The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010023	Yersinia pestis str. Pestoides B chromosome, complete genome	4607660	1419623	1504565	4607660	plate,transposase,tRNA	Bacillus_virus(15.79%)	67	NA	NA
WP_002212210.1|1419623_1420823_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.0	7.1e-27
WP_002212211.1|1421498_1422470_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	74.3	3.1e-137
WP_002212212.1|1422594_1424745_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.8	1.1e-211
WP_002215935.1|1424726_1425131_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	32.8	3.5e-10
WP_002212214.1|1425144_1425381_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	53.3	5.9e-18
WP_002212215.1|1425901_1426267_+	acid shock protein	NA	NA	NA	NA	NA
WP_002212216.1|1426744_1427080_+	YgaC family protein	NA	NA	NA	NA	NA
WP_002209743.1|1427314_1428523_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211577.1|1428547_1429738_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211576.1|1429722_1430331_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211575.1|1430435_1430960_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211574.1|1430983_1432486_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211573.1|1432811_1433297_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211572.1|1433570_1434110_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211571.1|1434113_1435463_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_042659205.1|1436141_1437164_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	4.1e-201
WP_001297096.1|1437163_1437943_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002214843.1|1438803_1442631_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_002231007.1|1442924_1445276_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	3.0e-29
WP_002209684.1|1445374_1445635_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002231006.1|1445634_1446462_+	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_002209685.1|1446501_1447308_+	ImpE family protein	NA	NA	NA	NA	NA
WP_002209686.1|1447420_1447900_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002209804.1|1449308_1449587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209803.1|1449645_1450113_-	DUF943 family protein	NA	NA	NA	NA	NA
WP_002209801.1|1450634_1451435_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_002209800.1|1452614_1453124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209799.1|1453410_1454301_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_002209798.1|1454936_1456331_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	81.4	1.5e-177
WP_002209797.1|1456605_1456944_-	YegP family protein	NA	NA	NA	NA	NA
WP_002209796.1|1457080_1457800_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.8	2.3e-33
WP_002231001.1|1457809_1459195_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	30.5	8.5e-32
WP_002209795.1|1459225_1460623_-	MFS transporter	NA	NA	NA	NA	NA
WP_002209794.1|1460656_1463731_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_002209793.1|1463727_1466886_-	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002214676.1|1466885_1468220_-	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002231000.1|1468583_1469669_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	7.1e-26
WP_002209790.1|1470051_1471557_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	31.7	4.0e-19
WP_002209789.1|1471738_1473028_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	2.1e-24
WP_002209788.1|1473080_1474109_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209787.1|1474155_1475421_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209786.1|1475482_1476331_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209785.1|1476602_1477955_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002209784.1|1478094_1479570_-	magnesium transporter	NA	NA	NA	NA	NA
WP_012303868.1|1479621_1479810_-	DUF2633 family protein	NA	NA	NA	NA	NA
WP_002209783.1|1479945_1481505_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002209782.1|1481515_1483579_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002214670.1|1483849_1486081_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002214668.1|1486080_1487793_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002209780.1|1487820_1488633_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.8	1.3e-16
WP_002214664.1|1488846_1489227_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002228400.1|1489202_1490036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209779.1|1490129_1490675_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_002209778.1|1490903_1491542_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.4	3.1e-29
WP_002209777.1|1491656_1492700_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.3	9.1e-71
WP_002209776.1|1493096_1493723_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002213775.1|1493898_1494357_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228401.1|1494544_1495252_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002208565.1|1495463_1495820_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.3	6.1e-19
WP_002217569.1|1495926_1497411_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002208563.1|1497741_1498806_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002208561.1|1499405_1500101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002224836.1|1500767_1501238_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002227068.1|1501240_1501810_-	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002227834.1|1501974_1502856_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_002208557.1|1502873_1503932_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002213775.1|1504106_1504565_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP010023	Yersinia pestis str. Pestoides B chromosome, complete genome	4607660	2110666	2117577	4607660	integrase,transposase	Bacteriophage(12.5%)	9	2108635:2108665	2117603:2117633
2108635:2108665	attL	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002211732.1|2110666_2111230_-	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002215638.1|2111278_2111497_-	ash family protein	NA	NA	NA	NA	NA
WP_002215636.1|2111500_2111890_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002211735.1|2111890_2112496_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002211736.1|2112569_2113016_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_071525537.1|2112991_2113741_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002215632.1|2114040_2114301_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_000255944.1|2115246_2116269_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211738.1|2116338_2117577_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
2117603:2117633	attR	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
>prophage 3
NZ_CP010023	Yersinia pestis str. Pestoides B chromosome, complete genome	4607660	2520251	2590014	4607660	coat,transposase,protease,tRNA	Pandoravirus(12.5%)	60	NA	NA
WP_002209716.1|2520251_2522321_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002209715.1|2522498_2522777_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002209714.1|2522834_2523377_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002209713.1|2523476_2524283_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_002225365.1|2524286_2525114_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002209711.1|2525119_2526205_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.4	2.7e-89
WP_002209710.1|2526281_2527214_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002227846.1|2527583_2528114_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002209707.1|2528523_2529015_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002209705.1|2529582_2531907_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002209704.1|2531906_2533217_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002227845.1|2533503_2533800_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_002209702.1|2534213_2535479_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002209701.1|2535585_2536350_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_002209700.1|2536385_2537612_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002214855.1|2537611_2538124_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002209699.1|2538120_2538687_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_002209698.1|2538683_2540654_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002209697.1|2540650_2541145_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_002209696.1|2541141_2541444_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_002209695.1|2541440_2542178_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_002209694.1|2542240_2542900_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_002209693.1|2542869_2543526_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A1V0SE00	Indivirus	24.7	4.8e-09
WP_002209692.1|2543970_2544438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209691.1|2545053_2545596_+	LemA family protein	NA	NA	NA	NA	NA
WP_002209690.1|2545600_2547640_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_002209688.1|2548015_2548357_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_042659211.1|2548431_2548731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|2548730_2549939_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|2549986_2550337_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|2550672_2551509_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|2551600_2552362_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210831.1|2552697_2554365_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210832.1|2554405_2555296_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|2556222_2557350_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|2557365_2558658_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|2558955_2559666_+	porin	NA	NA	NA	NA	NA
WP_002210837.1|2560145_2560694_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210838.1|2560897_2562289_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|2562503_2563355_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|2563739_2564531_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|2564717_2565884_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|2566210_2567578_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|2567631_2568435_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|2568431_2569595_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210844.1|2569591_2572204_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|2572285_2573065_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|2573217_2573760_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|2574417_2575299_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|2575790_2577863_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|2577882_2578596_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|2578691_2579189_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|2579420_2580668_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002216616.1|2580636_2583288_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|2583766_2584321_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|2584326_2584857_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|2584877_2585435_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210856.1|2585465_2586218_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210857.1|2586371_2588819_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002230846.1|2589024_2590014_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP010023	Yersinia pestis str. Pestoides B chromosome, complete genome	4607660	2755552	2859842	4607660	plate,transposase,tail,coat,holin,protease	Pseudomonas_phage(15.62%)	89	NA	NA
WP_002210815.1|2755552_2756062_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210816.1|2756096_2756354_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210817.1|2756357_2757488_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210818.1|2757650_2759939_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210820.1|2760432_2761161_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210821.1|2761422_2764098_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_011171779.1|2764285_2767159_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210824.1|2767226_2767880_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002216094.1|2767882_2768455_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_002216093.1|2768622_2770575_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002210825.1|2770598_2771753_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210826.1|2772855_2773971_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002228026.1|2774710_2775877_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002230696.1|2776151_2777588_-	MFS transporter	NA	NA	NA	NA	NA
WP_002230695.1|2777964_2778993_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208868.1|2779066_2780854_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|2781260_2782196_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208866.1|2782367_2782610_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208864.1|2782815_2783538_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|2783811_2784291_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|2784501_2785806_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002208861.1|2786514_2787327_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|2787302_2788097_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|2788710_2789001_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|2789046_2789664_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|2789668_2789863_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208856.1|2789859_2791368_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208855.1|2791389_2791758_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_002208854.1|2791759_2792059_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208853.1|2792179_2793673_+|coat	coat protein	coat	NA	NA	NA	NA
WP_002208852.1|2793939_2795346_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|2795342_2796398_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002215460.1|2796413_2797010_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208848.1|2797006_2797462_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|2797465_2798602_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|2798598_2798859_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|2798855_2799203_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002208845.1|2799299_2800079_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208843.1|2800376_2801117_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208842.1|2801407_2802844_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002209743.1|2803028_2804237_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_162828733.1|2804410_2804695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228617.1|2804808_2805045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016256670.1|2805185_2805512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158499539.1|2805558_2805873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220152.1|2806959_2808315_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.6	4.1e-55
WP_002220154.1|2808705_2809416_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_002220156.1|2809467_2810454_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_002220158.1|2810467_2812210_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	6.3e-24
WP_002230687.1|2812214_2813390_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002220162.1|2813402_2814509_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002220163.1|2814547_2814874_-	EthD family reductase	NA	NA	NA	NA	NA
WP_002220165.1|2814884_2815112_-	N5,N10-methylene tetrahydromethanopterin reductase	NA	NA	NA	NA	NA
WP_002220168.1|2815666_2816578_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002220169.1|2816578_2817688_-	alkene reductase	NA	NA	NA	NA	NA
WP_002220170.1|2818035_2819400_-	sigma 54-interacting transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.1	1.3e-05
WP_002220171.1|2819386_2821201_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	1.0e-16
WP_002220173.1|2821558_2822032_+	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_002213759.1|2822837_2823296_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002214195.1|2824224_2825088_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|2825433_2826282_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|2826319_2827213_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|2827444_2829493_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|2829857_2830454_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002218281.1|2830511_2831984_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002220180.1|2832006_2833710_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002213775.1|2833938_2834397_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210775.1|2834631_2835342_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002210774.1|2835484_2835937_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_002210773.1|2835939_2836185_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_002210772.1|2836181_2836661_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_002210771.1|2836761_2837742_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_002210768.1|2841284_2841530_-	VF530 family DNA-binding protein	NA	NA	NA	NA	NA
WP_002210767.1|2841821_2843837_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_002210766.1|2844927_2845638_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.3	3.5e-13
WP_002216554.1|2845789_2846512_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_002210764.1|2846504_2847308_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_002210763.1|2847291_2848443_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_002210762.1|2848442_2849480_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_002220188.1|2849578_2850859_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.1	2.4e-17
WP_002210760.1|2851043_2852048_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_002210759.1|2852338_2853160_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_002210758.1|2853215_2854295_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.4e-21
WP_002210757.1|2854288_2854984_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002210756.1|2854983_2855763_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002217291.1|2855997_2856150_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_002210754.1|2856415_2857207_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002210753.1|2857316_2858807_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.8	2.8e-12
WP_002210751.1|2859023_2859842_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP010023	Yersinia pestis str. Pestoides B chromosome, complete genome	4607660	2906745	2915470	4607660	transposase	Escherichia_phage(28.57%)	9	NA	NA
WP_002210709.1|2906745_2906946_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|2906945_2907488_+	ash family protein	NA	NA	NA	NA	NA
WP_002215950.1|2907480_2908440_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002210707.1|2908436_2909525_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|2909873_2910188_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|2910193_2910511_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_000255944.1|2911115_2912138_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2912137_2912917_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211063.1|2913388_2915470_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	30.7	4.1e-14
>prophage 6
NZ_CP010023	Yersinia pestis str. Pestoides B chromosome, complete genome	4607660	3007019	3051537	4607660	plate,transposase,lysis,tRNA	Indivirus(14.29%)	36	NA	NA
WP_002211870.1|3007019_3009047_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002213775.1|3009210_3009669_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228565.1|3009886_3010549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|3011246_3012323_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211974.1|3012340_3013594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211973.1|3013926_3015108_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211971.1|3015349_3015757_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211970.1|3015753_3016449_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211969.1|3016774_3017659_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211968.1|3018014_3019712_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211966.1|3019992_3020730_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002211965.1|3021174_3022185_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_002211964.1|3022205_3023726_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
WP_002211963.1|3023955_3024948_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211961.1|3025695_3026862_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211960.1|3026916_3027579_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|3027762_3028914_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|3029049_3029919_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002224699.1|3030192_3031332_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	6.1e-36
WP_002211956.1|3031352_3032195_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002227980.1|3032451_3032664_+	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002215886.1|3032747_3035108_+	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002211952.1|3035109_3036372_+	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211951.1|3036373_3037042_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_002211950.1|3037051_3038362_+	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211949.1|3038896_3040171_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211948.1|3040172_3040943_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002209743.1|3041109_3042318_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002230748.1|3042339_3042984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|3043211_3044807_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211945.1|3045489_3046113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211944.1|3046324_3047692_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002211943.1|3047716_3048169_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002214552.1|3048168_3048750_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211941.1|3048724_3049810_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211940.1|3049773_3051537_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NZ_CP010023	Yersinia pestis str. Pestoides B chromosome, complete genome	4607660	3818366	3881068	4607660	holin,tail,transposase,protease	Proteus_phage(10.0%)	51	NA	NA
WP_002210082.1|3818366_3819812_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002210083.1|3820014_3822873_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210084.1|3822933_3825765_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210086.1|3825965_3826325_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_002210087.1|3826321_3826723_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
WP_002214300.1|3826735_3827038_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002210089.1|3827171_3831662_-	toxin	NA	NA	NA	NA	NA
WP_002220204.1|3831718_3835312_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002230509.1|3835352_3837860_-	toxin	NA	NA	NA	NA	NA
WP_002214297.1|3838095_3838962_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210092.1|3839222_3840134_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002210093.1|3840436_3840640_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002210094.1|3840647_3841583_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210095.1|3841584_3843540_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002214288.1|3845469_3845943_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210098.1|3845947_3846229_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002210099.1|3846340_3846889_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210100.1|3847069_3848410_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011055205.1|3848658_3849303_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210102.1|3849510_3849897_+	cytochrome b562	NA	NA	NA	NA	NA
WP_002210103.1|3850112_3850523_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210104.1|3850875_3852543_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002215779.1|3852637_3854053_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210106.1|3854463_3855417_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002210107.1|3855650_3856127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210109.1|3856425_3856812_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|3856949_3857414_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|3857425_3858361_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|3858698_3858971_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|3858967_3859822_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|3860127_3860610_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|3861038_3862472_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002210116.1|3862533_3863259_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|3863265_3863811_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|3863794_3864358_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|3864354_3864918_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|3865166_3866153_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002210120.1|3866263_3867238_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|3867502_3868321_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|3868538_3869321_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|3869325_3869883_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|3869895_3870519_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|3870554_3870857_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|3871003_3871258_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|3871411_3872674_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|3872854_3873943_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002213775.1|3874168_3874627_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210453.1|3874773_3876336_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|3876338_3877430_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|3877431_3878862_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_000255944.1|3880045_3881068_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 8
NZ_CP010023	Yersinia pestis str. Pestoides B chromosome, complete genome	4607660	4040630	4115572	4607660	plate,transposase,protease	Escherichia_phage(18.18%)	60	NA	NA
WP_071525507.1|4040630_4040969_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002209171.1|4041312_4042686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002230553.1|4042657_4043380_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002230554.1|4043429_4044761_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_002209167.1|4045784_4047101_-	McrC family protein	NA	NA	NA	NA	NA
WP_002209166.1|4047097_4049161_-	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	33.2	5.3e-30
WP_001297096.1|4050317_4051097_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|4051436_4051823_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|4052117_4054832_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|4054909_4055443_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|4055471_4055996_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|4056162_4057083_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|4057182_4058334_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|4058406_4059663_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|4059689_4060517_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|4060518_4061439_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|4061431_4062907_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|4063044_4064115_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|4064111_4065314_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|4065313_4066630_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|4066632_4067715_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|4067708_4069085_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|4069081_4070569_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210440.1|4070555_4072319_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|4072384_4072702_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|4072698_4073661_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|4073663_4074122_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|4074676_4074766_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|4075223_4075664_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|4075794_4076805_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213759.1|4077309_4077768_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210448.1|4077966_4078461_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002228103.1|4078463_4080191_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002216437.1|4080650_4082456_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|4083004_4083961_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|4084638_4084854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|4085282_4085741_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002218066.1|4085857_4087231_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002210130.1|4087501_4087906_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002210131.1|4088129_4089257_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210132.1|4089570_4089999_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210133.1|4090013_4090406_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002230558.1|4090402_4090600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210135.1|4090779_4091421_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002216203.1|4091426_4091942_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
WP_002224291.1|4092094_4092580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210138.1|4093020_4094439_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002228691.1|4094448_4098906_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_002210140.1|4099728_4100652_+	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_002210142.1|4100915_4103252_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.4	9.9e-41
WP_002210143.1|4103493_4104147_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002210144.1|4104143_4104869_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002210145.1|4105075_4105651_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002210146.1|4105661_4106252_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.0	3.2e-12
WP_002210147.1|4106522_4106876_-	YraN family protein	NA	NA	NA	NA	NA
WP_002228200.1|4106959_4108933_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002210149.1|4108995_4109895_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.4	1.0e-49
WP_002210150.1|4110831_4111536_-	pirin family protein	NA	NA	NA	NA	NA
WP_002210151.1|4111797_4112691_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001436717.1|4114618_4115572_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	8.3e-180
>prophage 1
NZ_CP010022	Yersinia pestis str. Pestoides B plasmid pCD, complete sequence	70169	31426	59299	70169	transposase,protease	Enterobacteria_phage(42.86%)	25	NA	NA
WP_002231153.1|31426_31834_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	6.2e-07
WP_002213244.1|31857_32175_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|32346_32805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469136.1|32873_33143_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213256.1|35754_38070_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
WP_002213258.1|38233_38785_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002224338.1|38803_39268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229829.1|39406_39736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016640.1|39835_40934_+|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002213267.1|41082_41508_-	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_042659194.1|42281_43415_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.5	3.2e-202
WP_002213403.1|46218_46611_-	type III secretion system chaperone SycE/YerA	NA	NA	NA	NA	NA
WP_002229754.1|46804_47464_+	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213360.1|47603_47903_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002224342.1|47895_48138_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213357.1|48681_48855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154020274.1|49003_49240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213354.1|49399_50365_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
WP_002220902.1|50361_51528_-	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002229770.1|53539_54169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213007.1|54766_55315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213006.1|55814_56783_+|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_002213004.1|56782_57181_+	type III secretion system chaperone SycT	NA	NA	NA	NA	NA
WP_002222515.1|57885_58305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116442925.1|59053_59299_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP010021	Yersinia pestis str. Pestoides B plasmid pMT, complete sequence	106992	0	106467	106992	integrase,transposase,tail,terminase	Salmonella_phage(80.49%)	103	55015:55032	68074:68091
WP_002211774.1|71_869_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_011901831.1|861_1560_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	6.4e-137
WP_000440566.1|1649_1985_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|2026_6604_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|6611_6836_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|6961_7279_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|7338_8085_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|8159_8543_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|8544_9018_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|9008_9353_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|9450_10284_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|10283_10718_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|10761_11424_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|11498_12374_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002231160.1|12400_13297_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_002211786.1|13319_14894_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	2.4e-301
WP_002211787.1|14927_16184_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|16186_16828_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|17023_17290_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|17299_18190_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|18195_18450_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|18442_19081_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|19077_19746_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|19745_20444_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|20508_22068_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|22070_22349_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|22408_22831_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|22835_23363_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|23686_24337_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|24421_24649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211801.1|25287_25770_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|25975_26257_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213759.1|26456_26915_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_011901832.1|27153_27909_-	hypothetical protein	NA	J9Q742	Salmonella_phage	98.4	3.8e-135
WP_002231164.1|28107_29250_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_002231165.1|29357_31673_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	98.8	0.0e+00
WP_002214145.1|31750_32320_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|32332_33079_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_002214148.1|33068_34985_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
WP_002213300.1|35214_36300_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002213298.1|36715_37738_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002389821.1|38097_38322_-	hypothetical protein	NA	J9Q739	Salmonella_phage	97.3	1.5e-34
WP_002214164.1|39506_40571_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|41139_41352_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|41351_41687_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|41683_41863_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|41903_42179_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|42246_42657_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|42640_43012_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|43165_43996_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|43999_44200_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_000920226.1|45369_45636_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|45635_46580_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|46640_47669_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|47788_48220_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|48440_48692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|48764_49328_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|49357_49783_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002231173.1|52564_55282_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.4	0.0e+00
55015:55032	attL	CCAATGATTCCATACATC	NA	NA	NA	NA
WP_002211767.1|55462_56698_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|56794_59161_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002228800.1|59270_59483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228802.1|59745_60132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353208.1|60126_61230_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002216410.1|61990_62503_-	F1 capsule protein Caf1	NA	NA	NA	NA	NA
WP_002211763.1|62583_65085_-	F1 capsule-anchoring usher protein Caf1A	NA	NA	NA	NA	NA
WP_002211762.1|65109_65886_-	F1 capsule chaperone Caf1M	NA	NA	NA	NA	NA
WP_002211761.1|66213_67119_+	F1 operon transcriptional regulator Caf1R	NA	NA	NA	NA	NA
WP_002224363.1|67633_67939_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
WP_002225462.1|67935_68088_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	2.0e-19
WP_002224361.1|68084_68300_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
68074:68091	attR	GATGTATGGAATCATTGG	NA	NA	NA	NA
WP_002231172.1|68459_69782_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.1	1.6e-258
WP_002231171.1|69816_70293_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	96.2	1.3e-77
WP_025471067.1|70374_70572_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	98.4	2.8e-29
WP_001297096.1|70632_71412_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|71411_72434_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211744.1|72557_74567_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_002211745.1|74639_74870_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211746.1|75658_76165_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211747.1|76563_77343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|77396_77816_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211748.1|77826_78048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|78047_78725_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211750.1|79225_79426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228775.1|79587_80985_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002215070.1|81363_82335_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002211752.1|82331_83537_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002211753.1|83838_84066_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002215068.1|84065_84392_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211754.1|84591_85212_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215065.1|85277_86219_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211756.1|86241_86517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211758.1|87149_88913_+	phospholipase D	NA	NA	NA	NA	NA
WP_002211760.1|90988_92011_-|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002209743.1|92479_93688_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002224263.1|93721_94444_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_002231158.1|94696_95377_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.1	5.3e-104
WP_000255944.1|95390_96413_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|96412_97192_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|97321_97930_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|98231_101120_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|101200_101779_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|101835_106467_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
