399354	4742580		Bacillus_phage(100.0%)	2	NA	NA
WP_011191870.1|395771_397538_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	2.4e-47
WP_042659425.1|397530_399354_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	4.2e-39
>prophage 34
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	418639	431624	4742580		Klosneuvirus(20.0%)	11	NA	NA
WP_012105567.1|418639_419203_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.5	2.7e-29
WP_012105566.1|419858_421835_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.6	3.4e-42
WP_002208604.1|421890_422223_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002208603.1|422222_422828_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_002208601.1|423019_424894_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.2	2.4e-114
WP_002208600.1|425120_425765_+	adenylate kinase	NA	NA	NA	NA	NA
WP_002208599.1|425854_426817_+	ferrochelatase	NA	NA	NA	NA	NA
WP_011191878.1|427414_428404_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	A0A1D8KSN6	Synechococcus_phage	44.7	1.9e-09
WP_002208597.1|428441_429215_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_012304495.1|429219_430293_+	CDP-glucose 4,6-dehydratase	NA	NA	NA	NA	NA
WP_011191881.1|430310_431624_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	3.1e-52
>prophage 35
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	440104	445900	4742580		Acanthocystis_turfacea_Chlorella_virus(20.0%)	5	NA	NA
WP_011191888.1|440104_441226_+	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.4	5.8e-132
WP_002223297.1|441231_442197_+	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	47.9	2.1e-82
WP_012105563.1|442369_443776_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.3	5.4e-50
WP_012105562.1|443778_444522_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.8	8.6e-07
WP_011191889.1|444526_445900_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.9	5.3e-34
>prophage 36
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	456284	459170	4742580		uncultured_virus(100.0%)	1	NA	NA
WP_011191893.1|456284_459170_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.8	7.8e-112
>prophage 37
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	464250	464937	4742580		Planktothrix_phage(100.0%)	1	NA	NA
WP_011191895.1|464250_464937_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.1e-31
>prophage 38
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	470745	475900	4742580	integrase,tRNA	Acanthamoeba_polyphaga_mimivirus(33.33%)	8	473120:473133	475931:475944
WP_024063201.1|470745_472131_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.7	1.3e-40
WP_002209775.1|472352_472565_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002209774.1|472579_473446_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
473120:473133	attL	TTTAACGTTATCAA	NA	NA	NA	NA
WP_041175786.1|473813_473996_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_011191898.1|474254_474455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042659428.1|474568_475216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215266.1|475200_475539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080869027.1|475621_475900_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	77.4	4.0e-34
475931:475944	attR	TTTAACGTTATCAA	NA	NA	NA	NA
>prophage 39
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	485006	485858	4742580		Staphylococcus_phage(100.0%)	1	NA	NA
WP_042659430.1|485006_485858_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.8	6.1e-49
>prophage 40
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	502866	503112	4742580		Vibrio_phage(100.0%)	1	NA	NA
WP_002209745.1|502866_503112_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	7.2e-19
>prophage 41
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	515013	520834	4742580		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_041175886.1|515013_516939_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.7	3.4e-23
WP_012105533.1|517232_518219_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_002210300.1|518308_519238_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012105532.1|519286_520834_+	sugar ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	28.0	5.1e-09
>prophage 42
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	527463	529254	4742580		Bacillus_phage(100.0%)	1	NA	NA
WP_012105529.1|527463_529254_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	29.3	1.7e-48
>prophage 43
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	533626	534642	4742580		Morganella_phage(50.0%)	2	NA	NA
WP_002210315.1|533626_533836_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
WP_012105525.1|534258_534642_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	58.3	8.1e-25
>prophage 44
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	538195	540883	4742580		Stx2-converting_phage(50.0%)	2	NA	NA
WP_011191931.1|538195_539398_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	51.8	7.7e-106
WP_002210324.1|539800_540883_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.9	3.7e-14
>prophage 45
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	545046	568579	4742580	integrase,tail,tRNA	Salmonella_phage(33.33%)	27	544959:544981	561837:561859
544959:544981	attL	GCTTTACCTTGCAAAGGTTCCCC	NA	NA	NA	NA
WP_042659435.1|545046_546123_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	47.6	2.1e-94
WP_071880053.1|546088_546334_-	hypothetical protein	NA	K7PKU2	Enterobacteria_phage	40.5	3.3e-08
WP_042659436.1|546470_546674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042659437.1|546673_546967_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	37.5	3.1e-08
WP_042659438.1|547074_547338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071880054.1|547548_547869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042659440.1|548057_548396_+	DUF1659 domain-containing protein	NA	A0A2R3UAN5	Myoviridae_environmental_samples	51.0	1.8e-20
WP_042659441.1|548625_550242_+	bacteriophage TerL protein	NA	A9YWZ6	Burkholderia_phage	72.8	8.2e-236
WP_042659442.1|551496_551904_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	56.7	9.1e-27
WP_162472804.1|551915_552089_+	lytic transglycosylase	NA	NA	NA	NA	NA
WP_042659443.1|552081_554100_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	61.4	5.1e-227
WP_042659444.1|554110_554692_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	66.0	2.5e-62
WP_080869057.1|554805_554997_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	43.3	8.9e-09
WP_042659446.1|555049_556066_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	62.1	1.3e-125
WP_042659447.1|556062_556419_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	68.8	6.6e-21
WP_042659448.1|556421_556868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042659449.1|556920_557664_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	59.4	7.9e-77
WP_042659450.1|557660_558014_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	72.6	2.7e-43
WP_042659451.1|558014_559202_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	56.8	2.8e-116
WP_042659452.1|559201_559876_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	46.0	7.5e-50
WP_052491434.1|561001_561547_+|tail	tail assembly chaperone	tail	B6Z9I1	Kluyvera_phage	27.7	2.2e-07
WP_002210330.1|562072_562735_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
561837:561859	attR	GCTTTACCTTGCAAAGGTTCCCC	NA	NA	NA	NA
WP_002210331.1|562724_563759_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_002210332.1|563755_564379_-	LPS assembly lipoprotein LptE	NA	NA	NA	NA	NA
WP_002210333.1|564393_566976_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	4.3e-186
WP_002210335.1|567237_567720_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002210336.1|567853_568579_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	5.8e-32
>prophage 46
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	574901	575957	4742580		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002354474.1|574901_575957_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.7	1.6e-46
>prophage 47
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	580638	582303	4742580		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002210348.1|580638_582303_-	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	39.4	3.0e-84
>prophage 48
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	589337	591005	4742580	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_002210354.1|589337_591005_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	86.9	8.9e-294
>prophage 49
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	599004	603095	4742580	integrase	Mycobacterium_phage(33.33%)	5	595507:595521	608653:608667
595507:595521	attL	TATGAAGTTAACCCA	NA	NA	NA	NA
WP_012105497.1|599004_599772_-	esterase	NA	G1DB77	Mycobacterium_phage	35.1	2.6e-06
WP_002212204.1|600482_600734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041175783.1|600896_601082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012105495.1|601476_602007_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	46.3	4.1e-35
WP_002210714.1|602612_603095_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	3.4e-28
608653:608667	attR	TGGGTTAACTTCATA	NA	NA	NA	NA
>prophage 50
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	618967	620512	4742580	transposase	Tupanvirus(50.0%)	2	NA	NA
WP_002210729.1|618967_619840_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	34.7	3.6e-20
WP_002213759.1|620053_620512_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 51
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	632915	636195	4742580		Vibrio_phage(33.33%)	3	NA	NA
WP_002210742.1|632915_633641_+	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	28.6	8.7e-20
WP_002210743.1|633755_634694_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	42.0	1.2e-10
WP_002223549.1|635142_636195_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.7	1.3e-80
>prophage 52
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	641377	645279	4742580	protease	Tupanvirus(50.0%)	3	NA	NA
WP_042659454.1|641377_642394_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	1.0e-79
WP_042659455.1|642753_643572_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_024063421.1|643788_645279_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.8	2.8e-12
>prophage 53
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	648283	653000	4742580		Planktothrix_phage(50.0%)	4	NA	NA
WP_002210758.1|648283_649363_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.4e-21
WP_011191954.1|649418_650240_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_002210760.1|650530_651535_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_002220188.1|651719_653000_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.1	2.4e-17
>prophage 54
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	656939	657650	4742580		Planktothrix_phage(100.0%)	1	NA	NA
WP_002210766.1|656939_657650_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.3	3.5e-13
>prophage 55
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	661442	662366	4742580		Streptococcus_phage(100.0%)	1	NA	NA
WP_002210769.1|661442_662366_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.8	3.7e-23
>prophage 56
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	666462	681437	4742580	holin	Catovirus(20.0%)	11	NA	NA
WP_012105474.1|666462_668166_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_012105473.1|668188_669661_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002218278.1|669718_670315_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_012105472.1|670680_672729_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_012105471.1|672969_673863_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041175781.1|673900_674749_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011191966.1|675094_675958_+	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	1.7e-51
WP_011191967.1|676096_677353_+	MFS transporter	NA	NA	NA	NA	NA
WP_012105469.1|677440_677914_-	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_012105468.1|678271_680086_+	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.0	2.9e-16
WP_042659458.1|680072_681437_+	sigma-54-dependent Fis family transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.1	1.3e-05
>prophage 57
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	686719	691971	4742580		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_042659462.1|686719_688462_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	8.2e-24
WP_033847200.1|688475_689462_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_033847202.1|689514_690225_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_002220152.1|690615_691971_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.6	4.1e-55
>prophage 58
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	701045	701882	4742580		Planktothrix_phage(100.0%)	1	NA	NA
WP_002210787.1|701045_701882_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.1e-17
>prophage 59
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	704923	705397	4742580		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002210791.1|704923_705397_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
>prophage 60
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	709889	711518	4742580		Cedratvirus(50.0%)	2	NA	NA
WP_072081304.1|709889_710726_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	4.2e-10
WP_042659466.1|710819_711518_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	1.4e-11
>prophage 61
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	717996	718935	4742580		Bacillus_virus(100.0%)	1	NA	NA
WP_012105454.1|717996_718935_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	8.6e-20
>prophage 62
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	725694	730770	4742580		Enterobacteria_phage(33.33%)	3	NA	NA
WP_012105452.1|725694_726810_-	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.3	4.8e-110
WP_011191991.1|727079_729260_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.4e-44
WP_041175780.1|729327_730770_-	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	1.7e-99
>prophage 63
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	734988	780830	4742580	protease,tail,plate	Pseudomonas_phage(23.81%)	39	NA	NA
WP_002210815.1|734988_735498_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210816.1|735532_735790_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210817.1|735793_736924_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210818.1|737085_739374_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210820.1|739867_740596_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_012413581.1|740895_743571_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	1.4e-102
WP_012304344.1|743758_746632_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210824.1|746699_747353_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_011191996.1|747355_750049_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002210825.1|750072_751227_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210826.1|752330_753446_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_012304343.1|753482_754091_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012105445.1|754238_754700_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_002228026.1|755326_756493_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_011191998.1|756767_758294_-	MFS transporter	NA	NA	NA	NA	NA
WP_002230695.1|758670_759699_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012105444.1|759772_761560_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208866.1|763081_763324_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208864.1|763529_764252_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|764525_765005_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_012105443.1|765215_766520_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.2	2.0e-91
WP_032466639.1|766576_767248_+	aldolase	NA	A0A077SK32	Escherichia_phage	54.9	1.3e-57
WP_002208861.1|767250_768063_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|768038_768833_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|769090_769381_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|769426_770044_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_012105441.1|770048_770243_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_012105440.1|770239_771748_+|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.6	1.3e-105
WP_002208855.1|771769_772138_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_012105439.1|772139_772439_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012105438.1|772559_774053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012105437.1|774334_775741_+	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_012105436.1|775737_776793_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	28.1	1.0e-37
WP_002215460.1|776808_777405_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_012105435.1|777401_777857_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_011192005.1|777860_778997_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	3.5e-31
WP_011192006.1|778993_779596_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.6	2.0e-33
WP_011192007.1|779692_780409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304333.1|780410_780830_+|tail	tail assembly protein	tail	F1BUK2	Cronobacter_phage	33.9	1.4e-06
>prophage 64
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	786949	798629	4742580		Vibrio_phage(40.0%)	10	NA	NA
WP_012105429.1|786949_787333_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	68.6	1.8e-37
WP_002208837.1|787563_789360_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002208836.1|789387_789615_-	YejL family protein	NA	NA	NA	NA	NA
WP_002208835.1|789792_790797_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002208834.1|790884_791169_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_012105428.1|791330_793088_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	3.0e-98
WP_012105427.1|793621_794329_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002208831.1|794447_795647_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.3e-23
WP_011192014.1|796631_796976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012105426.1|797036_798629_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.3e-20
>prophage 65
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	804823	805408	4742580		Clostridioides_phage(100.0%)	1	NA	NA
WP_002208822.1|804823_805408_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	2.8e-13
>prophage 66
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	809317	810790	4742580		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002224659.1|809317_810790_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.5	4.9e-46
>prophage 67
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	815365	817175	4742580		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_012105419.1|815365_816199_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.2	1.5e-12
WP_072080443.1|816209_817175_-	C-terminal binding protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.3	5.2e-28
>prophage 68
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	823773	826930	4742580		Staphylococcus_phage(50.0%)	3	NA	NA
WP_012105414.1|823773_825348_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	5.0e-12
WP_012105413.1|825383_826382_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012105412.1|826474_826930_-	NUDIX domain-containing protein	NA	A0A1L7N1W6	Ralstonia_phage	36.8	5.1e-10
>prophage 69
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	837055	837913	4742580		Catovirus(100.0%)	1	NA	NA
WP_002208791.1|837055_837913_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.0	6.9e-24
>prophage 70
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	845208	848254	4742580		Bacillus_virus(50.0%)	2	NA	NA
WP_042659467.1|845208_845997_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	1.5e-12
WP_002208782.1|846256_848254_+	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	31.6	3.5e-10
>prophage 71
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	852962	856154	4742580		Planktothrix_phage(50.0%)	3	NA	NA
WP_002208776.1|852962_853949_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	9.6e-30
WP_002208775.1|853945_854617_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012105405.1|854951_856154_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.2	1.2e-101
>prophage 72
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	864785	865049	4742580		Vibrio_phage(100.0%)	1	NA	NA
WP_002208765.1|864785_865049_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	2.5e-25
>prophage 73
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	868264	878930	4742580		Bacillus_virus(25.0%)	10	NA	NA
WP_002208760.1|868264_869398_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	35.4	3.4e-31
WP_011192037.1|869422_870388_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_012105401.1|870384_871230_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_011192038.1|871354_871819_+	YbjO family protein	NA	NA	NA	NA	NA
WP_012105400.1|871902_873033_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.8	3.0e-27
WP_002220045.1|873159_873891_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211378.1|874659_875586_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	44.1	4.6e-50
WP_012105397.1|875998_877090_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012105396.1|877089_878148_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_012105395.1|878144_878930_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	1.8e-10
>prophage 74
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	884215	884944	4742580		Planktothrix_phage(100.0%)	1	NA	NA
WP_012105392.1|884215_884944_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.4	8.7e-28
>prophage 75
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	900896	928361	4742580	protease,tRNA	uncultured_Mediterranean_phage(15.38%)	18	NA	NA
WP_012105388.1|900896_902846_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.7	2.0e-34
WP_002211350.1|903143_903407_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.6e-16
WP_002211349.1|903767_904088_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_011192049.1|904113_906390_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.9e-166
WP_002211347.1|906802_907021_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002211346.1|907186_907897_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211344.1|908115_909840_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	3.3e-17
WP_012105386.1|909842_911609_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.9	1.5e-25
WP_002211341.1|912067_913030_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.7	4.9e-63
WP_002211340.1|913797_914292_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_012105385.1|914414_918347_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.8	1.5e-89
WP_002211338.1|918536_919145_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_002228009.1|919155_920499_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.4	5.4e-76
WP_002211336.1|920740_922033_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.5	4.0e-92
WP_002211335.1|922263_923412_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211334.1|923565_924300_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	3.6e-21
WP_002211333.1|925286_925961_+	glycosyltransferase family 25 protein	NA	A0A2H4UUT1	Bodo_saltans_virus	40.5	7.8e-31
WP_002211332.1|926078_928361_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	1.6e-157
>prophage 76
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	933241	937656	4742580		Escherichia_phage(50.0%)	3	NA	NA
WP_012105384.1|933241_934336_+	hemagglutinin	NA	B0FIT1	Escherichia_phage	32.7	3.7e-06
WP_012105383.1|934356_936204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012105382.1|936570_937656_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.1	7.5e-84
>prophage 77
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	942032	946967	4742580		Bacillus_phage(100.0%)	3	NA	NA
WP_002211322.1|942032_942317_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	2.4e-10
WP_012105381.1|942891_945183_+	ComEC family protein	NA	NA	NA	NA	NA
WP_002211320.1|945218_946967_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	31.5	8.7e-66
>prophage 78
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	950121	950331	4742580		Morganella_phage(100.0%)	1	NA	NA
WP_002211317.1|950121_950331_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	50.0	3.0e-10
>prophage 79
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	963468	969379	4742580	tRNA	Rhodobacter_phage(25.0%)	6	NA	NA
WP_002211305.1|963468_964017_+	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_011192061.1|964077_964725_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.7	3.7e-22
WP_002430096.1|964878_964995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033853352.1|965148_966339_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_073990204.1|966595_967678_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.8	1.3e-109
WP_002211301.1|967978_969379_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
>prophage 80
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	980153	982067	4742580		Tupanvirus(100.0%)	1	NA	NA
WP_012105373.1|980153_982067_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	2.0e-47
>prophage 81
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	991341	991800	4742580	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_002213775.1|991341_991800_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 82
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	997688	1017510	4742580	tail	Burkholderia_phage(54.55%)	23	NA	NA
WP_011192072.1|997688_999743_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	5.7e-16
WP_002213060.1|999803_1000268_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213058.1|1000446_1001127_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213056.1|1001442_1001859_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213054.1|1001967_1002285_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_042659476.1|1002345_1003530_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	27.5	1.0e-25
WP_048677086.1|1004019_1004343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042659477.1|1004756_1005023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052491436.1|1005012_1005669_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_042659478.1|1005675_1005942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071880058.1|1005985_1006168_-	DUF1317 family protein	NA	A0A193GYJ8	Enterobacter_phage	54.9	7.7e-10
WP_052491437.1|1006272_1006875_+	DUF3383 family protein	NA	I7B2P4	Escherichia_phage	52.0	5.5e-52
WP_042659479.1|1007337_1008909_+	hypothetical protein	NA	Q4L1H3	Burkholderia_phage	29.3	1.6e-31
WP_042659480.1|1008908_1009418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012303825.1|1009419_1009722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042659481.1|1009725_1010565_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	42.0	5.8e-52
WP_042659482.1|1010546_1011224_+	hypothetical protein	NA	Q6IWQ1	Burkholderia_phage	44.1	2.4e-40
WP_025383410.1|1011220_1011580_+	hypothetical protein	NA	Q6IWQ2	Burkholderia_phage	47.8	1.9e-20
WP_025383411.1|1011563_1012763_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	46.3	1.0e-81
WP_012105508.1|1012815_1013643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042659483.1|1013651_1015511_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	36.8	7.1e-34
WP_012303831.1|1015514_1015736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042659484.1|1015728_1017510_+|tail	phage tail protein	tail	H9C1B7	Pectobacterium_phage	59.4	3.8e-194
>prophage 83
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1024735	1025482	4742580		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_002213038.1|1024735_1025482_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
>prophage 84
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1042155	1047149	4742580		Cronobacter_phage(50.0%)	2	NA	NA
WP_012105358.1|1042155_1044798_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.0	7.4e-93
WP_012105357.1|1044800_1047149_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
>prophage 85
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1073850	1075446	4742580		Tupanvirus(100.0%)	1	NA	NA
WP_071880059.1|1073850_1075446_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	2.3e-57
>prophage 86
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1080283	1080952	4742580		Planktothrix_phage(100.0%)	1	NA	NA
WP_011192100.1|1080283_1080952_-	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	2.3e-35
>prophage 87
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1085993	1090409	4742580		Synechococcus_phage(50.0%)	4	NA	NA
WP_002224699.1|1085993_1087133_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	6.1e-36
WP_002211958.1|1087406_1088276_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211959.1|1088411_1089563_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211960.1|1089746_1090409_+	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
>prophage 88
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1093599	1095120	4742580		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002211964.1|1093599_1095120_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
>prophage 89
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1107562	1116326	4742580	tRNA	Indivirus(25.0%)	6	NA	NA
WP_012413632.1|1107562_1109590_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002211871.1|1109854_1110967_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_002211872.1|1111211_1111853_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	1.0e-35
WP_002211873.1|1111957_1112539_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	2.5e-33
WP_002211874.1|1112725_1114582_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_002211875.1|1114739_1116326_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.5	1.5e-40
>prophage 90
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1123123	1123942	4742580		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002211879.1|1123123_1123942_-	ABC transporter ATP-binding protein	NA	M1H3A1	Paramecium_bursaria_Chlorella_virus	29.7	2.0e-09
>prophage 91
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1132436	1136958	4742580		Bacillus_phage(50.0%)	4	NA	NA
WP_002211886.1|1132436_1133327_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.3	1.1e-56
WP_002211887.1|1133410_1134304_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	41.1	1.1e-45
WP_002211888.1|1134734_1136144_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	30.2	1.8e-29
WP_012105321.1|1136343_1136958_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	28.8	2.3e-13
>prophage 92
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1142592	1143492	4742580		Cellulophaga_phage(100.0%)	1	NA	NA
WP_002211896.1|1142592_1143492_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	81.6	3.2e-08
>prophage 93
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1146871	1148428	4742580		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_011192125.1|1146871_1148428_-	sugar ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.9	2.8e-07
>prophage 94
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1151860	1152319	4742580	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_042659502.1|1151860_1152319_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	4.5e-14
>prophage 95
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1169142	1170510	4742580		Dickeya_phage(100.0%)	1	NA	NA
WP_002211920.1|1169142_1170510_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	7.0e-63
>prophage 96
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1190775	1192494	4742580		Bacillus_phage(100.0%)	1	NA	NA
WP_012105302.1|1190775_1192494_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	2.4e-52
>prophage 97
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1196020	1196320	4742580		Pectobacterium_phage(100.0%)	1	NA	NA
WP_002211053.1|1196020_1196320_+	DUF2591 family protein	NA	K9L3P6	Pectobacterium_phage	37.0	7.4e-10
>prophage 98
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1200348	1205460	4742580		Morganella_phage(50.0%)	5	NA	NA
WP_002221949.1|1200348_1200558_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	5.3e-23
WP_012105300.1|1200648_1201422_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_011192144.1|1201817_1202657_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_002211062.1|1202878_1203157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211063.1|1203378_1205460_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	30.7	4.1e-14
>prophage 99
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1213396	1214941	4742580		Moraxella_phage(100.0%)	1	NA	NA
WP_042659505.1|1213396_1214941_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.2	1.4e-38
>prophage 100
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1228274	1233075	4742580		Pandoravirus(50.0%)	4	NA	NA
WP_002211081.1|1228274_1229651_-	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	31.1	4.5e-41
WP_002211082.1|1229815_1230073_+	YoaH family protein	NA	NA	NA	NA	NA
WP_011192155.1|1230198_1231380_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_012105292.1|1231692_1233075_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.3	9.6e-52
>prophage 101
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1238444	1238675	4742580		Pectobacterium_phage(100.0%)	1	NA	NA
WP_002211091.1|1238444_1238675_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.0e-14
>prophage 102
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1259528	1260473	4742580		Clostridium_phage(100.0%)	1	NA	NA
WP_002211118.1|1259528_1260473_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A0A7RU71	Clostridium_phage	35.9	2.9e-15
>prophage 103
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1269574	1274091	4742580		Staphylococcus_phage(33.33%)	5	NA	NA
WP_012105279.1|1269574_1271152_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	9.1e-14
WP_011192171.1|1271154_1272177_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012105278.1|1272225_1273185_+	sugar kinase	NA	NA	NA	NA	NA
WP_002211129.1|1273444_1273864_-	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	44.0	1.8e-14
WP_002214976.1|1273908_1274091_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	55.0	1.5e-13
>prophage 104
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1286557	1286725	4742580		Enterobacterial_phage(100.0%)	1	NA	NA
WP_002215990.1|1286557_1286725_+	hypothetical protein	NA	K7PGV2	Enterobacterial_phage	71.2	1.0e-16
>prophage 105
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1301254	1302016	4742580		Bacillus_phage(100.0%)	1	NA	NA
WP_002211159.1|1301254_1302016_+	L-cystine ABC transporter ATP-binding protein YecC	NA	W8CYL7	Bacillus_phage	36.6	6.1e-16
>prophage 106
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1318146	1318698	4742580		Salmonella_phage(100.0%)	1	NA	NA
WP_012105262.1|1318146_1318698_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	34.4	2.0e-21
>prophage 107
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1324347	1375129	4742580	terminase,head,integrase,plate,tail	Pectobacterium_phage(51.02%)	66	1324154:1324213	1364988:1365111
1324154:1324213	attL	ATTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGCACCATGGAA	NA	NA	NA	NA
WP_012105261.1|1324347_1325364_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	68.3	1.2e-136
WP_012105260.1|1325353_1325590_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	46.5	1.0e-09
WP_041175872.1|1325930_1326581_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	69.0	2.9e-83
WP_012105258.1|1326684_1326891_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	68.3	2.3e-18
WP_012105257.1|1326924_1327389_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	53.1	5.9e-30
WP_041175776.1|1327405_1327630_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	63.5	4.5e-20
WP_012105256.1|1327632_1328676_+	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	36.2	9.5e-28
WP_012105255.1|1328672_1330046_+	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	47.9	2.9e-109
WP_012105254.1|1330135_1330378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012105252.1|1330811_1331552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071838966.1|1331565_1331748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071838965.1|1331811_1332291_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_012105251.1|1333078_1333672_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	54.8	2.4e-60
WP_041175775.1|1333680_1333965_+	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	73.4	1.8e-34
WP_012105250.1|1333961_1334408_+	antitermination protein	NA	S5M7R9	Escherichia_phage	52.8	8.8e-31
WP_012105249.1|1334566_1334920_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012105248.1|1334943_1335171_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_041175774.1|1335450_1335666_+	peptidoglycan-binding protein LysM	NA	Q9ZWW2	Enterobacteria_phage	50.0	2.5e-07
WP_041175773.1|1336227_1336497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041175868.1|1336713_1336950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012105244.1|1336997_1337216_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_012105242.1|1337674_1338184_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	50.0	6.7e-35
WP_012105241.1|1338180_1338795_+	hypothetical protein	NA	C9E2P8	Enterococcus_phage	61.7	1.8e-66
WP_012105240.1|1338797_1339058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012105239.1|1339061_1340078_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.4	2.5e-41
WP_012105238.1|1340088_1340373_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	76.6	6.4e-35
WP_012105237.1|1340362_1340602_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	63.3	5.2e-22
WP_012105236.1|1340728_1342372_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	84.3	7.9e-287
WP_012105235.1|1342374_1343760_+	DUF1073 domain-containing protein	NA	H9C192	Pectobacterium_phage	70.2	2.0e-190
WP_041175772.1|1343818_1344568_+|head	phage head morphogenesis protein	head	H9C193	Pectobacterium_phage	75.5	3.4e-104
WP_012105233.1|1344579_1345779_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	72.2	2.3e-126
WP_012105231.1|1346437_1346857_+	hypothetical protein	NA	H9C1A0	Pectobacterium_phage	73.6	1.1e-59
WP_012105230.1|1346856_1347417_+	hypothetical protein	NA	H9C1A1	Pectobacterium_phage	62.9	8.4e-55
WP_012105229.1|1347400_1348558_+	DUF3383 family protein	NA	H9C1A2	Pectobacterium_phage	74.8	8.9e-168
WP_012105228.1|1348564_1348969_+	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	78.4	1.1e-53
WP_012105227.1|1348971_1349361_+	hypothetical protein	NA	H9C1A4	Pectobacterium_phage	55.5	4.8e-33
WP_012105225.1|1349606_1350062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012105224.1|1350143_1350467_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	46.6	3.1e-17
WP_012105223.1|1350757_1351408_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	37.8	8.3e-30
WP_012105221.1|1352229_1353135_-	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	63.7	6.3e-36
WP_041175771.1|1353448_1353694_+	Arc family DNA-binding protein	NA	A0A0M5M1J2	Salmonella_phage	61.4	3.8e-20
WP_041175770.1|1353767_1354274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129192660.1|1355670_1356261_+	glycoside hydrolase family 104 protein	NA	H9C1A7	Pectobacterium_phage	52.9	1.5e-46
WP_012105217.1|1356260_1356929_+	hypothetical protein	NA	H9C1A8	Pectobacterium_phage	45.2	1.1e-34
WP_012105216.1|1356928_1357219_+	hypothetical protein	NA	H9C1A9	Pectobacterium_phage	60.6	1.2e-25
WP_012105215.1|1357211_1358105_+	hypothetical protein	NA	H9C1B0	Pectobacterium_phage	47.3	1.2e-79
WP_042659514.1|1358112_1358790_+	hypothetical protein	NA	H9C1B1	Pectobacterium_phage	56.0	6.1e-68
WP_042659828.1|1358863_1359214_+	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	62.6	2.4e-36
WP_042659515.1|1359213_1360413_+|plate	phage baseplate protein	plate	H9C1B3	Pectobacterium_phage	64.2	1.5e-146
WP_012105211.1|1360405_1361050_+	DUF2612 domain-containing protein	NA	H9C1B4	Pectobacterium_phage	48.0	9.4e-42
WP_080869059.1|1361772_1362270_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	45.9	1.7e-27
WP_042659516.1|1362269_1362926_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	42.3	2.6e-31
WP_012105208.1|1363464_1364034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012105207.1|1364045_1364480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012105206.1|1365264_1365480_-	phage transcriptional activator, Ogr/Delta	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
1364988:1365111	attR	ATTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGCACCATGGAAAATATTCTAAGTAAAACAAAGTAGTACGAGTATGTCGTTAACCGCCGAGAGGCGGTTTTTTTGT	NA	NA	NA	NA
WP_042659517.1|1365554_1366649_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	66.3	2.5e-127
WP_012304200.1|1366645_1367110_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	56.2	7.2e-44
WP_071819140.1|1370007_1370127_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_011192297.1|1370141_1370489_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	51.6	8.6e-18
WP_012105203.1|1370542_1371058_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	67.4	2.9e-62
WP_012105202.1|1371069_1372239_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.5	1.1e-178
WP_012105201.1|1372643_1373162_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_002215413.1|1373596_1373884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213212.1|1373900_1374200_-	lysozyme	NA	A0A218M4K8	Erwinia_phage	64.9	2.6e-23
WP_002213211.1|1374196_1374451_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	62.5	1.1e-17
WP_002213209.1|1374838_1375129_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	39.4	1.8e-05
>prophage 108
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1385456	1386599	4742580		Planktothrix_phage(100.0%)	1	NA	NA
WP_012105192.1|1385456_1386599_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.1	8.6e-22
>prophage 109
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1393752	1398361	4742580		Hokovirus(50.0%)	2	NA	NA
WP_012105189.1|1393752_1397613_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.6	1.4e-39
WP_002212073.1|1397728_1398361_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.3	2.7e-09
>prophage 110
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1412418	1413189	4742580		Escherichia_phage(100.0%)	1	NA	NA
WP_002212058.1|1412418_1413189_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	64.7	3.1e-84
>prophage 111
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1424587	1425301	4742580		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_042659521.1|1424587_1425301_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	2.1e-18
>prophage 112
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1437500	1438289	4742580		Cronobacter_phage(100.0%)	1	NA	NA
WP_002212037.1|1437500_1438289_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.8	2.5e-89
>prophage 113
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1444207	1445452	4742580		Klosneuvirus(100.0%)	1	NA	NA
WP_002216140.1|1444207_1445452_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.3	8.2e-26
>prophage 114
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1451194	1452277	4742580		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002230843.1|1451194_1452277_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	52.7	3.3e-100
>prophage 115
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1486602	1487295	4742580		Bacillus_phage(100.0%)	1	NA	NA
WP_012105151.1|1486602_1487295_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	1.6e-31
>prophage 116
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1495250	1496198	4742580		Tupanvirus(100.0%)	1	NA	NA
WP_002211240.1|1495250_1496198_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	6.0e-45
>prophage 117
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1499663	1505847	4742580		Pseudomonas_phage(33.33%)	6	NA	NA
WP_002211236.1|1499663_1500746_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	42.1	7.4e-07
WP_011192399.1|1500745_1501576_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002211234.1|1501639_1502041_+	SirB2 family protein	NA	NA	NA	NA	NA
WP_002211233.1|1502037_1502847_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002211232.1|1502942_1503797_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.7	4.4e-47
WP_012105141.1|1504149_1505847_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.0	6.3e-21
>prophage 118
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1510940	1512008	4742580		Bacillus_virus(100.0%)	1	NA	NA
WP_042659529.1|1510940_1512008_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	7.5e-28
>prophage 119
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1530123	1531854	4742580	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_038834299.1|1530123_1531854_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	34.2	1.1e-89
>prophage 120
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1536768	1548765	4742580	tRNA	Bacillus_virus(50.0%)	11	NA	NA
WP_012105129.1|1536768_1537584_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	68.5	2.2e-48
WP_002211204.1|1538925_1540722_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.3	2.8e-11
WP_002211203.1|1540721_1541165_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211202.1|1541222_1541966_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002211201.1|1542190_1542712_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	32.4	6.5e-09
WP_002211199.1|1543018_1543633_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002211198.1|1543795_1544800_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.8	4.7e-08
WP_002211197.1|1544855_1545641_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_002228434.1|1545637_1546396_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	30.3	1.2e-16
WP_002227944.1|1546471_1547428_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_002228437.1|1547448_1548765_+	murein DD-endopeptidase MepM	NA	G3MBP9	Bacillus_virus	44.5	2.4e-15
>prophage 121
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1553327	1563496	4742580	tRNA	Cyanophage(33.33%)	10	NA	NA
WP_011906215.1|1553327_1554812_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	4.0e-80
WP_012105126.1|1555053_1555695_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_012105125.1|1556382_1556826_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_002211187.1|1556812_1557142_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_002211186.1|1557273_1557618_-	RidA family protein	NA	NA	NA	NA	NA
WP_011192419.1|1557748_1559653_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.6	3.4e-92
WP_002211184.1|1559724_1560423_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002211183.1|1560559_1561165_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_087768167.1|1561165_1561273_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002220632.1|1561807_1563496_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
>prophage 122
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1571565	1572765	4742580		Faustovirus(100.0%)	1	NA	NA
WP_012105123.1|1571565_1572765_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
>prophage 123
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1582241	1583435	4742580		Salmonella_phage(100.0%)	1	NA	NA
WP_011192426.1|1582241_1583435_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	9.9e-29
>prophage 124
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1586946	1588221	4742580		Bacillus_phage(100.0%)	1	NA	NA
WP_002216501.1|1586946_1588221_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
>prophage 125
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1595002	1595650	4742580		Tupanvirus(100.0%)	1	NA	NA
WP_042659536.1|1595002_1595650_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	4.1e-21
>prophage 126
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1600679	1602605	4742580		Streptococcus_phage(100.0%)	1	NA	NA
WP_012105118.1|1600679_1602605_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
>prophage 127
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1606408	1607257	4742580		Synechococcus_phage(100.0%)	1	NA	NA
WP_012105115.1|1606408_1607257_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	7.0e-13
>prophage 128
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1610461	1613990	4742580		Bacillus_phage(50.0%)	3	NA	NA
WP_002210664.1|1610461_1611808_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002223593.1|1612242_1612650_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210659.1|1613399_1613990_+	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
>prophage 129
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1623325	1625325	4742580		Planktothrix_phage(50.0%)	2	NA	NA
WP_012105111.1|1623325_1624327_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-14
WP_002210651.1|1624323_1625325_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.2	1.8e-15
>prophage 130
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1629404	1629944	4742580		Salmonella_phage(100.0%)	1	NA	NA
WP_002210646.1|1629404_1629944_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	42.4	2.1e-26
>prophage 131
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1633775	1635515	4742580		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_011192440.1|1633775_1635515_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.6	2.4e-15
>prophage 132
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1640461	1643484	4742580		Acinetobacter_phage(100.0%)	3	NA	NA
WP_012105108.1|1640461_1641889_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.0	2.9e-35
WP_002215980.1|1641892_1642891_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	7.7e-51
WP_002215981.1|1642905_1643484_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	37.3	7.4e-30
>prophage 133
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1650060	1654511	4742580	protease	Bodo_saltans_virus(50.0%)	4	NA	NA
WP_002210624.1|1650060_1651107_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	1.6e-22
WP_012105106.1|1651225_1651477_-	YciN family protein	NA	NA	NA	NA	NA
WP_002228458.1|1651569_1651869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012105105.1|1651895_1654511_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	34.1	1.4e-88
>prophage 134
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1660269	1660860	4742580		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002227926.1|1660269_1660860_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	8.0e-40
>prophage 135
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1667986	1673417	4742580		Synechococcus_phage(50.0%)	4	NA	NA
WP_012105101.1|1667986_1668652_+	fructose-6-phosphate aldolase	NA	A0A1Z1LWE4	Synechococcus_phage	34.4	7.9e-28
WP_002210607.1|1668768_1669074_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_002220371.1|1669066_1671133_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_012105100.1|1671482_1673417_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	22.5	1.2e-10
>prophage 136
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1685489	1691192	4742580		Bacillus_phage(100.0%)	3	NA	NA
WP_012105094.1|1685489_1687637_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.7	8.8e-44
WP_011192461.1|1687681_1689052_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012105093.1|1689053_1691192_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.4	3.3e-51
>prophage 137
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1696180	1697752	4742580		Staphylococcus_phage(100.0%)	1	NA	NA
WP_012105090.1|1696180_1697752_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	4.1e-14
>prophage 138
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1734544	1736083	4742580		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011192492.1|1734544_1736083_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.2	1.5e-16
>prophage 139
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1739353	1740172	4742580		Bacillus_virus(100.0%)	1	NA	NA
WP_011192495.1|1739353_1740172_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	2.6e-36
>prophage 140
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1750941	1752609	4742580		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_002211027.1|1750941_1752609_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	4.7e-53
>prophage 141
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1758490	1759009	4742580		Streptococcus_phage(100.0%)	1	NA	NA
WP_002211023.1|1758490_1759009_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.5	1.6e-23
>prophage 142
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1768634	1769939	4742580		Bacillus_phage(100.0%)	1	NA	NA
WP_002232819.1|1768634_1769939_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	27.9	3.5e-19
>prophage 143
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1780273	1787889	4742580		Catovirus(50.0%)	4	NA	NA
WP_071880065.1|1780273_1784161_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	31.4	5.3e-55
WP_002211004.1|1784605_1785211_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_002211003.1|1785331_1786288_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_012105054.1|1786497_1787889_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	1.6e-46
>prophage 144
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1791713	1794589	4742580		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_012105052.1|1791713_1792706_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	44.2	9.9e-67
WP_042659547.1|1792775_1793228_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_002227907.1|1793285_1793627_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_002210995.1|1793929_1794589_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	44.6	6.0e-20
>prophage 145
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1799267	1801484	4742580	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_033851634.1|1799267_1800209_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	87.9	3.5e-130
WP_162007547.1|1800515_1801484_+	alpha/beta hydrolase fold domain-containing protein	NA	A0A2P1EM31	Moumouvirus	28.7	7.3e-14
>prophage 146
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1821241	1823049	4742580		Planktothrix_phage(100.0%)	2	NA	NA
WP_002210970.1|1821241_1822234_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	25.3	8.8e-07
WP_002210969.1|1822233_1823049_+	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	30.9	6.5e-16
>prophage 147
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1830149	1831424	4742580	tRNA	Pectobacterium_phage(100.0%)	1	NA	NA
WP_011192524.1|1830149_1831424_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.2	8.8e-84
>prophage 148
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1835084	1835543	4742580	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_002213759.1|1835084_1835543_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 149
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1842232	1853336	4742580		Enterobacteria_phage(28.57%)	13	NA	NA
WP_012105037.1|1842232_1842451_+	hypothetical protein	NA	A0A0A7NPW2	Enterobacteria_phage	68.1	6.6e-24
WP_080869062.1|1842506_1842668_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011192527.1|1842889_1843297_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_011906187.1|1843375_1844056_+	ribonuclease T	NA	NA	NA	NA	NA
WP_002210946.1|1844366_1844717_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_012105035.1|1845156_1846008_+	hydrolase	NA	A0A2H5BMT3	Streptomyces_phage	41.9	1.5e-18
WP_011192530.1|1846368_1846947_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.6	1.5e-43
WP_002216285.1|1847050_1847140_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_002210943.1|1847473_1848499_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.4	5.9e-30
WP_042659548.1|1848570_1849506_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024062903.1|1849795_1850998_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.2	4.1e-14
WP_042659549.1|1851477_1852629_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	7.9e-84
WP_042659550.1|1852679_1853336_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.7	1.1e-21
>prophage 150
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1860428	1865774	4742580		environmental_halophage(33.33%)	5	NA	NA
WP_042659551.1|1860428_1861649_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.9	2.1e-87
WP_042659552.1|1861645_1862971_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011192535.1|1862945_1863692_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.8	4.9e-10
WP_012105025.1|1863876_1865388_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_002211809.1|1865402_1865774_-	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	35.6	1.1e-15
>prophage 151
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1872356	1880429	4742580		Hokovirus(25.0%)	5	NA	NA
WP_042659554.1|1872356_1874741_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	4.1e-175
WP_002211814.1|1875115_1875937_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_011192538.1|1876093_1877140_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	49.0	4.2e-84
WP_011192539.1|1877308_1878772_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.8	8.9e-56
WP_002216102.1|1879964_1880429_-	lipoprotein	NA	A0A217EQL1	Bacillus_phage	37.0	8.9e-10
>prophage 152
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1883995	1899861	4742580	tRNA	Tupanvirus(44.44%)	16	NA	NA
WP_011192542.1|1883995_1885999_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	24.6	1.3e-17
WP_011192543.1|1885995_1886979_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.5	1.4e-36
WP_002211825.1|1886965_1888120_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.8	8.3e-33
WP_002211826.1|1888469_1889228_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A1M7XV31	Cedratvirus	28.5	9.4e-09
WP_002211827.1|1889252_1889807_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_002220283.1|1889876_1890884_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_012105022.1|1891110_1891569_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002211830.1|1891902_1892199_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_042659555.1|1892203_1894591_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011192546.1|1894604_1895588_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_152328947.1|1895944_1895992_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002211833.1|1896086_1896443_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002211834.1|1896480_1896678_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002227898.1|1896774_1897326_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_042659556.1|1897329_1899258_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.1e-127
WP_002216696.1|1899648_1899861_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
>prophage 153
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1903834	1904725	4742580		Klosneuvirus(100.0%)	1	NA	NA
WP_002211843.1|1903834_1904725_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
>prophage 154
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1911248	1912010	4742580		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_002210830.1|1911248_1912010_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
>prophage 155
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1915879	1923030	4742580		Pithovirus(33.33%)	6	NA	NA
WP_002210834.1|1915879_1917007_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|1917022_1918315_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|1918612_1919323_+	porin	NA	NA	NA	NA	NA
WP_033851001.1|1919820_1920369_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.3	5.2e-09
WP_042659557.1|1920572_1921964_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|1922178_1923030_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
>prophage 156
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1935506	1937579	4742580		Moraxella_phage(100.0%)	1	NA	NA
WP_012105008.1|1935506_1937579_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	5.2e-86
>prophage 157
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1960737	1968769	4742580		uncultured_Caudovirales_phage(40.0%)	7	NA	NA
WP_011192565.1|1960737_1961502_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	27.2	1.9e-09
WP_002210872.1|1962063_1962708_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_002210873.1|1962717_1963107_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.3	1.3e-06
WP_042659567.1|1963207_1964257_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	6.1e-06
WP_002214065.1|1964256_1965129_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_002220817.1|1965301_1966912_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.4	2.3e-12
WP_011192568.1|1967095_1968769_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	1.5e-11
>prophage 158
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1980672	1991938	4742580		Paramecium_bursaria_Chlorella_virus(20.0%)	6	NA	NA
WP_011192575.1|1980672_1983372_-	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.5	1.1e-43
WP_011192576.1|1983832_1984531_-	MgtC family protein	NA	G3MA03	Bacillus_virus	39.3	6.2e-15
WP_011192577.1|1985656_1987396_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	9.7e-09
WP_071525649.1|1987578_1987893_-	protein DsrB	NA	NA	NA	NA	NA
WP_002210893.1|1987984_1988197_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_012104994.1|1988737_1991938_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	61.9	0.0e+00
>prophage 159
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	1996410	1996614	4742580		Salmonella_phage(100.0%)	1	NA	NA
WP_002210902.1|1996410_1996614_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	44.6	9.8e-06
>prophage 160
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2001092	2005755	4742580		Salmonella_phage(50.0%)	4	NA	NA
WP_002210907.1|2001092_2002673_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	50.7	2.5e-35
WP_002210908.1|2002792_2003053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210909.1|2003312_2004356_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002210910.1|2004501_2005755_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
>prophage 161
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2008997	2010368	4742580		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_042659572.1|2008997_2010368_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	7.7e-110
>prophage 162
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2016531	2020301	4742580		Vibrio_phage(50.0%)	4	NA	NA
WP_002210921.1|2016531_2017368_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	2.6e-20
WP_011192586.1|2017416_2018331_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_042659575.1|2018349_2019597_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002210923.1|2019596_2020301_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	43.3	1.4e-35
>prophage 163
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2038597	2039236	4742580		Pseudomonas_phage(100.0%)	1	NA	NA
WP_011192604.1|2038597_2039236_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	3.5e-25
>prophage 164
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2042871	2043996	4742580		Ralstonia_phage(50.0%)	2	NA	NA
WP_002220787.1|2042871_2043108_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	7.7e-10
WP_012104964.1|2043261_2043996_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	7.7e-16
>prophage 165
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2055892	2056138	4742580		Enterobacteria_phage(100.0%)	1	NA	NA
WP_002213110.1|2055892_2056138_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	51.3	2.6e-13
>prophage 166
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2063422	2066609	4742580		Morganella_phage(50.0%)	2	NA	NA
WP_038401393.1|2063422_2064346_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	43.6	1.4e-62
WP_011192613.1|2065070_2066609_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.2	5.7e-162
>prophage 167
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2083389	2091125	4742580		Vibrio_phage(100.0%)	5	NA	NA
WP_011192624.1|2083389_2084394_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	41.2	3.3e-54
WP_042659579.1|2084411_2085362_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_012104945.1|2085358_2086705_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_012104944.1|2086860_2090148_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	29.8	1.3e-59
WP_012104943.1|2090144_2091125_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YUF3	Vibrio_phage	36.7	2.4e-49
>prophage 168
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2104239	2106807	4742580		Bacillus_phage(50.0%)	2	NA	NA
WP_002210201.1|2104239_2105628_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	28.3	2.5e-31
WP_011192635.1|2105727_2106807_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.3	2.3e-24
>prophage 169
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2131553	2133044	4742580		Staphylococcus_phage(100.0%)	1	NA	NA
WP_012104931.1|2131553_2133044_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.6	6.3e-17
>prophage 170
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2138994	2142883	4742580		Escherichia_phage(50.0%)	5	NA	NA
WP_002210229.1|2138994_2139519_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.0	5.5e-16
WP_002213809.1|2139923_2140811_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_042659588.1|2140826_2141324_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002210232.1|2141346_2142123_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_002210233.1|2142379_2142883_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.8	2.5e-05
>prophage 171
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2146330	2148585	4742580		Planktothrix_phage(50.0%)	2	NA	NA
WP_002210237.1|2146330_2147053_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.9	5.0e-36
WP_012104922.1|2147280_2148585_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.8	8.0e-16
>prophage 172
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2165124	2166075	4742580		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_012104911.1|2165124_2166075_-	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	25.2	8.4e-15
>prophage 173
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2192884	2196973	4742580		Salmonella_phage(50.0%)	4	NA	NA
WP_002210283.1|2192884_2193478_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	34.6	8.4e-05
WP_038401858.1|2193524_2193716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012104895.1|2194192_2196025_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_011192675.1|2196316_2196973_-	sugar phosphatase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	25.6	4.0e-08
>prophage 174
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2209883	2210681	4742580		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_002209738.1|2209883_2210681_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.9	1.1e-07
>prophage 175
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2214309	2215827	4742580		Mollivirus(100.0%)	1	NA	NA
WP_002209733.1|2214309_2215827_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	5.0e-86
>prophage 176
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2223098	2224226	4742580		Cedratvirus(100.0%)	1	NA	NA
WP_002209725.1|2223098_2224226_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A285PXZ1	Cedratvirus	27.9	6.1e-20
>prophage 177
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2236706	2237792	4742580		Pandoravirus(100.0%)	1	NA	NA
WP_002209711.1|2236706_2237792_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.4	2.7e-89
>prophage 178
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2254328	2254985	4742580		Indivirus(100.0%)	1	NA	NA
WP_012104878.1|2254328_2254985_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A1V0SE00	Indivirus	25.4	2.1e-09
>prophage 179
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2265845	2268596	4742580		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_042659596.1|2265845_2268596_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	3.5e-29
>prophage 180
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2284338	2286996	4742580		Agrobacterium_phage(100.0%)	1	NA	NA
WP_012104866.1|2284338_2286996_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.9	2.2e-81
>prophage 181
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2293055	2294393	4742580		Xanthomonas_phage(100.0%)	1	NA	NA
WP_042659598.1|2293055_2294393_+	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.4	1.2e-70
>prophage 182
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2303513	2304563	4742580		Planktothrix_phage(100.0%)	1	NA	NA
WP_011192722.1|2303513_2304563_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
>prophage 183
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2308081	2313117	4742580		Escherichia_phage(100.0%)	4	NA	NA
WP_011192724.1|2308081_2310508_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.8	1.3e-256
WP_002211603.1|2310519_2311137_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211604.1|2311138_2311915_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_041175854.1|2312520_2313117_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	48.7	7.8e-43
>prophage 184
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2316224	2317275	4742580		Yersinia_phage(50.0%)	2	NA	NA
WP_002211610.1|2316224_2316656_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002211611.1|2316750_2317275_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
>prophage 185
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2332784	2346746	4742580		Ralstonia_phage(20.0%)	11	NA	NA
WP_012104854.1|2332784_2334797_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.4	1.0e-142
WP_002227089.1|2334887_2335874_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002231042.1|2336122_2336857_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002222180.1|2337013_2337982_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.8	4.8e-74
WP_002208488.1|2338480_2338738_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002208490.1|2338786_2340514_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	3.0e-18
WP_002208491.1|2340562_2341072_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_011192737.1|2341254_2342604_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_012104853.1|2342629_2343313_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012104852.1|2343500_2344706_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	64.6	1.0e-25
WP_011192738.1|2344709_2346746_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.0	4.0e-38
>prophage 186
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2355290	2359872	4742580		Pseudomonas_phage(25.0%)	4	NA	NA
WP_002208505.1|2355290_2356835_+	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	28.6	8.6e-09
WP_002224818.1|2356831_2357539_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	2.4e-35
WP_002208508.1|2357731_2358610_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.3	1.0e-51
WP_011192745.1|2358780_2359872_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	3.0e-32
>prophage 187
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2362939	2364472	4742580		Burkholderia_virus(100.0%)	1	NA	NA
WP_002231046.1|2362939_2364472_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.1	3.2e-08
>prophage 188
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2369832	2372297	4742580		Pandoravirus(50.0%)	3	NA	NA
WP_002208519.1|2369832_2370732_-	Dyp-type peroxidase	NA	S4VXK8	Pandoravirus	33.2	1.6e-26
WP_042659599.1|2370909_2371521_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_042659600.1|2371883_2372297_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	40.9	3.9e-17
>prophage 189
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2401244	2402315	4742580		Planktothrix_phage(100.0%)	1	NA	NA
WP_002208544.1|2401244_2402315_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	2.5e-31
>prophage 190
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2412632	2413346	4742580		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002208555.1|2412632_2413346_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	34.8	2.9e-36
>prophage 191
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2421551	2431126	4742580	transposase	uncultured_Caudovirales_phage(16.67%)	10	NA	NA
WP_002208565.1|2421551_2421908_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.3	6.1e-19
WP_002228401.1|2422120_2422828_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_042659607.1|2423086_2424373_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.2	3.5e-64
WP_042659502.1|2424560_2425019_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	4.5e-14
WP_002209776.1|2425195_2425822_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011192770.1|2426256_2427300_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.3	1.2e-70
WP_011192771.1|2427414_2428053_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.4	3.1e-29
WP_002209779.1|2428281_2428827_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_080869064.1|2428920_2430081_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002209780.1|2430313_2431126_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.8	1.3e-16
>prophage 192
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2445976	2450421	4742580		Klosneuvirus(33.33%)	3	NA	NA
WP_042659608.1|2445976_2447266_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	1.0e-23
WP_012104822.1|2447447_2448953_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	31.7	1.2e-18
WP_011192780.1|2449335_2450421_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	8.4e-27
>prophage 193
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2459878	2464157	4742580	tRNA	Bacillus_phage(66.67%)	4	NA	NA
WP_041175852.1|2459878_2461261_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	30.9	5.0e-32
WP_011192786.1|2461270_2461990_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.8	3.0e-33
WP_002209797.1|2462126_2462465_+	YegP family protein	NA	NA	NA	NA	NA
WP_012104819.1|2462762_2464157_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	81.4	5.1e-178
>prophage 194
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2475343	2478353	4742580		Klosneuvirus(50.0%)	2	NA	NA
WP_002227862.1|2475343_2476807_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.1	1.7e-86
WP_012104810.1|2476976_2478353_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	38.7	3.6e-43
>prophage 195
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2489652	2490081	4742580		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_011192804.1|2489652_2490081_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	7.4e-19
>prophage 196
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2503282	2510358	4742580		Mycoplasma_phage(20.0%)	8	NA	NA
WP_012104798.1|2503282_2504581_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	39.0	1.3e-37
WP_002209830.1|2504720_2504921_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002209831.1|2504950_2505286_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_071880073.1|2505288_2507241_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.1	4.0e-96
WP_042659613.1|2507483_2508008_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_002209834.1|2508118_2508442_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	7.8e-21
WP_002209835.1|2508711_2509098_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	5.4e-53
WP_011192814.1|2509128_2510358_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	33.1	1.1e-35
>prophage 197
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2517569	2519814	4742580		Salmonella_phage(50.0%)	3	NA	NA
WP_011192817.1|2517569_2518118_-	attachment invasion locus protein Ail	NA	A0A1B0VBR9	Salmonella_phage	36.7	5.2e-25
WP_002223388.1|2518226_2518409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012104792.1|2518560_2519814_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.5	3.6e-98
>prophage 198
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2523457	2529032	4742580		Bacillus_phage(66.67%)	4	NA	NA
WP_012104790.1|2523457_2525080_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.7	8.3e-95
WP_002211556.1|2525239_2526577_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.4	1.2e-11
WP_072080453.1|2526539_2527547_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_002216114.1|2527595_2529032_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.8	3.1e-13
>prophage 199
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2532109	2538505	4742580	tRNA	Burkholderia_phage(33.33%)	3	NA	NA
WP_011192822.1|2532109_2536000_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.5	8.8e-127
WP_002211562.1|2536315_2537776_+	membrane-bound lytic murein transglycosylase MltF	NA	I1VXB7	Halocynthia_phage	41.4	7.1e-13
WP_042659614.1|2537902_2538505_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	34.1	2.9e-05
>prophage 200
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2541593	2541854	4742580		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_002211567.1|2541593_2541854_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	9.3e-17
>prophage 201
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2544872	2548712	4742580		Yellowstone_lake_phycodnavirus(50.0%)	3	NA	NA
WP_002209679.1|2544872_2545553_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	28.8	2.4e-19
WP_012104784.1|2545904_2546903_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002209677.1|2546912_2548712_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.4	3.4e-25
>prophage 202
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2552176	2552752	4742580		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_002209672.1|2552176_2552752_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	27.4	6.2e-05
>prophage 203
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2555857	2560617	4742580		Klosneuvirus(33.33%)	5	NA	NA
WP_012104783.1|2555857_2557183_+	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	32.4	1.9e-52
WP_012104782.1|2557313_2557970_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012104780.1|2558053_2559016_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_002209664.1|2559194_2559578_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	67.3	9.8e-31
WP_012104779.1|2559930_2560617_+	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	48.6	6.7e-54
>prophage 204
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2568064	2569528	4742580		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_012104775.1|2568064_2569528_-	deoxyribodipyrimidine photo-lyase	NA	F2Y1K1	Organic_Lake_phycodnavirus	31.3	1.2e-52
>prophage 205
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2572973	2578590	4742580		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_012104771.1|2572973_2575040_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.4	1.5e-29
WP_011192834.1|2575203_2575854_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_042659615.1|2575863_2578590_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.7	1.2e-13
>prophage 206
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2603156	2603963	4742580		Cedratvirus(100.0%)	1	NA	NA
WP_038401120.1|2603156_2603963_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	31.2	1.2e-09
>prophage 207
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2608106	2608319	4742580		Morganella_phage(100.0%)	1	NA	NA
WP_002212220.1|2608106_2608319_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	75.7	3.2e-23
>prophage 208
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2611577	2617317	4742580		Bacillus_virus(40.0%)	5	NA	NA
WP_002212214.1|2611577_2611814_+	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	53.3	5.9e-18
WP_002215935.1|2611827_2612232_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	32.8	3.5e-10
WP_011192848.1|2612213_2614364_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.8	1.9e-211
WP_012104754.1|2614470_2615442_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	74.6	4.7e-138
WP_002212210.1|2616117_2617317_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.0	7.1e-27
>prophage 209
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2622780	2629592	4742580		Bradyrhizobium_phage(25.0%)	7	NA	NA
WP_002210700.1|2622780_2623545_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.8	1.9e-41
WP_002210699.1|2623614_2624079_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.9	9.1e-47
WP_002210698.1|2624133_2624853_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011192852.1|2624897_2625653_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_012104749.1|2625724_2627104_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.8	4.5e-09
WP_002220059.1|2627146_2627929_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_012104747.1|2628788_2629592_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	29.2	8.1e-27
>prophage 210
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2636611	2637643	4742580		Planktothrix_phage(100.0%)	1	NA	NA
WP_002212161.1|2636611_2637643_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	35.4	1.7e-32
>prophage 211
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2648552	2652794	4742580		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_012104742.1|2648552_2652035_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.1	1.8e-203
WP_002212145.1|2652197_2652794_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	41.4	3.8e-29
>prophage 212
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2661805	2662564	4742580		Flavobacterium_phage(100.0%)	1	NA	NA
WP_002212136.1|2661805_2662564_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	1.4e-23
>prophage 213
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2676075	2679453	4742580		Vibrio_phage(50.0%)	3	NA	NA
WP_011192866.1|2676075_2676921_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.9	9.4e-42
WP_002212121.1|2677073_2678438_+	LOG family protein	NA	NA	NA	NA	NA
WP_011192868.1|2678697_2679453_+	flap endonuclease Xni	NA	A0A0N7ACJ6	Bacillus_phage	29.2	1.1e-14
>prophage 214
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2682978	2699337	4742580	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_012104737.1|2682978_2684184_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.7	1.6e-74
WP_041175749.1|2684316_2684760_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_012104734.1|2684809_2685637_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	30.8	1.5e-15
WP_002228046.1|2685779_2686952_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_002211623.1|2687853_2689104_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	30.3	4.2e-14
WP_002211624.1|2689339_2690665_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_012104733.1|2690819_2692793_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.0	7.9e-23
WP_012104732.1|2692789_2696452_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	23.0	3.4e-11
WP_002211626.1|2696448_2699337_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	24.7	5.1e-63
>prophage 215
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2705233	2709404	4742580		Cronobacter_phage(50.0%)	3	NA	NA
WP_011192873.1|2705233_2706028_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.9	1.2e-118
WP_002211383.1|2706034_2706907_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_011192874.1|2707157_2709404_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.6	7.9e-11
>prophage 216
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2714923	2719789	4742580		Staphylococcus_phage(50.0%)	2	NA	NA
WP_011192876.1|2714923_2717080_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.1	2.2e-18
WP_012104728.1|2717527_2719789_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	30.5	2.1e-72
>prophage 217
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2727697	2729389	4742580		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_011906285.1|2727697_2729389_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.4	3.1e-12
>prophage 218
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2739431	2741354	4742580		Vibrio_phage(100.0%)	1	NA	NA
WP_002220086.1|2739431_2741354_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	32.2	6.9e-32
>prophage 219
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2752079	2753633	4742580		Catovirus(100.0%)	1	NA	NA
WP_002209873.1|2752079_2753633_-	sulfatase	NA	A0A1V0SA98	Catovirus	26.1	5.4e-19
>prophage 220
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2761880	2765367	4742580		Trichoplusia_ni_ascovirus(50.0%)	3	NA	NA
WP_012104704.1|2761880_2762636_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	6.7e-15
WP_012104703.1|2762651_2763710_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_042659621.1|2764140_2765367_+	anaerobic sulfatase maturase	NA	A0A1B2IC15	Erwinia_phage	33.1	5.4e-06
>prophage 221
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2776037	2779374	4742580		Enterobacteria_phage(50.0%)	3	NA	NA
WP_002209894.1|2776037_2777111_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	43.6	2.9e-72
WP_011192907.1|2777382_2778642_+	maltoporin	NA	NA	NA	NA	NA
WP_002209896.1|2779062_2779374_-	PTS transporter subunit EIIB	NA	A0A2I7SAJ6	Vibrio_phage	39.2	3.3e-08
>prophage 222
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2786731	2789885	4742580		Bacillus_virus(50.0%)	2	NA	NA
WP_002223743.1|2786731_2787838_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	4.7e-25
WP_042659624.1|2788376_2789885_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.8	1.4e-08
>prophage 223
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2808428	2825058	4742580	integrase,tRNA	Enterobacteria_phage(28.57%)	14	2799321:2799335	2818284:2818298
2799321:2799335	attL	GCTGAGTTATCACTG	NA	NA	NA	NA
WP_042659628.1|2808428_2810720_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.5	1.2e-152
WP_002209924.1|2811119_2811518_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_024063131.1|2811517_2811814_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_011192920.1|2811977_2812340_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042659629.1|2813268_2813454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192954.1|2813535_2814750_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	58.8	3.7e-132
WP_002209930.1|2815182_2816700_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.0	1.1e-85
WP_002228062.1|2816709_2817808_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_002209931.1|2817986_2819720_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.7	3.6e-64
2818284:2818298	attR	CAGTGATAACTCAGC	NA	NA	NA	NA
WP_002209932.1|2819726_2820443_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_002209933.1|2820473_2821373_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	8.5e-33
WP_011192956.1|2821479_2821998_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_012303664.1|2822082_2823540_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_042659630.1|2823624_2825058_-	two-component system sensor histidine kinase CreC	NA	B5LWN8	Feldmannia_species_virus	22.5	3.1e-05
>prophage 224
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2834775	2837655	4742580		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_002209947.1|2834775_2837655_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.3	1.7e-268
>prophage 225
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2846632	2847874	4742580		Catovirus(100.0%)	1	NA	NA
WP_002209956.1|2846632_2847874_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
>prophage 226
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2859767	2921516	4742580	protease,tRNA,integrase,plate	Staphylococcus_phage(33.33%)	44	2900648:2900663	2927021:2927036
WP_042659839.1|2859767_2860520_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_071525520.1|2860665_2860776_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209968.1|2860809_2861130_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_002209969.1|2861289_2863269_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209971.1|2864493_2865648_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_012104670.1|2865839_2866352_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_042659633.1|2866449_2867157_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002209975.1|2867396_2868128_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_012104668.1|2868153_2869113_+	glutathione synthase	NA	NA	NA	NA	NA
WP_011192971.1|2869228_2869792_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209978.1|2869791_2870214_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209979.1|2870393_2871278_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209980.1|2871281_2872397_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_012104667.1|2872505_2873630_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_042659634.1|2873649_2874348_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_042659635.1|2874480_2875302_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011192975.1|2875589_2876144_+	YggT family protein	NA	NA	NA	NA	NA
WP_002215612.1|2876140_2876431_+	YggU family protein	NA	NA	NA	NA	NA
WP_042659636.1|2876530_2877124_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002209987.1|2877116_2878247_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_042659637.1|2878436_2887769_-	pore forming RTX toxin family protein	NA	NA	NA	NA	NA
WP_012104662.1|2888272_2889007_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_012104660.1|2889118_2890045_-	glutaminase B	NA	NA	NA	NA	NA
WP_002209990.1|2890155_2890482_-	YggL family protein	NA	NA	NA	NA	NA
WP_012104659.1|2890481_2891201_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_038927616.1|2891613_2892729_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002230648.1|2892906_2893179_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002209995.1|2893485_2894562_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002209997.1|2894861_2895962_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041175847.1|2896065_2898099_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209999.1|2898325_2899309_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012104656.1|2899341_2900841_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
2900648:2900663	attL	TGGATCATAATGCGCC	NA	NA	NA	NA
WP_012104655.1|2900886_2901846_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012104654.1|2902426_2904589_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_012104652.1|2905529_2906789_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.0	6.9e-73
WP_041175742.1|2907182_2912750_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_012104650.1|2913059_2914910_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_113773016.1|2914973_2915567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012104648.1|2915700_2917098_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_049756382.1|2917213_2917630_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
WP_012104646.1|2917698_2918148_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012104645.1|2918147_2918729_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012104644.1|2918703_2919789_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_042659638.1|2919752_2921516_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
2927021:2927036	attR	GGCGCATTATGATCCA	NA	NA	NA	NA
>prophage 227
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2933081	2940385	4742580		uncultured_Caudovirales_phage(100.0%)	4	NA	NA
WP_012104633.1|2933081_2935784_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.5	4.0e-17
WP_032467135.1|2936098_2936494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012104632.1|2936497_2937769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012104631.1|2937886_2940385_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.5	2.1e-17
>prophage 228
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2955320	2956901	4742580		Staphylococcus_phage(100.0%)	1	NA	NA
WP_080869045.1|2955320_2956901_-	recombinase family protein	NA	A0A0N9RZT8	Staphylococcus_phage	28.8	1.3e-12
>prophage 229
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2967769	2975470	4742580	transposase	Escherichia_phage(60.0%)	12	NA	NA
WP_012104602.1|2967769_2968591_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	37.8	9.8e-44
WP_012104601.1|2968590_2968851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012104600.1|2968978_2969410_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.5e-14
WP_041175841.1|2969441_2969915_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_129192872.1|2970022_2970241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012104596.1|2970296_2970653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012104595.1|2970664_2970985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012104594.1|2971080_2971947_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_012104593.1|2972146_2972470_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	O64357	Escherichia_phage	48.0	2.1e-18
WP_004722488.1|2972504_2972744_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	46.5	2.7e-10
WP_041175740.1|2973534_2974164_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_115027165.1|2974772_2975470_-|transposase	IS1-like element ISYps7 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	3.7e-60
>prophage 230
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	2983614	2988608	4742580		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_012104588.1|2983614_2985963_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.2	5.0e-16
WP_012104587.1|2985959_2988608_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	2.8e-92
>prophage 231
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3025389	3033452	4742580		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_042659643.1|3025389_3029868_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.9	2.8e-28
WP_042659644.1|3029881_3031201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042659645.1|3031226_3033452_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.0	1.2e-27
>prophage 232
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3048185	3051708	4742580		Bacillus_phage(100.0%)	2	NA	NA
WP_012104560.1|3048185_3049943_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.2	2.0e-33
WP_012104559.1|3049935_3051708_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.8	4.6e-30
>prophage 233
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3055949	3077044	4742580		Tupanvirus(66.67%)	4	NA	NA
WP_042659651.1|3055949_3061616_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	31.0	1.1e-40
WP_080869046.1|3061628_3073205_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.0	4.6e-38
WP_012104552.1|3073355_3075428_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_002211633.1|3075811_3077044_-	peptidase T	NA	A0A0K2CPK3	Brevibacillus_phage	39.1	1.2e-05
>prophage 234
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3084349	3097519	4742580		Escherichia_phage(100.0%)	1	NA	NA
WP_071880075.1|3084349_3097519_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.8	8.7e-134
>prophage 235
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3161530	3162925	4742580		Apis_mellifera_filamentous_virus(100.0%)	1	NA	NA
WP_052491438.1|3161530_3162925_+	hypothetical protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	29.1	4.7e-06
>prophage 236
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3172993	3173329	4742580	integrase,transposase	Escherichia_phage(100.0%)	1	3172212:3172225	3173954:3173967
3172212:3172225	attL	ATATTTATTTTTTT	NA	NA	NA	NA
WP_080869050.1|3172993_3173329_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	88.0	6.6e-07
WP_080869050.1|3172993_3173329_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	88.0	6.6e-07
3173954:3173967	attR	AAAAAAATAAATAT	NA	NA	NA	NA
>prophage 237
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3192854	3196091	4742580		Staphylococcus_phage(50.0%)	2	NA	NA
WP_042659682.1|3192854_3193688_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	43.5	4.7e-62
WP_042659683.1|3193709_3196091_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	69.9	1.3e-101
>prophage 238
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3200398	3206428	4742580		Bacillus_virus(100.0%)	4	NA	NA
WP_002212178.1|3200398_3202672_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.4	5.4e-84
WP_002212179.1|3202975_3203560_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011193094.1|3203617_3204529_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002212181.1|3204532_3206428_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.5	2.9e-91
>prophage 239
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3211203	3219234	4742580		Erwinia_phage(25.0%)	7	NA	NA
WP_002357252.1|3211203_3211887_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	45.6	2.2e-41
WP_012104467.1|3211896_3213057_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	45.2	2.2e-89
WP_002212189.1|3213463_3214246_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_002212190.1|3214687_3215341_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	45.1	1.1e-42
WP_002212191.1|3215910_3216192_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_002212192.1|3216516_3217767_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_011193099.1|3217803_3219234_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.9	1.8e-37
>prophage 240
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3224804	3267999	4742580	terminase,holin,lysis,head,tRNA,plate,integrase,tail,capsid	Erwinia_phage(46.15%)	50	3234475:3234523	3267106:3267154
WP_011193101.1|3224804_3226043_+	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	4.7e-82
WP_002212198.1|3226278_3227097_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_002212199.1|3227370_3227730_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_002217581.1|3227837_3228488_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_002212201.1|3228733_3229747_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.7	6.5e-106
WP_001144069.1|3230152_3230368_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002210358.1|3230503_3232252_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	8.7e-74
WP_002210359.1|3232409_3234248_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
3234475:3234523	attL	ACTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCAAAT	NA	NA	NA	NA
WP_042592712.1|3234655_3235159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042592711.1|3235175_3235805_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	66.4	1.8e-37
WP_042659685.1|3236093_3236312_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	72.2	1.6e-25
WP_042659686.1|3236418_3237582_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	66.4	1.1e-144
WP_011192200.1|3237578_3238064_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	60.4	1.5e-47
WP_042659687.1|3238063_3240490_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	44.5	1.1e-159
WP_011192202.1|3240482_3240605_-|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	68.4	7.4e-09
WP_011192204.1|3241001_3241517_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	73.1	2.3e-67
WP_042659688.1|3241530_3242700_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	80.5	1.6e-185
WP_042659689.1|3242827_3243310_-|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	41.9	3.0e-29
WP_042659690.1|3243321_3244761_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	78.9	5.8e-76
WP_042659691.1|3244757_3245366_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	79.1	7.9e-91
WP_042659692.1|3245358_3246267_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	80.1	6.6e-126
WP_042659693.1|3246271_3246622_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	66.4	1.7e-37
WP_042659849.1|3246618_3247260_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	60.1	4.4e-68
WP_042659694.1|3247392_3248292_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_042659695.1|3248409_3248856_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	64.6	5.7e-46
WP_042659696.1|3248852_3249308_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	63.3	1.1e-47
WP_071880004.1|3249246_3249444_-|holin	holin	holin	F1BUQ0	Erwinia_phage	59.3	4.0e-12
WP_011192214.1|3249403_3249820_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	49.6	8.7e-25
WP_038830076.1|3249821_3250328_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	63.5	3.1e-56
WP_038830077.1|3250311_3250521_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	44.9	1.7e-08
WP_011192217.1|3250523_3250727_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	64.2	3.5e-19
WP_011192218.1|3250726_3251200_-|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	56.8	1.7e-40
WP_042659697.1|3251299_3251959_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	70.8	1.1e-82
WP_042659698.1|3251962_3253201_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	74.6	3.2e-147
WP_042659699.1|3253277_3254132_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	61.1	8.5e-91
WP_042659700.1|3254280_3256053_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.0	5.0e-287
WP_042659701.1|3257179_3257458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042659850.1|3257878_3259444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042659702.1|3259540_3260092_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	45.6	5.9e-37
WP_033852506.1|3260702_3261062_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	42.5	1.1e-18
WP_042659703.1|3261081_3263361_-	replication endonuclease	NA	Q858T4	Yersinia_virus	56.3	9.4e-238
WP_038830085.1|3263357_3263621_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	45.0	1.7e-13
WP_038830087.1|3263632_3263905_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_042659704.1|3263970_3264282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038830089.1|3264293_3264479_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_038830090.1|3264488_3264998_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	50.6	3.0e-43
WP_102895971.1|3265028_3265289_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	66.2	3.9e-23
WP_042659706.1|3265422_3265998_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	61.7	7.5e-67
WP_042659707.1|3265997_3267023_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	77.6	6.0e-160
WP_071880080.1|3267396_3267999_-|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	50.3	1.4e-39
3267106:3267154	attR	ACTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCAAAT	NA	NA	NA	NA
>prophage 241
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3290814	3291801	4742580		Enterobacteria_phage(100.0%)	1	NA	NA
WP_011193115.1|3290814_3291801_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.0	2.3e-23
>prophage 242
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3295345	3296461	4742580		Planktothrix_phage(100.0%)	1	NA	NA
WP_002353714.1|3295345_3296461_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	8.9e-24
>prophage 243
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3313557	3323610	4742580		Moraxella_phage(100.0%)	1	NA	NA
WP_042659720.1|3313557_3323610_-	contact-dependent inhibition toxin CdiA	NA	A0A0R6PJK4	Moraxella_phage	39.3	4.1e-51
>prophage 244
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3360836	3369831	4742580		Streptococcus_phage(33.33%)	8	NA	NA
WP_002210149.1|3360836_3361736_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.4	1.0e-49
WP_012303495.1|3361798_3363772_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002210147.1|3363870_3364224_+	YraN family protein	NA	NA	NA	NA	NA
WP_011193139.1|3364494_3365085_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.0	2.4e-12
WP_012104422.1|3365095_3365671_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_012104421.1|3365877_3366603_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_012104420.1|3366599_3367253_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002210142.1|3367494_3369831_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.4	9.9e-41
>prophage 245
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3378982	3379498	4742580	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_012104417.1|3378982_3379498_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 246
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3383693	3386245	4742580	protease	uncultured_Mediterranean_phage(100.0%)	2	NA	NA
WP_002218066.1|3383693_3385067_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002210128.1|3385156_3386245_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
>prophage 247
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3390778	3401695	4742580		Bacillus_virus(16.67%)	13	NA	NA
WP_002210121.1|3390778_3391597_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210120.1|3391861_3392836_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210119.1|3392946_3393933_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002228203.1|3394202_3394766_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_011193147.1|3394762_3395326_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002210117.1|3395309_3395855_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002210116.1|3395861_3396587_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210115.1|3396648_3398082_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004392031.1|3398105_3398393_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_002213952.1|3398510_3398993_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210113.1|3399298_3400153_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002210112.1|3400149_3400422_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_012104413.1|3400759_3401695_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.9	3.9e-49
>prophage 248
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3409825	3410470	4742580		Salmonella_phage(100.0%)	1	NA	NA
WP_011055205.1|3409825_3410470_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
>prophage 249
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3432431	3432833	4742580		Proteus_phage(100.0%)	1	NA	NA
WP_012303481.1|3432431_3432833_+	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
>prophage 250
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3455336	3456380	4742580		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002228205.1|3455336_3456380_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.0e-06
>prophage 251
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3473368	3474733	4742580		Burkholderia_virus(100.0%)	1	NA	NA
WP_012104388.1|3473368_3474733_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	25.8	7.9e-14
>prophage 252
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3478718	3479875	4742580		Morganella_phage(100.0%)	3	NA	NA
WP_011193172.1|3478718_3478931_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.6	1.7e-24
WP_012104384.1|3479190_3479403_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	81.4	8.9e-26
WP_002210052.1|3479662_3479875_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	9.9e-25
>prophage 253
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3488581	3493043	4742580		Bacillus_virus(50.0%)	3	NA	NA
WP_002210044.1|3488581_3490078_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.7	1.1e-13
WP_012104382.1|3490281_3491271_-	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210042.1|3492122_3493043_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	6.8e-78
>prophage 254
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3496565	3500012	4742580		Moraxella_phage(50.0%)	3	NA	NA
WP_002210039.1|3496565_3497921_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	74.0	4.1e-164
WP_012104378.1|3498320_3498578_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_011193182.1|3499196_3500012_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	1.5e-28
>prophage 255
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3515955	3518922	4742580		Ralstonia_phage(50.0%)	2	NA	NA
WP_012104368.1|3515955_3518154_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.3e-26
WP_012104367.1|3518514_3518922_+	helix-turn-helix transcriptional regulator	NA	S5MUA5	Brevibacillus_phage	32.2	3.1e-06
>prophage 256
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3535205	3537428	4742580		Ralstonia_phage(100.0%)	1	NA	NA
WP_012104360.1|3535205_3537428_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	3.5e-27
>prophage 257
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3545350	3547954	4742580		Agrobacterium_phage(100.0%)	1	NA	NA
WP_002212107.1|3545350_3547954_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.5	6.4e-89
>prophage 258
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3561870	3562980	4742580		Planktothrix_phage(100.0%)	1	NA	NA
WP_002212091.1|3561870_3562980_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	5.0e-27
>prophage 259
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3578920	3582616	4742580		Dickeya_phage(100.0%)	1	NA	NA
WP_041175719.1|3578920_3582616_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	4.6e-24
>prophage 260
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3590595	3591804	4742580	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_011991005.1|3590595_3591804_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 261
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3599562	3603902	4742580	tRNA	Pandoravirus(50.0%)	6	NA	NA
WP_002209025.1|3599562_3600135_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	30.2	4.9e-10
WP_012105865.1|3600136_3600676_-	DNA topoisomerase	NA	NA	NA	NA	NA
WP_002209023.1|3600716_3601190_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_002209022.1|3601161_3602283_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002209021.1|3602417_3602930_+	peptide deformylase	NA	NA	NA	NA	NA
WP_002209020.1|3602954_3603902_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	29.8	1.2e-05
>prophage 262
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3623516	3626881	4742580		Tupanvirus(50.0%)	2	NA	NA
WP_002212326.1|3623516_3624701_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.0e-13
WP_002212325.1|3624772_3626881_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.7	1.0e-60
>prophage 263
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3635166	3641762	4742580		Tupanvirus(33.33%)	6	NA	NA
WP_002230378.1|3635166_3637089_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	32.1	1.6e-73
WP_012105871.1|3637223_3638213_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	30.6	6.1e-08
WP_012105872.1|3638305_3639286_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_002212310.1|3639298_3640147_-	taurine dioxygenase	NA	NA	NA	NA	NA
WP_002212309.1|3640143_3640998_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_002212307.1|3640994_3641762_-	taurine ABC transporter ATP-binding subunit	NA	G3M9Y6	Bacillus_virus	35.6	1.6e-35
>prophage 264
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3648088	3655040	4742580		environmental_Halophage(20.0%)	5	NA	NA
WP_012105875.1|3648088_3650209_+	membrane protein	NA	H9YQA8	environmental_Halophage	62.3	1.1e-43
WP_042659729.1|3650434_3651652_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	4.5e-29
WP_002223842.1|3651784_3652360_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	3.0e-68
WP_042659730.1|3652603_3654145_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	1.2e-82
WP_002208878.1|3654470_3655040_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	32.3	1.7e-07
>prophage 265
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3671780	3672596	4742580		Vibrio_phage(100.0%)	1	NA	NA
WP_002208895.1|3671780_3672596_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.5	9.0e-66
>prophage 266
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3675937	3677470	4742580		Vibrio_phage(100.0%)	1	NA	NA
WP_162484314.1|3675937_3677470_-	DNA uptake porin HofQ	NA	R9TEZ5	Vibrio_phage	22.3	1.4e-14
>prophage 267
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3688871	3692898	4742580		Bacillus_phage(66.67%)	3	NA	NA
WP_011193240.1|3688871_3690491_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.0	1.6e-138
WP_002208913.1|3690829_3692182_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.1	1.6e-11
WP_002208914.1|3692178_3692898_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	2.7e-29
>prophage 268
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3705114	3707520	4742580		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_012105894.1|3705114_3707520_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.1	4.0e-13
>prophage 269
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3717298	3719746	4742580		Dickeya_phage(100.0%)	1	NA	NA
WP_042659735.1|3717298_3719746_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	84.5	1.2e-33
>prophage 270
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3727610	3729308	4742580		Enterobacteria_phage(100.0%)	1	NA	NA
WP_042659736.1|3727610_3729308_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	68.1	1.7e-204
>prophage 271
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3772215	3773739	4742580		Staphylococcus_phage(100.0%)	1	NA	NA
WP_042659737.1|3772215_3773739_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	2.5e-16
>prophage 272
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3792932	3794069	4742580		Streptococcus_phage(100.0%)	1	NA	NA
WP_012105927.1|3792932_3794069_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.7	8.8e-43
>prophage 273
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3817828	3819882	4742580		Bacillus_virus(50.0%)	2	NA	NA
WP_161597821.1|3817828_3818869_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	5.2e-18
WP_002209562.1|3818901_3819882_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	3.0e-15
>prophage 274
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3826272	3827664	4742580		Moraxella_phage(100.0%)	1	NA	NA
WP_042659744.1|3826272_3827664_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.0	3.2e-23
>prophage 275
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3837713	3839246	4742580		Catovirus(100.0%)	1	NA	NA
WP_012105946.1|3837713_3839246_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	8.1e-84
>prophage 276
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3846911	3855694	4742580		uncultured_Caudovirales_phage(25.0%)	7	NA	NA
WP_002209582.1|3846911_3847871_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	39.3	2.7e-61
WP_012105949.1|3847860_3848868_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_012105950.1|3848864_3849623_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.2	1.0e-15
WP_011193300.1|3851049_3851322_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	80.0	9.7e-25
WP_002209588.1|3851707_3852901_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002209589.1|3852990_3854175_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_012105953.1|3854161_3855694_-	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	6.5e-17
>prophage 277
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3871840	3873793	4742580		Tupanvirus(100.0%)	1	NA	NA
WP_042659749.1|3871840_3873793_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.1	1.1e-11
>prophage 278
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3882449	3883073	4742580		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_002209614.1|3882449_3883073_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	2.4e-63
>prophage 279
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3897220	3900967	4742580		Streptococcus_phage(50.0%)	4	NA	NA
WP_011193335.1|3897220_3897676_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	32.2	8.1e-16
WP_002209628.1|3898033_3898693_+	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_002209629.1|3898823_3899468_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002209630.1|3899986_3900967_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	29.3	9.3e-25
>prophage 280
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3908061	3909216	4742580		Synechococcus_phage(50.0%)	2	NA	NA
WP_033851943.1|3908061_3908526_-	heat shock chaperone IbpB	NA	A0A0E3FB97	Synechococcus_phage	32.2	3.3e-12
WP_002209636.1|3908802_3909216_-	heat shock chaperone IbpA	NA	A0A127KM93	Cyanophage	36.8	7.1e-19
>prophage 281
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3914908	3919701	4742580		Bacillus_virus(50.0%)	4	NA	NA
WP_033852170.1|3914908_3917323_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.0	2.4e-114
WP_012105977.1|3917342_3918428_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_002218418.1|3918426_3918597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209645.1|3918600_3919701_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	36.8	1.1e-53
>prophage 282
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3927834	3942723	4742580		Moraxella_phage(16.67%)	14	NA	NA
WP_012105983.1|3927834_3929163_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	4.7e-64
WP_071525562.1|3929482_3929581_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_012105984.1|3929655_3930324_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_012105985.1|3930339_3931095_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012105986.1|3931096_3931834_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012105987.1|3932016_3932871_-	ABC transporter substrate-binding protein	NA	A0A140XBD5	Dickeya_phage	78.9	7.3e-10
WP_002228151.1|3933090_3933762_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_002220747.1|3934057_3934780_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002215562.1|3934867_3935644_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.2	3.8e-13
WP_012105988.1|3935724_3936612_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002215558.1|3936613_3937570_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_002215557.1|3937799_3938840_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	38.2	5.7e-49
WP_012105990.1|3939322_3941152_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	43.0	4.3e-132
WP_002215550.1|3941352_3942723_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	33.5	6.0e-30
>prophage 283
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3955305	3961547	4742580		Heterosigma_akashiwo_virus(33.33%)	4	NA	NA
WP_002212256.1|3955305_3956298_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	36.0	2.2e-50
WP_002212255.1|3956396_3957863_-	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_011991003.1|3957866_3959405_-	ATPase RavA	NA	A0A0N9NIH9	Sulfolobus_monocaudavirus	32.4	1.6e-18
WP_011191440.1|3959678_3961547_+	low affinity potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	30.3	5.8e-68
>prophage 284
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3971761	3972970	4742580	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_011991005.1|3971761_3972970_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 285
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3976786	3979585	4742580		uncultured_virus(100.0%)	1	NA	NA
WP_011991008.1|3976786_3979585_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.6	6.0e-69
>prophage 286
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3983562	3990079	4742580		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_011191444.1|3983562_3984975_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	25.6	3.1e-05
WP_002213151.1|3984982_3986032_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.2	4.2e-07
WP_002213150.1|3986284_3987694_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_002217380.1|3988255_3990079_+	ribosome-dependent GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	42.3	1.2e-20
>prophage 287
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	3995516	3996902	4742580		environmental_Halophage(100.0%)	1	NA	NA
WP_011191446.1|3995516_3996902_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	80.7	4.5e-57
>prophage 288
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4001499	4009295	4742580	terminase	Bordetella_phage(25.0%)	8	NA	NA
WP_002209002.1|4001499_4003608_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	3.7e-10
WP_004392061.1|4003627_4003903_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002209000.1|4003957_4004581_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.7	2.4e-18
WP_011991012.1|4004981_4006685_+	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.9	1.2e-19
WP_012104253.1|4006704_4007322_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_012104254.1|4008062_4008434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012104255.1|4008450_4008663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012104256.1|4008692_4009295_-|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	49.2	1.1e-39
>prophage 289
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4014240	4015509	4742580	integrase	Morganella_phage(100.0%)	1	4011552:4011566	4016764:4016778
4011552:4011566	attL	GGTTCAGTGTTGGTT	NA	NA	NA	NA
WP_012104264.1|4014240_4015509_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.6	8.8e-193
WP_012104264.1|4014240_4015509_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.6	8.8e-193
4016764:4016778	attR	GGTTCAGTGTTGGTT	NA	NA	NA	NA
>prophage 290
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4019071	4023642	4742580		Xanthomonas_phage(25.0%)	7	NA	NA
WP_011566231.1|4019071_4019530_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.5	6.0e-51
WP_038824339.1|4019507_4020725_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	9.1e-46
WP_002208992.1|4020918_4021587_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002208991.1|4021849_4022086_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002208990.1|4022097_4022265_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002208989.1|4022347_4023157_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	32.7	6.7e-21
WP_012104267.1|4023162_4023642_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.3	4.7e-30
>prophage 291
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4028178	4036900	4742580		Synechococcus_phage(20.0%)	8	NA	NA
WP_002208983.1|4028178_4029111_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.6	1.3e-31
WP_012104268.1|4029356_4030568_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	27.6	4.6e-34
WP_011191451.1|4030577_4031603_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	8.0e-19
WP_011191452.1|4031740_4032751_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_012104269.1|4032774_4034145_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	35.7	2.4e-10
WP_012104270.1|4034154_4035702_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002208978.1|4036098_4036533_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002208977.1|4036651_4036900_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	50.0	5.4e-14
>prophage 292
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4041501	4045871	4742580	tail,transposase	Bacillus_phage(33.33%)	5	NA	NA
WP_002208971.1|4041501_4042878_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.4	1.5e-17
WP_002208970.1|4042874_4043573_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.8e-06
WP_002208969.1|4043746_4044235_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_144405811.1|4044690_4044867_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_002353252.1|4044950_4045871_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	8.6e-73
>prophage 293
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4061801	4066095	4742580		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_002208954.1|4061801_4062650_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.5	3.2e-13
WP_002208953.1|4063421_4063661_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_011191463.1|4063980_4066095_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	2.8e-34
>prophage 294
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4070924	4072256	4742580		Erwinia_phage(100.0%)	1	NA	NA
WP_002208943.1|4070924_4072256_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
>prophage 295
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4097460	4099269	4742580		Bacillus_phage(100.0%)	1	NA	NA
WP_042659769.1|4097460_4099269_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	31.2	2.6e-25
>prophage 296
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4103214	4103946	4742580		Synechococcus_phage(100.0%)	1	NA	NA
WP_002209479.1|4103214_4103946_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	58.5	1.3e-47
>prophage 297
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4109382	4111257	4742580		Acinetobacter_phage(100.0%)	1	NA	NA
WP_024063655.1|4109382_4111257_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.3	2.2e-14
>prophage 298
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4119981	4121472	4742580		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011191480.1|4119981_4121472_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.7	1.2e-10
>prophage 299
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4127223	4128870	4742580		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_002212017.1|4127223_4128870_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.7	3.1e-65
>prophage 300
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4150012	4155433	4742580		Bacillus_phage(33.33%)	4	NA	NA
WP_012104296.1|4150012_4152034_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.0	4.9e-113
WP_032466602.1|4152201_4153695_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002228177.1|4153701_4154988_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.1	6.4e-34
WP_002211990.1|4155106_4155433_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	42.1	1.9e-14
>prophage 301
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4160300	4166777	4742580		Enterobacteria_phage(40.0%)	6	NA	NA
WP_011191498.1|4160300_4161431_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	28.4	5.9e-31
WP_002211985.1|4161427_4162690_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HPJ2	Paramecium_bursaria_Chlorella_virus	26.3	4.7e-21
WP_011191500.1|4162686_4163754_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	1.2e-99
WP_002211983.1|4164048_4164930_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.6	1.3e-105
WP_002211982.1|4164907_4165645_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_002211981.1|4165646_4166777_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	35.5	7.9e-20
>prophage 302
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4186029	4189918	4742580		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_002211473.1|4186029_4186941_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	31.2	4.6e-18
WP_002211474.1|4186940_4187657_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_002211475.1|4187755_4189918_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	9.3e-118
>prophage 303
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4197533	4199366	4742580		Catovirus(100.0%)	1	NA	NA
WP_002211484.1|4197533_4199366_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	36.8	2.4e-82
>prophage 304
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4212523	4217162	4742580		Dickeya_phage(50.0%)	4	NA	NA
WP_011191518.1|4212523_4213192_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	56.4	6.3e-57
WP_002215973.1|4213452_4213707_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	91.7	2.0e-11
WP_012104321.1|4213755_4216122_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	36.7	3.3e-116
WP_012104322.1|4216535_4217162_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	63.7	1.2e-30
>prophage 305
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4221417	4224197	4742580		Staphylococcus_phage(50.0%)	3	NA	NA
WP_002211504.1|4221417_4222086_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	9.5e-13
WP_002211505.1|4222075_4223029_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_002211506.1|4223339_4224197_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.0	4.6e-44
>prophage 306
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4228716	4230230	4742580		Bacillus_virus(50.0%)	2	NA	NA
WP_011191524.1|4228716_4229484_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	23.9	8.3e-13
WP_002211512.1|4229528_4230230_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.6	1.7e-12
>prophage 307
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4241185	4243005	4742580		Planktothrix_phage(50.0%)	2	NA	NA
WP_011191533.1|4241185_4242259_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	6.8e-21
WP_011191534.1|4242255_4243005_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	26.1	3.1e-12
>prophage 308
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4254926	4261465	4742580		Alteromonas_phage(33.33%)	7	NA	NA
WP_012104343.1|4254926_4256432_+	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	61.8	1.4e-08
WP_002224024.1|4256523_4257279_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_041175718.1|4257292_4257943_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_002211535.1|4257942_4259574_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.1	5.3e-41
WP_002211536.1|4259753_4260020_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_002211537.1|4260023_4260686_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_011191543.1|4260688_4261465_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	33.3	4.2e-28
>prophage 309
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4271602	4272214	4742580		Streptococcus_phage(100.0%)	1	NA	NA
WP_002231137.1|4271602_4272214_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	44.4	1.7e-24
>prophage 310
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4282424	4302795	4742580	transposase	uncultured_Mediterranean_phage(14.29%)	16	NA	NA
WP_002212290.1|4282424_4283375_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.2	8.7e-28
WP_162007551.1|4283585_4284038_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002210669.1|4285119_4286304_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_002210670.1|4286554_4286938_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210671.1|4286939_4287485_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210672.1|4287675_4288104_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210673.1|4288107_4288812_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210674.1|4289176_4289674_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210675.1|4289740_4290109_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210676.1|4290451_4294480_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210677.1|4294608_4298829_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_002213775.1|4299059_4299518_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002210678.1|4299845_4300976_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002228257.1|4300968_4301784_-	thiazole synthase	NA	NA	NA	NA	NA
WP_002217275.1|4301785_4302001_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_012105863.1|4301997_4302795_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	26.9	4.3e-12
>prophage 311
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4310912	4314974	4742580		Bacillus_phage(50.0%)	4	NA	NA
WP_002210689.1|4310912_4311188_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_012303442.1|4311237_4311891_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210691.1|4312038_4313325_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002210692.1|4313384_4314974_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
>prophage 312
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4325050	4327009	4742580		Staphylococcus_phage(100.0%)	1	NA	NA
WP_011191563.1|4325050_4327009_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.8	1.3e-86
>prophage 313
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4330020	4332840	4742580		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_012105858.1|4330020_4332840_-	two component system sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	28.4	7.5e-35
>prophage 314
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4353579	4354380	4742580		Pithovirus(100.0%)	1	NA	NA
WP_002209058.1|4353579_4354380_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.5	1.9e-15
>prophage 315
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4365660	4374748	4742580	protease	Acinetobacter_phage(33.33%)	10	NA	NA
WP_002209070.1|4365660_4366740_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	36.1	3.7e-43
WP_002209071.1|4366732_4367545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209072.1|4367537_4368674_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.3	4.8e-33
WP_012105843.1|4368685_4369747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011191586.1|4370022_4370616_+	tellurium resistance protein TerZ	NA	A0A2L1IWC0	Streptomyces_phage	34.5	9.3e-12
WP_002209075.1|4370615_4371800_+	tellurite resistance protein	NA	NA	NA	NA	NA
WP_002209076.1|4371832_4372288_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_012105842.1|4372309_4373347_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	49.1	5.9e-78
WP_002209078.1|4373410_4373989_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.5	4.9e-34
WP_012105841.1|4374172_4374748_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.5	1.6e-29
>prophage 316
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4395262	4395871	4742580		Lactococcus_phage(100.0%)	1	NA	NA
WP_002209090.1|4395262_4395871_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	39.8	7.8e-14
>prophage 317
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4400276	4409066	4742580		Salmonella_phage(25.0%)	6	NA	NA
WP_002209095.1|4400276_4401683_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.4	2.8e-192
WP_012105831.1|4401779_4402859_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.7	4.9e-27
WP_012105830.1|4403044_4404238_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002209098.1|4404764_4405124_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_012105829.1|4405216_4408060_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.4	1.3e-308
WP_002209100.1|4408517_4409066_+	single-stranded DNA-binding protein SSB1	NA	A0A291LCB6	Klebsiella_phage	90.1	1.1e-54
>prophage 318
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4418671	4422079	4742580		Escherichia_phage(50.0%)	2	NA	NA
WP_002209112.1|4418671_4419097_-	subtilase	NA	A0A0U2KD34	Escherichia_phage	50.0	6.0e-29
WP_041175800.1|4419523_4422079_+	enhancing factor	NA	A0A068LKB3	Peridroma_alphabaculovirus	23.2	5.4e-40
>prophage 319
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4434984	4436971	4742580		uncultured_virus(50.0%)	2	NA	NA
WP_002209127.1|4434984_4435278_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	36.8	3.3e-10
WP_002209128.1|4435324_4436971_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	66.9	1.6e-183
>prophage 320
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4442330	4444154	4742580		Lactobacillus_phage(100.0%)	1	NA	NA
WP_002209137.1|4442330_4444154_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.6	1.0e-16
>prophage 321
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4451814	4452360	4742580		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_011191612.1|4451814_4452360_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.1	2.9e-28
>prophage 322
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4456794	4460631	4742580		Bacillus_virus(50.0%)	2	NA	NA
WP_042659784.1|4456794_4458708_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	M1HNA7	Bacillus_virus	27.9	4.6e-28
WP_012105753.1|4458723_4460631_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.3e-58
>prophage 323
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4466354	4471242	4742580		Pithovirus(50.0%)	3	NA	NA
WP_012105751.1|4466354_4467653_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.2	1.7e-66
WP_002217229.1|4468041_4468467_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002209159.1|4468707_4471242_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	2.5e-66
>prophage 324
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4493580	4495321	4742580		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_002210169.1|4493580_4494108_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	9.3e-56
WP_011191626.1|4494307_4495321_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	45.8	1.8e-71
>prophage 325
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4500130	4502005	4742580		Vibrio_phage(33.33%)	3	NA	NA
WP_002210175.1|4500130_4500406_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	1.1e-18
WP_002210176.1|4500589_4500937_+	putative DNA-binding transcriptional regulator	NA	A0A0M3LPN5	Mannheimia_phage	45.2	7.3e-09
WP_011191628.1|4501033_4502005_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	27.6	7.8e-08
>prophage 326
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4505194	4506921	4742580		Bacillus_phage(100.0%)	2	NA	NA
WP_002210182.1|4505194_4506262_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	21.9	4.7e-06
WP_002210183.1|4506258_4506921_-	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	35.5	8.4e-30
>prophage 327
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4510362	4513250	4742580	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_002228195.1|4510362_4512297_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	44.5	4.4e-119
WP_011191630.1|4512416_4513250_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.2	1.4e-18
>prophage 328
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4517675	4520354	4742580		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_002223151.1|4517675_4520354_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	2.3e-25
>prophage 329
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4525771	4527766	4742580		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_002209261.1|4525771_4527766_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.3	1.6e-52
>prophage 330
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4539754	4540042	4742580		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_002209274.1|4539754_4540042_-	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	54.1	9.6e-15
>prophage 331
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4547182	4548277	4742580		Bacillus_virus(100.0%)	1	NA	NA
WP_012105737.1|4547182_4548277_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	32.0	2.1e-25
>prophage 332
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4553274	4555174	4742580		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_012105733.1|4553274_4553994_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.6	1.3e-07
WP_041175794.1|4554382_4555174_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.1	5.4e-15
>prophage 333
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4559395	4564190	4742580		Cronobacter_phage(25.0%)	4	NA	NA
WP_025470743.1|4559395_4559860_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.5	9.4e-52
WP_002209296.1|4560036_4562175_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	65.3	1.5e-269
WP_012105727.1|4562608_4563325_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	2.3e-20
WP_002209298.1|4563311_4564190_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-10
>prophage 334
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4571763	4587753	4742580	integrase,tRNA	Klosneuvirus(20.0%)	9	4568727:4568740	4584116:4584129
4568727:4568740	attL	CGTCGTGCTGCAAA	NA	NA	NA	NA
WP_011191653.1|4571763_4574661_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	5.5e-142
WP_002209309.1|4574673_4575123_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002209310.1|4575273_4576785_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.7	5.4e-48
WP_002209311.1|4577064_4578159_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002223173.1|4578158_4579235_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_042659787.1|4579623_4580883_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	1.7e-79
WP_042659867.1|4581037_4582948_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_042659788.1|4582940_4584878_+	ATP-binding protein	NA	A0A2H4J2R8	uncultured_Caudovirales_phage	67.4	6.7e-253
4584116:4584129	attR	TTTGCAGCACGACG	NA	NA	NA	NA
WP_042659789.1|4585074_4587753_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	39.9	1.1e-173
>prophage 335
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4591380	4592667	4742580		Enterobacteria_phage(100.0%)	1	NA	NA
WP_042659792.1|4591380_4592667_-	hypothetical protein	NA	Q858S9	Enterobacteria_phage	27.3	9.3e-41
>prophage 336
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4604522	4605344	4742580		Yersinia_phage(100.0%)	1	NA	NA
WP_004389304.1|4604522_4605344_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	35.9	1.3e-40
>prophage 337
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4613036	4616877	4742580		Staphylococcus_phage(100.0%)	2	NA	NA
WP_042659809.1|4613036_4614284_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	29.1	9.1e-09
WP_042659810.1|4614285_4616877_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	40.3	6.1e-92
>prophage 338
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4624370	4626947	4742580		Hokovirus(100.0%)	1	NA	NA
WP_012105718.1|4624370_4626947_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.3	1.4e-11
>prophage 339
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4632219	4633803	4742580		Staphylococcus_phage(100.0%)	1	NA	NA
WP_012105714.1|4632219_4633803_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	6.7e-25
>prophage 340
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4641854	4644941	4742580		Leptospira_phage(100.0%)	1	NA	NA
WP_011191676.1|4641854_4644941_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	19.0	7.0e-18
>prophage 341
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4648098	4649253	4742580		Bacillus_virus(100.0%)	1	NA	NA
WP_012105710.1|4648098_4649253_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	32.2	1.5e-18
>prophage 342
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4652889	4655749	4742580		Streptococcus_phage(50.0%)	3	NA	NA
WP_011191681.1|4652889_4654479_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.6	8.8e-33
WP_011191682.1|4654806_4655421_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_011191683.1|4655587_4655749_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	49.0	2.7e-06
>prophage 343
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4661263	4662586	4742580		Geobacillus_virus(100.0%)	1	NA	NA
WP_011191687.1|4661263_4662586_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.8	2.0e-78
>prophage 344
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4668455	4681024	4742580		Bacillus_phage(33.33%)	8	NA	NA
WP_002209221.1|4668455_4669727_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	46.3	2.4e-89
WP_011191690.1|4669883_4671014_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.4e-08
WP_011191691.1|4671159_4672827_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	25.6	3.9e-39
WP_002215967.1|4673009_4673516_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002209224.1|4673521_4674823_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.6	3.7e-13
WP_002209225.1|4674819_4675443_-	YfiR family protein	NA	NA	NA	NA	NA
WP_011191693.1|4675808_4678535_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.0	8.5e-68
WP_011191694.1|4679104_4681024_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	37.5	6.1e-12
>prophage 345
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4693306	4694260	4742580		Cyanophage(100.0%)	1	NA	NA
WP_002209241.1|4693306_4694260_+	transaldolase	NA	A0A127KNC6	Cyanophage	28.8	4.3e-11
>prophage 346
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4700442	4710655	4742580	tRNA	Chrysochromulina_ericina_virus(25.0%)	8	NA	NA
WP_012105698.1|4700442_4702353_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.3	1.4e-146
WP_012105697.1|4702464_4703604_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	4.7e-20
WP_012105696.1|4703846_4705031_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.0	2.9e-89
WP_002220713.1|4705160_4706060_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_002220715.1|4706190_4706454_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_157131898.1|4706570_4706735_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_002210510.1|4706868_4707807_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_002210509.1|4707838_4710655_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.1	1.0e-63
>prophage 347
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4714573	4715749	4742580		Halovirus(100.0%)	1	NA	NA
WP_002224759.1|4714573_4715749_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	6.9e-51
>prophage 348
NZ_CP010067	Yersinia pseudotuberculosis str. PA3606 chromosome, complete genome	4742580	4721563	4722046	4742580		Bacillus_phage(100.0%)	1	NA	NA
WP_002210497.1|4721563_4722046_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.6	4.7e-30
>prophage 1
NZ_CP010069	Yersinia pseudotuberculosis str. PA3606 plasmid unnamed1, complete sequence	74956	31600	54659	74956	transposase,protease	Enterobacteria_phage(57.14%)	22	NA	NA
WP_042659886.1|31600_32569_-|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_042592523.1|33068_33617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071880093.1|34214_34844_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_002220902.1|36854_38021_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_042659889.1|38017_38983_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	4.0e-89
WP_158499626.1|39142_39469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002224342.1|40334_40577_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213360.1|40569_40869_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_072080538.1|41008_41668_-	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213403.1|41861_42254_+	YopE transcriptional regulator YerA	NA	NA	NA	NA	NA
WP_042659891.1|43063_44236_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.9	2.9e-222
WP_002213267.1|45011_45437_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_144405817.1|45584_46684_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	3.1e-45
WP_042659894.1|46783_47113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042659895.1|47251_47716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|47734_48286_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_042659896.1|48449_50759_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.5	2.3e-276
WP_032494814.1|51744_53043_+	trimeric autotransporter adhesin YadA	NA	Q9MCI8	Enterobacteria_phage	54.2	2.0e-11
WP_057533956.1|53045_53345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072080544.1|53371_53632_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|53710_54169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072080544.1|54398_54659_+|transposase	transposase	transposase	NA	NA	NA	NA
