The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	43258	98677	4501786	transposase,protease,tRNA	uncultured_Mediterranean_phage(25.0%)	50	NA	NA
WP_012228761.1|43258_44734_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.4e-181
WP_002209980.1|45481_46597_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209979.1|46600_47485_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209978.1|47664_48087_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209977.1|48086_48650_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209976.1|48765_49725_-	glutathione synthase	NA	NA	NA	NA	NA
WP_002209975.1|49750_50482_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_012229925.1|50590_50773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209973.1|50751_51459_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002228653.1|51556_52069_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|52261_53416_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|54604_56584_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209968.1|56743_57064_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_071525520.1|57097_57208_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209967.1|57353_58106_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209965.1|58596_60591_+	transketolase	NA	NA	NA	NA	NA
WP_002213775.1|60898_61357_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_012229926.1|61446_61611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209896.1|61722_62034_+	PTS transporter subunit EIIB	NA	A0A2I7SAJ6	Vibrio_phage	39.2	3.3e-08
WP_002215759.1|62390_63650_-	maltoporin	NA	NA	NA	NA	NA
WP_002209894.1|63921_64995_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	43.6	2.9e-72
WP_002213775.1|65175_65634_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_012229927.1|66017_68387_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_002209891.1|68537_69845_-	MFS transporter	NA	NA	NA	NA	NA
WP_002209890.1|70238_71321_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209889.1|71543_72122_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_002209888.1|72145_73000_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_002209887.1|73109_74597_-	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_002209886.1|74719_76327_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_012229928.1|76347_77574_-	anaerobic sulfatase maturase	NA	A0A1B2IC15	Erwinia_phage	33.1	5.4e-06
WP_002209884.1|78004_79063_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_002230627.1|79078_79834_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	6.7e-15
WP_002209882.1|80029_81196_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_002209881.1|81198_81639_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002209880.1|81724_82615_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_012229929.1|82604_83393_-	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_002209878.1|83439_83937_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_012229932.1|83954_85121_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002209876.1|85117_86416_-	tagatose-bisphosphate aldolase subunit KbaZ	NA	NA	NA	NA	NA
WP_002362901.1|86465_87218_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002209873.1|88081_89635_+	sulfatase	NA	A0A1V0SA98	Catovirus	26.1	5.4e-19
WP_002213759.1|90086_90545_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208669.1|90751_91720_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.7	1.9e-46
WP_002208670.1|91730_93578_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_002208671.1|93605_93941_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.6	6.4e-10
WP_002208672.1|94052_95177_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	3.2e-90
WP_002208673.1|95269_96340_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002216927.1|96542_97124_+	ACP phosphodiesterase	NA	NA	NA	NA	NA
WP_002208675.1|97402_98005_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_042666680.1|98218_98677_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	137659	197341	4501786	transposase,protease,tRNA	Escherichia_phage(44.44%)	51	NA	NA
WP_012229943.1|137659_139015_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_002212137.1|139043_139892_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002212136.1|139901_140660_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	1.4e-23
WP_002212135.1|140883_142080_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_002212134.1|142293_142851_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_012229944.1|142986_143712_-	UMP kinase	NA	NA	NA	NA	NA
WP_002212132.1|143920_144778_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002221800.1|144905_145631_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002212129.1|146839_149521_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_002212128.1|149695_150520_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_002212127.1|150643_151033_+	DUF3461 family protein	NA	NA	NA	NA	NA
WP_002212126.1|151122_151572_-	flavodoxin	NA	NA	NA	NA	NA
WP_002212125.1|151599_152373_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_002212124.1|152372_152705_-	YqcC family protein	NA	NA	NA	NA	NA
WP_002209872.1|152954_153389_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000255944.1|153445_154468_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|154467_155247_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_012229945.1|155297_156818_-	aminotransferase class V-fold PLP-dependent enzyme	NA	G9BWD6	Planktothrix_phage	41.1	5.3e-35
WP_002208733.1|156798_157452_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002208734.1|157448_158117_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012229946.1|158129_158918_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002208736.1|159245_160079_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208738.1|160388_160592_+	oxalurate catabolism protein HpxX	NA	NA	NA	NA	NA
WP_002208739.1|160588_161986_+	AtzE family amidohydrolase	NA	NA	NA	NA	NA
WP_002264506.1|162095_162482_+	oxalurate catabolism protein HpxZ	NA	NA	NA	NA	NA
WP_002208741.1|162718_163918_+	MFS transporter	NA	NA	NA	NA	NA
WP_002208742.1|164077_164851_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002208743.1|164847_165189_+	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_002208744.1|165360_165873_+	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_002208745.1|166256_167429_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_002208746.1|167467_169003_+	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_012229947.1|169125_170292_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002216643.1|170543_170981_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	36.6	2.6e-11
WP_002208749.1|171150_171900_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_002223249.1|171942_174585_+	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002208751.1|174760_176116_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002208752.1|176177_176519_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002220061.1|181915_182101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002217405.1|182426_185000_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	2.4e-128
WP_002209471.1|185129_185861_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002231132.1|185862_186840_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_002209469.1|186975_187707_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002209468.1|188061_188424_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_041854827.1|188755_189214_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002228330.1|189496_190654_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002209465.1|190758_191880_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002228238.1|191892_192963_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	1.5e-89
WP_002223245.1|193195_193912_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001297096.1|194065_194845_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|194844_195867_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213775.1|196882_197341_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	1054732	1115342	4501786	transposase,protease,tRNA	Bacillus_phage(17.65%)	59	NA	NA
WP_002213775.1|1054732_1055191_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208996.1|1055433_1056081_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002208995.1|1056215_1056812_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_011566231.1|1056933_1057392_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.5	6.0e-51
WP_002208993.1|1057369_1058587_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	9.1e-46
WP_002208992.1|1058780_1059449_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002208991.1|1059711_1059948_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002208990.1|1059959_1060127_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002208989.1|1060209_1061019_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	32.7	6.7e-21
WP_002208988.1|1061024_1061504_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.7	1.0e-29
WP_002208987.1|1061500_1062283_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002208986.1|1062283_1063561_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_002208985.1|1063980_1064946_-	lipopolysaccharide heptosyltransferase RfaC	NA	NA	NA	NA	NA
WP_002208984.1|1064945_1066010_-	ADP-heptose--LPS heptosyltransferase RfaF	NA	NA	NA	NA	NA
WP_002208983.1|1066040_1066973_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	36.6	1.3e-31
WP_002208982.1|1067218_1068430_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	27.6	4.6e-34
WP_002208981.1|1068439_1069465_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	8.0e-19
WP_002208980.1|1070560_1071931_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	35.7	2.4e-10
WP_002208979.1|1071940_1073488_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002208978.1|1073884_1074319_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002208977.1|1074437_1074686_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	50.0	5.4e-14
WP_002208976.1|1074773_1075250_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_002208975.1|1075249_1076269_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002208974.1|1076534_1077356_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_002208973.1|1077478_1077967_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_000255944.1|1079058_1080081_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_012228794.1|1080080_1080860_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.9e-138
WP_002208971.1|1081227_1082604_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.4	1.5e-17
WP_002208970.1|1082600_1083299_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.8e-06
WP_002208969.1|1083472_1083961_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_002221684.1|1084417_1084594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353252.1|1084677_1085598_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	8.6e-73
WP_002208967.1|1086159_1087062_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_002208966.1|1087279_1088263_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002208965.1|1088483_1089473_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002218867.1|1089722_1090499_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208963.1|1090616_1092044_-	anion permease	NA	NA	NA	NA	NA
WP_002208962.1|1092109_1092823_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_002208961.1|1092819_1093557_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_002208960.1|1093693_1094929_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208959.1|1095160_1095928_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_002215864.1|1096056_1096692_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_002208957.1|1096839_1097274_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_002208956.1|1097595_1098342_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_041854751.1|1098496_1099507_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_002218876.1|1099743_1101267_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_002208954.1|1101443_1102292_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.5	3.2e-13
WP_002208953.1|1102919_1103159_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_002213759.1|1103366_1103825_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002230357.1|1104195_1106310_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	2.8e-34
WP_002208949.1|1106302_1107595_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_002215873.1|1107807_1108047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228141.1|1108676_1109261_+	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_002208945.1|1109377_1109863_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_002208944.1|1110004_1110922_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002208943.1|1111157_1112489_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
WP_002208942.1|1112559_1113084_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002208941.1|1113183_1114029_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002213775.1|1114883_1115342_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	1120149	1208413	4501786	transposase,protease,tRNA,plate	Acinetobacter_phage(22.22%)	50	NA	NA
WP_002209474.1|1120149_1121253_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_002228170.1|1121732_1123610_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	24.8	1.3e-11
WP_002228171.1|1123554_1124418_+	glutamate racemase	NA	NA	NA	NA	NA
WP_041175547.1|1124683_1124869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086016626.1|1130408_1131507_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	2.2e-46
WP_002215609.1|1134635_1135334_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209983.1|1135466_1136288_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002209984.1|1136575_1137130_+	YggT family protein	NA	NA	NA	NA	NA
WP_002215612.1|1137126_1137417_+	YggU family protein	NA	NA	NA	NA	NA
WP_002215614.1|1137516_1138110_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002209987.1|1138102_1139233_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002209743.1|1139401_1140610_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_041854754.1|1140745_1150078_-	pore forming RTX toxin family protein	NA	NA	NA	NA	NA
WP_002209989.1|1151418_1152345_-	glutaminase B	NA	NA	NA	NA	NA
WP_002209990.1|1152455_1152782_-	YggL family protein	NA	NA	NA	NA	NA
WP_002209991.1|1152781_1153501_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_041854841.1|1153838_1154954_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002230648.1|1155131_1155404_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002209995.1|1155586_1156663_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002209997.1|1156944_1158045_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209998.1|1158133_1160167_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_012228890.1|1160249_1161230_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210000.1|1161262_1162762_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002210001.1|1162807_1163767_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|1164322_1166485_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210005.1|1167813_1168449_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_086016632.1|1169056_1169754_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210008.1|1169849_1170617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210009.1|1170603_1172901_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_012228901.1|1172916_1175265_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_012228902.1|1175261_1177910_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_012228903.1|1178327_1178819_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_041854755.1|1178822_1180559_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210015.1|1180558_1181245_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002213011.1|1181241_1182594_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_041854756.1|1182605_1184150_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_012228906.1|1184192_1184693_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215900.1|1186967_1187363_-	lipoprotein	NA	NA	NA	NA	NA
WP_002215902.1|1187813_1188464_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215903.1|1189638_1190289_+	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_002211655.1|1190269_1191013_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012228910.1|1192896_1194237_+	peptidase	NA	NA	NA	NA	NA
WP_002211652.1|1194613_1195447_+	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_002228661.1|1195594_1195789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211651.1|1195736_1196960_-	MFS transporter	NA	NA	NA	NA	NA
WP_002211649.1|1198854_1199805_+	acetyltransferase	NA	NA	NA	NA	NA
WP_002211648.1|1199801_1201550_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_012228914.1|1202947_1205128_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_002211645.1|1205386_1206811_-	MFS transporter	NA	NA	NA	NA	NA
WP_100067904.1|1207058_1208413_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 6
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	2168885	2224362	4501786	transposase,protease,tail	uncultured_Mediterranean_phage(18.18%)	50	NA	NA
WP_002216203.1|2168885_2169401_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
WP_012229216.1|2169406_2170048_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002230558.1|2170227_2170425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210133.1|2170421_2170814_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002210132.1|2170828_2171257_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210131.1|2171570_2172698_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210130.1|2172921_2173326_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002218066.1|2173596_2174970_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002213775.1|2175086_2175545_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210128.1|2175770_2176859_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002210127.1|2177039_2178302_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210126.1|2178442_2178697_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210125.1|2178843_2179146_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210124.1|2179181_2179805_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210123.1|2179817_2180375_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210122.1|2180379_2181162_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210121.1|2181379_2182198_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210120.1|2182462_2183437_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210119.1|2183547_2184534_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002228203.1|2184782_2185346_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002218352.1|2185342_2185906_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002210117.1|2185889_2186435_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002210116.1|2186441_2187167_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_012229232.1|2187228_2188662_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002213952.1|2189090_2189573_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210113.1|2189878_2190733_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002210112.1|2190729_2191002_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210111.1|2191339_2192275_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210110.1|2192286_2192751_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210109.1|2192888_2193275_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210107.1|2193573_2194050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210106.1|2194283_2195237_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002215779.1|2195647_2197063_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210104.1|2197157_2198825_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002210103.1|2199177_2199588_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210102.1|2199827_2200214_-	cytochrome b562	NA	NA	NA	NA	NA
WP_011055205.1|2200421_2201066_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_012229239.1|2201314_2202655_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_002210099.1|2202835_2203384_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210098.1|2203495_2203777_-	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002214288.1|2203781_2204255_-	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210095.1|2206190_2208146_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002210094.1|2208147_2209083_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210093.1|2209090_2209294_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002210092.1|2209596_2210508_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002214297.1|2210768_2211635_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210090.1|2211870_2214372_+	toxin	NA	NA	NA	NA	NA
WP_012229241.1|2214412_2218006_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002210089.1|2218062_2222553_+	toxin	NA	NA	NA	NA	NA
WP_012229243.1|2222892_2224362_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	3.7e-179
>prophage 7
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	2264753	2338664	4501786	transposase,protease,tRNA,integrase	Bacillus_virus(12.5%)	59	2285769:2285828	2346743:2347759
WP_042666681.1|2264753_2265212_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210051.1|2265616_2266792_+	DNA repair ATPase	NA	NA	NA	NA	NA
WP_002210050.1|2266898_2268245_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_002228699.1|2268498_2269350_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_012229272.1|2269539_2270145_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_012229273.1|2270141_2271779_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_002210046.1|2271797_2272751_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012229276.1|2272752_2273697_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210044.1|2273689_2275186_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.7	1.1e-13
WP_012229279.1|2275389_2276379_-	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210042.1|2277172_2278093_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	6.8e-78
WP_002210041.1|2278244_2279432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215816.1|2279649_2281299_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_002210039.1|2281647_2283003_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	74.0	4.1e-164
WP_002210038.1|2283456_2283660_+	DNA-damage-inducible protein J	NA	NA	NA	NA	NA
WP_012229280.1|2284267_2285083_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	2.6e-28
WP_012229282.1|2285222_2286698_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.4e-181
2285769:2285828	attL	GTCATACTCTTTTTTCTCCGGAGGCAGTGCCAGCATGGACTGCTGCTCTTCGAGCCAGCG	NA	NA	NA	NA
WP_002209166.1|2286831_2288895_+	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	33.2	5.3e-30
WP_002209167.1|2288891_2290208_+	McrC family protein	NA	NA	NA	NA	NA
WP_002209169.1|2291231_2292557_+	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_002230553.1|2292606_2293329_+	histidine kinase	NA	NA	NA	NA	NA
WP_012229284.1|2293300_2294737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|2294699_2295908_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002215988.1|2297331_2298045_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002208592.1|2298424_2299567_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002208591.1|2301033_2302047_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_012229288.1|2303190_2304156_+	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	47.6	4.8e-82
WP_002208590.1|2304335_2305742_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.3	5.4e-50
WP_002208589.1|2305744_2306488_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.8	8.6e-07
WP_002208588.1|2306492_2307866_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	29.1	8.1e-35
WP_002208587.1|2307913_2309065_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_002208586.1|2309268_2310573_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_012229292.1|2310669_2312358_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_002208584.1|2312592_2313807_-	MFS transporter	NA	NA	NA	NA	NA
WP_002208583.1|2315828_2316068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208581.1|2316404_2316884_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002208580.1|2317148_2317958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012229295.1|2318478_2321346_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.7	8.5e-111
WP_002208578.1|2321552_2321972_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_002208577.1|2322080_2322530_-	NfeD family protein	NA	NA	NA	NA	NA
WP_002208576.1|2322532_2323447_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002208575.1|2323641_2324511_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_002208574.1|2324587_2325364_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041854772.1|2325750_2326386_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_012229298.1|2326356_2327043_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	1.0e-30
WP_002208571.1|2327039_2329469_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208570.1|2329512_2330577_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002208569.1|2330573_2331098_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002208568.1|2331373_2332096_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_002208567.1|2332106_2332601_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_002222677.1|2332811_2334197_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.5	2.2e-40
WP_002213759.1|2334523_2334982_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209775.1|2335128_2335341_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002209774.1|2335355_2336222_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
WP_041854773.1|2336577_2336760_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_002215268.1|2337018_2337219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012229308.1|2337332_2337980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215266.1|2337964_2338303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079866998.1|2338385_2338664_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.5	4.2e-31
2346743:2347759	attR	GTCATACTCTTTTTTCTCCGGAGGCAGTGCCAGCATGGACTGCTGCTCTTCGAGCCAGCGATCGCAGGGACGGGCCTGGATTGTTTCATGCTTTCGTTGGTTAGCGACATCGTGCAGCCAGCGCAGACCGTGGCGGTTGGCTGTTTCAACATCGACAGTGATCCCCATCGGGCGCAGGCGAGTCATTAGTGGGATGTAAAAACTGTTACGGGTGTACTGCACCATCCGTTCCACCTTACCTTTAGTCTGTGCCCTGAAGGGGCGACACAGTCGGGGAGAGAAGCCCATCTCCTTGCCGAACTGCCACAGCGAAGGATGGAACCGGTGCTGACCGGTCTGATATGCGTCACGTTGCAGAACCACAGTTTTCATATTGTCATACAACACTTCGCGCGGCACACCACCAAAGAAGCGGAACGCATTACGATGGCAGGTCTCCAGCGTGTCATAACGCATATTGTCAGTGAATTCGATGTACAGCATTCGGCTGTATCCGAGAACAGCAACGAACACGTGAAGCGGTGAGCGACCATTACGCATAGTGCCCCAGTCAACCTGCATCTGTCGTCCGGGTTCAGTTTCGAACCGAACGGCAGGCTCCTGCTCCTGAGGAACCGAGAGAGAACGAATGAATGCCCTGAGAATGGTCATTCCGCCACGATATCCCTGGTCTCTGATCTCGCGAGCGATTACCGTTGCCGGGATTTTGTAAGGATGAGCATCGGCGATGCGTTGACGAATATAATCCCGGTATTCATCCAGGAGTGAAGCAACAGCAGGTCGCGGCGTATATTTTGGCGGCTCAGATTTTGCCTGCAAATAACGTTTAACGGTATTGCGGGAGATCCCCAGTTCTCTGGCAATCGCCCGGCTACTCATTCCCTGCTTGTGCAGGATTTTAATTTCCATAACTGTCTCAAAAGTGACCATAAACTCTCCTGAATCAGGAGAGCAGATTACCCCCTGGATCTGATTTCAGGCGTTGGGTGTGGATCACTATTGCACCGTTCGTTACAA	NA	NA	NA	NA
>prophage 8
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	2465230	2533247	4501786	tail,transposase,plate,protease,coat	Escherichia_phage(13.04%)	62	NA	NA
WP_002210751.1|2465230_2466049_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002210753.1|2466265_2467756_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.8	2.8e-12
WP_002210754.1|2467865_2468657_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002217291.1|2468905_2469058_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_002210756.1|2469292_2470072_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012229365.1|2470071_2470767_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002210758.1|2470760_2471840_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.4e-21
WP_002210759.1|2471895_2472717_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_002220188.1|2474192_2475473_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.1	2.4e-17
WP_002210762.1|2475571_2476609_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_002210763.1|2476608_2477760_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_002210764.1|2477743_2478547_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_002216554.1|2478539_2479262_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_002210766.1|2479394_2480105_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.3	3.5e-13
WP_002210767.1|2481199_2483215_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_002210768.1|2483506_2483752_+	DNA-binding protein VF530	NA	NA	NA	NA	NA
WP_002210769.1|2483882_2484806_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.8	3.7e-23
WP_002210771.1|2485337_2486318_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_002210772.1|2486418_2486898_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_002210773.1|2486894_2487140_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_002210774.1|2487142_2487595_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_002210775.1|2487737_2488448_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002213759.1|2488682_2489141_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_012228761.1|2489542_2491018_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.4e-181
WP_002210825.1|2493189_2494344_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210826.1|2495454_2496570_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002228026.1|2497309_2498476_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002208870.1|2498750_2500277_-	MFS transporter	NA	NA	NA	NA	NA
WP_002230695.1|2500653_2501682_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208868.1|2501755_2503543_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|2503979_2504915_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208866.1|2505086_2505329_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208864.1|2505534_2506257_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|2506530_2507010_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|2507220_2508525_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002208861.1|2509233_2510046_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|2510021_2510816_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|2511447_2511738_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|2511783_2512401_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|2512405_2512600_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208856.1|2512596_2514105_+|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208855.1|2514126_2514495_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002208854.1|2514496_2514796_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208853.1|2514916_2516410_+|coat	coat protein	coat	NA	NA	NA	NA
WP_012229392.1|2516676_2518083_+	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|2518079_2519135_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_012229395.1|2519150_2519747_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208848.1|2519743_2520199_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|2520202_2521339_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|2521335_2521596_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|2521592_2521940_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_012229397.1|2522036_2522816_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	51.9	1.0e-50
WP_002208843.1|2523113_2523854_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012229399.1|2524144_2525581_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208841.1|2525706_2526069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208840.1|2526768_2527257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208839.1|2527269_2528418_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_002230704.1|2528774_2529158_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208837.1|2529388_2531185_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002208836.1|2531212_2531440_-	YejL family protein	NA	NA	NA	NA	NA
WP_002208835.1|2531617_2532622_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002213759.1|2532788_2533247_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	2992378	3013288	4501786	transposase,protease,plate	uncultured_virus(50.0%)	16	NA	NA
WP_002209743.1|2992378_2993587_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209688.1|2994766_2995108_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002209687.1|2995182_2995530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209686.1|2995554_2996034_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012104872.1|2996098_2996905_-	ImpE family protein	NA	NA	NA	NA	NA
WP_002354537.1|2996924_2997767_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_002209684.1|2997772_2998033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012229527.1|2998131_3000756_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	3.4e-29
WP_042666695.1|3001560_3002769_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209681.1|3006241_3007078_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_012228761.1|3007093_3008569_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.4e-181
WP_002211286.1|3009202_3009391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220006.1|3009656_3010175_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002224683.1|3010243_3011995_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002226586.1|3012205_3012661_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_042666681.1|3012829_3013288_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	3264313	3294073	4501786	transposase,tail,lysis	Cronobacter_phage(17.24%)	35	NA	NA
WP_042666697.1|3264313_3264772_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_144405494.1|3266351_3267305_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	4.7e-167
WP_001297096.1|3267372_3268152_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215632.1|3268319_3268580_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_071525537.1|3268879_3269629_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002211736.1|3269604_3270051_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_002211735.1|3270124_3270730_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002215636.1|3270730_3271120_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_041854794.1|3271123_3271342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|3271390_3271954_+	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002211731.1|3272377_3272587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002430108.1|3272933_3273131_+	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002211730.1|3273161_3273674_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002211729.1|3273658_3274117_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211727.1|3274662_3275376_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211724.1|3276328_3276778_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211723.1|3276781_3277366_+	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002209743.1|3277413_3278622_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211722.1|3278626_3279601_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002228445.1|3279600_3280329_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002228446.1|3280347_3280989_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_012229589.1|3280989_3282102_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.0	3.9e-120
WP_002211720.1|3282223_3282997_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211717.1|3283871_3284126_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211716.1|3284127_3284478_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211715.1|3284479_3285064_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|3285060_3285468_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|3285533_3286454_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|3286466_3286778_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071525538.1|3286825_3287086_+	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_012229598.1|3287086_3290590_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	1.1e-117
WP_002211710.1|3290592_3290934_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002213759.1|3291239_3291698_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210990.1|3291953_3292793_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002222427.1|3293104_3294073_-	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	28.7	7.3e-14
>prophage 11
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	3385958	3505319	4501786	transposase,protease,tail,integrase	Escherichia_phage(14.29%)	99	3481746:3481776	3505345:3505375
WP_002213775.1|3385958_3386417_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_012229644.1|3386506_3388531_+	virulence factor	NA	NA	NA	NA	NA
WP_012229646.1|3388699_3389494_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_002232808.1|3389855_3389951_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_002213759.1|3390157_3390616_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002230908.1|3392435_3392783_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002211025.1|3392849_3393524_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_002223598.1|3393654_3396051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211024.1|3396596_3398042_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_002211023.1|3398282_3398801_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.5	1.6e-23
WP_002211022.1|3398873_3399626_+	FNR family transcription factor	NA	NA	NA	NA	NA
WP_002211020.1|3400990_3402385_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_002211019.1|3402457_3403984_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_002211018.1|3404513_3405467_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002211017.1|3405736_3407128_+	amino acid permease	NA	NA	NA	NA	NA
WP_012229654.1|3407151_3407568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211015.1|3407864_3408611_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_012229656.1|3410015_3411515_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_002213759.1|3411636_3412095_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210622.1|3412324_3414940_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	34.1	1.4e-88
WP_002228458.1|3414966_3415266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210623.1|3415358_3415610_+	YciN family protein	NA	NA	NA	NA	NA
WP_002210624.1|3415728_3416775_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	1.6e-22
WP_002210625.1|3416946_3417708_+	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_002210626.1|3417724_3418315_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_012229663.1|3418437_3419472_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_041854882.1|3419801_3420401_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_079993239.1|3420357_3421263_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002227930.1|3421536_3421599_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_002228454.1|3421717_3423280_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_002215981.1|3423279_3423858_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	37.3	7.4e-30
WP_041854798.1|3423872_3424871_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	37.8	1.0e-50
WP_012229668.1|3424874_3426302_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.0	2.9e-35
WP_002210633.1|3426458_3427649_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_012229670.1|3427648_3428464_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_002210636.1|3428806_3429121_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_041854799.1|3429678_3429858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012229672.1|3429857_3431048_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_002230897.1|3431167_3431803_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_002210638.1|3431911_3432127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210639.1|3432288_3433059_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_002215979.1|3433179_3433800_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_041854800.1|3433831_3434860_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.2	1.1e-07
WP_002210640.1|3435090_3435633_+	septation protein A	NA	NA	NA	NA	NA
WP_002210641.1|3435712_3436162_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_002209743.1|3436309_3437518_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210664.1|3438031_3439378_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210665.1|3439684_3440701_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002213759.1|3441586_3442045_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210666.1|3442745_3443210_+	YchJ family protein	NA	NA	NA	NA	NA
WP_002230891.1|3443293_3444142_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	7.0e-13
WP_002209743.1|3444742_3445951_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211667.1|3447876_3448683_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211668.1|3448780_3449167_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|3449179_3449470_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211670.1|3449466_3451392_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211671.1|3451453_3452500_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211673.1|3452724_3453276_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002230886.1|3453438_3455289_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211675.1|3455405_3456422_+	asparaginase	NA	NA	NA	NA	NA
WP_002211676.1|3456436_3457084_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002217933.1|3457217_3457490_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002211677.1|3457560_3457974_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002224141.1|3458321_3459317_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211679.1|3459630_3460506_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002430110.1|3460578_3461328_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211681.1|3461771_3463706_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002211683.1|3465237_3466356_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211684.1|3466390_3467296_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211685.1|3467493_3468363_+	pirin family protein	NA	NA	NA	NA	NA
WP_002216508.1|3468627_3469830_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211686.1|3469845_3471150_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_012229676.1|3471614_3473150_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211688.1|3473367_3474087_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_012229677.1|3474330_3475899_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002227934.1|3476134_3476665_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002214494.1|3477081_3477438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|3478529_3479270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211693.1|3479286_3480486_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002214492.1|3480489_3481662_+	MFS transporter	NA	NA	NA	NA	NA
3481746:3481776	attL	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_097608205.1|3483396_3483765_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002211696.1|3483826_3484744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211697.1|3484760_3485759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|3485758_3488962_-	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211700.1|3489533_3490154_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211701.1|3490209_3490425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214482.1|3490567_3491119_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211704.1|3491217_3492225_-	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002211705.1|3492298_3492466_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211706.1|3492589_3493021_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211708.1|3493978_3494689_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211709.1|3494691_3495444_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_041854760.1|3495563_3496022_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A1S5REW8	Helicobacter_phage	24.1	1.7e-08
WP_002210985.1|3496939_3497914_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_002210987.1|3499105_3500722_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002227906.1|3500964_3501948_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001297096.1|3502209_3502989_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3502988_3504011_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211738.1|3504080_3505319_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
3505345:3505375	attR	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
>prophage 12
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	3640382	3700308	4501786	transposase,tRNA	Escherichia_phage(16.67%)	54	NA	NA
WP_042666698.1|3640382_3641405_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	5.4e-201
WP_002210983.1|3642258_3643836_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_012229742.1|3644171_3644618_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_002210981.1|3644696_3645155_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_002210980.1|3645164_3646226_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_002210979.1|3646222_3647620_-	YcjX family protein	NA	NA	NA	NA	NA
WP_002216375.1|3647600_3647843_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002210977.1|3647927_3648287_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002210976.1|3648286_3648514_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002210975.1|3648675_3649341_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_002210974.1|3649585_3650614_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002213775.1|3650778_3651237_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_012229746.1|3651901_3653548_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_002210972.1|3653544_3654510_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_002210971.1|3654496_3655387_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_002210970.1|3655386_3656379_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	25.3	8.8e-07
WP_012229750.1|3656378_3657194_+	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	30.9	6.5e-16
WP_012229752.1|3657583_3658864_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_002215910.1|3659506_3661012_+	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_002210965.1|3661266_3661857_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_012229762.1|3662102_3662351_+	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|3662412_3663621_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210962.1|3663933_3664539_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_002210960.1|3665612_3666887_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.4	3.0e-84
WP_002210959.1|3667068_3667722_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_002218323.1|3667812_3668127_-	lipoprotein	NA	NA	NA	NA	NA
WP_002218322.1|3668184_3669297_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_002210956.1|3669852_3670320_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_002213759.1|3670547_3671006_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210955.1|3671173_3671605_-	virulence master transcriptional regulator RovA	NA	NA	NA	NA	NA
WP_002210954.1|3672402_3673299_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_002210953.1|3673430_3673670_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_002210952.1|3673843_3675481_+	phosphoethanolamine transferase EptA	NA	NA	NA	NA	NA
WP_002210951.1|3675703_3676303_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210950.1|3676390_3677488_+	alkene reductase	NA	NA	NA	NA	NA
WP_012229765.1|3677708_3680651_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210948.1|3680923_3681331_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_002210947.1|3681409_3682090_+	ribonuclease T	NA	NA	NA	NA	NA
WP_087768161.1|3682104_3682200_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210946.1|3682398_3682749_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_002210945.1|3683188_3684040_+	hydrolase	NA	A0A2H4PI41	Streptomyces_phage	43.9	2.8e-17
WP_002210944.1|3684417_3684996_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	45.6	4.4e-43
WP_002216285.1|3685099_3685189_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_002210943.1|3685522_3686548_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.4	5.9e-30
WP_002210942.1|3686636_3687569_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012229766.1|3687858_3689061_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.2	4.1e-14
WP_012229767.1|3689540_3690692_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	46.0	9.4e-85
WP_002210939.1|3691454_3692111_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.7	1.1e-21
WP_002210938.1|3692155_3692347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210937.1|3692359_3693733_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002210936.1|3694763_3696176_+	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_002227902.1|3696496_3696733_+	major outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_002213759.1|3696923_3697382_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_001618661.1|3699285_3700308_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	2.0e-200
>prophage 13
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	3714719	3781399	4501786	transposase,protease,tRNA	Tupanvirus(22.22%)	60	NA	NA
WP_002213759.1|3714719_3715178_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211813.1|3715516_3717901_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	4.1e-175
WP_002211815.1|3719228_3720275_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	49.0	3.2e-84
WP_002211816.1|3721958_3722975_-	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_002216102.1|3723099_3723564_-	lipoprotein	NA	A0A217EQL1	Bacillus_phage	37.0	8.9e-10
WP_002211818.1|3723504_3723687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211819.1|3723843_3724230_-	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF	NA	NA	NA	NA	NA
WP_002211820.1|3724226_3724571_-	4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnE	NA	NA	NA	NA	NA
WP_002211821.1|3724567_3726232_-	lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase	NA	NA	NA	NA	NA
WP_002211822.1|3726228_3727134_-	4-deoxy-4-formamido-L-arabinose- phosphoundecaprenol deformylase	NA	NA	NA	NA	NA
WP_002211823.1|3727130_3729134_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	24.6	1.7e-17
WP_002211824.1|3729130_3730114_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.2	6.9e-36
WP_002211825.1|3730100_3731255_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.8	8.3e-33
WP_002213775.1|3731783_3732242_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_012229772.1|3732329_3733073_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A1M7XV31	Cedratvirus	28.5	9.2e-09
WP_002211827.1|3733097_3733652_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_002220283.1|3733721_3734729_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_002211829.1|3734955_3735414_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002213759.1|3735813_3736272_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211830.1|3736460_3736757_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_002211831.1|3736761_3739149_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002211832.1|3739162_3740146_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_152328947.1|3740502_3740550_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002211833.1|3740644_3741001_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002211834.1|3741038_3741236_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002227898.1|3741332_3741884_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_002211836.1|3741887_3743816_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.1e-127
WP_002216696.1|3744206_3744419_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_002211839.1|3745177_3745429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211840.1|3745747_3746431_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_002216686.1|3746552_3747215_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_002211842.1|3747426_3748395_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_002211843.1|3748391_3749282_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
WP_002211844.1|3749281_3750166_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_002211845.1|3750162_3751056_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_002216683.1|3751123_3751336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211846.1|3751360_3752236_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002211847.1|3752364_3752919_-	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_002209743.1|3754231_3755440_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|3755487_3755838_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|3756172_3757009_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|3757100_3757862_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_012229773.1|3758190_3759858_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_012229774.1|3759898_3760789_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|3760781_3761702_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|3761715_3762843_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_012229775.1|3762858_3764151_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|3764448_3765159_+	porin	NA	NA	NA	NA	NA
WP_002210837.1|3765638_3766187_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_012229776.1|3766390_3767782_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|3767996_3768848_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_012229777.1|3769214_3770006_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|3770192_3771359_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|3771666_3773034_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|3773087_3773891_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|3773887_3775051_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002215118.1|3777674_3778454_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|3778606_3779149_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002213759.1|3779803_3780262_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210847.1|3780517_3781399_-|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 14
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	4074079	4158659	4501786	transposase,plate	Yellowstone_lake_phycodnavirus(22.22%)	57	NA	NA
WP_002213775.1|4074079_4074538_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002424260.1|4074736_4075261_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002228103.1|4075233_4076961_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002216437.1|4077420_4079226_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|4079752_4080709_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|4081386_4081602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|4082030_4082489_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210453.1|4082635_4084198_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|4084200_4085292_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|4085293_4086724_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|4086738_4087341_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002224086.1|4087581_4088763_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210461.1|4089426_4091088_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|4092027_4093020_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|4092995_4094603_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|4094589_4095300_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|4095368_4096136_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|4096331_4098701_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|4099125_4102032_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002213759.1|4102413_4102872_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210468.1|4102998_4103352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012229833.1|4106876_4108484_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210471.1|4109945_4110437_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|4110429_4110795_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|4110800_4111418_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|4111410_4112514_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002224087.1|4112539_4114759_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_001297096.1|4117793_4118573_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213039.1|4119367_4121785_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213038.1|4121938_4122685_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213036.1|4123415_4123634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002231245.1|4123998_4124421_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_012229841.1|4124410_4125694_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|4125695_4126433_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041854810.1|4126458_4127688_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213026.1|4127680_4128400_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_012229846.1|4128401_4129154_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213024.1|4129156_4129945_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002228570.1|4130031_4130472_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213017.1|4130509_4130758_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002213016.1|4130856_4131705_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_012229852.1|4132693_4133194_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_079993216.1|4133236_4134232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041854755.1|4134231_4135968_+	OmpA family protein	NA	NA	NA	NA	NA
WP_012228903.1|4135971_4136463_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211927.1|4136850_4139493_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	1.6e-92
WP_012229857.1|4139495_4141844_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_002214564.1|4144141_4144612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211935.1|4146776_4148009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012229859.1|4148005_4151428_+	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211937.1|4151470_4153072_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002211938.1|4153089_4154148_+	PAAR domain protein	NA	NA	NA	NA	NA
WP_002211939.1|4154162_4154618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012229860.1|4154838_4156602_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211941.1|4156565_4157651_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002214552.1|4157625_4158207_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211943.1|4158206_4158659_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 15
NZ_CP009935	Yersinia pestis Angola chromosome, complete genome	4501786	4170402	4223310	4501786	transposase,protease,lysis	Bacillus_phage(20.0%)	42	NA	NA
WP_002209743.1|4170402_4171611_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002227980.1|4173711_4173924_-	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002211956.1|4174180_4175023_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002224699.1|4175043_4176183_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	6.1e-36
WP_002211958.1|4176456_4177326_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211960.1|4178566_4179229_+	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_012229866.1|4179283_4180450_+	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211963.1|4181197_4182190_+	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211964.1|4182419_4183940_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
WP_012229868.1|4183960_4184971_+	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_002213759.1|4185192_4185651_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211966.1|4186091_4186829_-	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002211969.1|4189149_4190034_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211970.1|4190359_4191055_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211971.1|4191051_4191459_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211973.1|4191700_4192882_-	MFS transporter	NA	NA	NA	NA	NA
WP_002211974.1|4193195_4194449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|4194466_4195543_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002228565.1|4196240_4196903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|4197120_4197579_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208618.1|4198092_4198236_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002208619.1|4199109_4199463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002218472.1|4199621_4199990_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002208622.1|4200038_4200242_+	expression modulating protein YmoA	NA	NA	NA	NA	NA
WP_002208623.1|4201129_4201519_+	MGMT family protein	NA	NA	NA	NA	NA
WP_002208625.1|4202373_4203234_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_002228344.1|4203493_4204783_-	ammonium transporter AmtB	NA	NA	NA	NA	NA
WP_002208627.1|4204822_4205161_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_002208628.1|4205562_4207386_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	2.5e-39
WP_002208629.1|4207378_4209145_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	7.0e-47
WP_002208630.1|4209246_4209708_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208631.1|4209833_4210874_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_002208632.1|4211085_4211907_-	HMP-PP phosphatase	NA	NA	NA	NA	NA
WP_002208633.1|4212011_4213715_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208635.1|4213971_4214670_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	70.5	2.1e-87
WP_012229871.1|4214755_4215163_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002208637.1|4215516_4215963_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_002208638.1|4216102_4217989_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002213759.1|4218286_4218745_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208639.1|4218999_4219272_-	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	59.6	3.5e-22
WP_012229872.1|4219489_4221844_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.9	5.9e-227
WP_002208641.1|4222038_4223310_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.2	7.3e-131
>prophage 1
NZ_CP009934	Yersinia pestis Angola plasmid pMT, complete sequence	95352	0	95031	95352	tail,transposase,integrase,terminase	Salmonella_phage(76.71%)	89	21663:21722	75380:76091
WP_000952684.1|181_406_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_012228764.1|413_4979_+	tape measure protein	NA	J9Q712	Salmonella_phage	89.9	0.0e+00
WP_000440566.1|5020_5356_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_011901831.1|5445_6144_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	6.4e-137
WP_002211774.1|6136_6934_+|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211773.1|6921_7509_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002214118.1|7530_12162_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211771.1|12218_12797_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_012228802.1|12877_15766_+|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211769.1|16067_16676_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_071882744.1|16809_17415_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.5	5.1e-98
WP_042593479.1|17356_18283_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	2.4e-179
WP_002213132.1|18946_19975_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|20094_20526_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|20746_20998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228774.1|21070_21634_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
21663:21722	attL	TTGTGCCCAGAAAACCCCCAGCTAGGCTGGGGGTTCAGTAAAGCTTTCAGCTTTGGGTCA	NA	NA	NA	NA
WP_002213759.1|21807_22266_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002425587.1|22374_22800_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_012228814.1|22814_26339_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.0	0.0e+00
WP_002211767.1|26519_27755_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|27851_30218_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002228800.1|30327_30540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228802.1|30802_31189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041854749.1|31183_32287_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002209743.1|32759_33968_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211760.1|34436_35459_+|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002211758.1|37522_39286_-	phospholipase D	NA	NA	NA	NA	NA
WP_002211757.1|39363_39852_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211756.1|40590_40866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012228784.1|40888_41830_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.4	2.9e-68
WP_002211754.1|41895_42516_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215068.1|42715_43042_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211753.1|43041_43269_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002211752.1|43570_44776_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002215070.1|44772_45744_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002228775.1|46122_47520_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002211750.1|47681_47882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012228803.1|48382_49060_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211748.1|49059_49281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|49291_49711_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211747.1|49764_50544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211746.1|50942_51449_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211745.1|52161_52392_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_012228783.1|52464_54474_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.1	1.3e-25
WP_000255944.1|54597_55620_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|55619_56399_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000920226.1|56897_57164_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_161597819.1|57211_58243_+	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_002213303.1|60697_61444_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_038918515.1|61433_61793_-	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213300.1|63579_64665_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002214160.1|66463_67108_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
WP_012228763.1|67862_68927_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.3	5.4e-188
WP_002222711.1|69495_69708_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|69707_70043_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|70039_70219_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|70259_70535_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|70602_71013_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|70996_71368_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|71521_72352_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002231164.1|73189_74332_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_011901832.1|74530_75286_+	hypothetical protein	NA	J9Q742	Salmonella_phage	98.4	3.8e-135
WP_002213759.1|75524_75983_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002211802.1|76182_76464_+	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
75380:76091	attR	TTGTGCCCAGAAAACCCCCAGCTAGGCTGGGGGTTCAGTAAAGCTTTCAGCTTTGGGTCAGTTATAAAAACCCCTTTTGATTTGTTAAAACAGTTTGCGGTCTGGCAACAGCAAATGTTCAACAAGAAATCAAAAGGGGGTCCCAATGAGGGATGAAAAGAGCTTAGCGCACACCCGATGGAACTGTAAATATCATATAGTTTTTGCGCCGAAGTACCGAAGGCAGGTGTTCTACAGGGAAAAACGCAGAGCGATTGGCAGTATTTTAAGAAAACTGTGCGAATGGAAAAACGTGAATATCCTGGAAGCAGAATACTGTGTGGATCACATCCATATGCTTCTGGAGATCCCGCCCAAGATGAGTGTCTCGGGATTTATGGGGTACCTGAAGGGAAAGAGCAGTCTGATGCTTTATGAGCAGTTTGGCGATTTGAAGTTCAAATACCGTAACAGGGAGTTTTGGTGTCGAGGGTATTACGTTGATACGGTAGGGAAAAACACGGCCAGGATACAAGAATACATAAAGCACCAATTGGAAGAGGATAAAATGGGTGAGCAACTCTCGATCCCGTATCCCGGTAGCCCGTTTACGGGCCGTAAGTAATCCATAGATGCAAATGTCAGATCGCGATGCGCCTGTTAGGGCGCGGCTGGTAACAGAGCCTTATAGGCGCATATGAAAAACCTCCGGCTATGCCGGAGGATATTTATT	NA	NA	NA	NA
WP_002211801.1|76669_77152_+	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002214137.1|77790_78018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211799.1|78102_78753_-	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214134.1|79075_79603_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211796.1|79607_80030_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214131.1|80089_80368_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_012228815.1|80370_81930_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	98.8	1.4e-293
WP_002418921.1|82039_82693_+	ParB/RepB/Spo0J family partition protein	NA	J9Q756	Salmonella_phage	98.6	6.9e-117
WP_002211792.1|82692_83361_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002211791.1|83357_83996_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211790.1|83988_84243_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211789.1|84248_85139_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_000176291.1|85148_85415_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211788.1|85610_86252_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_002211787.1|86254_87511_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_012228810.1|87544_89119_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	9.2e-301
WP_002231160.1|89141_90038_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_012228823.1|90064_90871_+	hypothetical protein	NA	J9Q710	Salmonella_phage	91.4	5.6e-145
WP_002211783.1|90945_91608_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211782.1|91651_92086_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211781.1|92085_92919_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_001027662.1|93016_93361_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211780.1|93351_93825_+	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_002211779.1|93826_94210_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211778.1|94284_95031_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
