The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	401673	499160	4654228	plate,transposase	Escherichia_phage(16.67%)	60	NA	NA
WP_002213759.1|401673_402132_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211550.1|402720_404172_+	Trk system potassium transporter TrkH	NA	NA	NA	NA	NA
WP_002215920.1|404193_404727_+	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_002212288.1|410863_411901_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002212289.1|411897_412857_+	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_002212290.1|412891_413842_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.2	8.7e-28
WP_002355327.1|414052_414511_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255944.1|414693_415716_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002210669.1|417552_418737_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_002210670.1|418987_419371_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210671.1|419372_419918_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210672.1|420108_420537_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210673.1|420540_421245_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210674.1|421609_422107_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210675.1|422173_422542_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210676.1|422884_426913_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210677.1|427041_431262_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_002210678.1|432280_433411_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002217273.1|433403_434219_-	thiazole synthase	NA	NA	NA	NA	NA
WP_002217275.1|434220_434436_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002210680.1|434432_435230_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002210681.1|435219_435894_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210682.1|435880_437926_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210683.1|438301_438811_-	sigma D regulator	NA	NA	NA	NA	NA
WP_002210684.1|438907_439690_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210685.1|439782_440568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210686.1|440686_441754_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210687.1|441783_442524_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210688.1|442569_443160_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002210689.1|443348_443624_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002355296.1|443673_444327_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210691.1|444474_445761_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002210692.1|445820_447410_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002212076.1|454253_455183_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002212077.1|455603_457202_+	malate synthase A	NA	NA	NA	NA	NA
WP_002212078.1|457248_458556_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_002212079.1|458811_460539_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_002212080.1|461717_465413_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	4.6e-24
WP_002212081.1|465508_470416_-	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_002228189.1|470485_472171_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_002212084.1|472738_474124_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_002212085.1|474493_476140_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002212086.1|476274_476682_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_002212087.1|476824_477715_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_002212088.1|477728_479306_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_002212089.1|479492_480704_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_002221973.1|481265_481502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212091.1|481505_482615_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	5.0e-27
WP_002212092.1|482685_483957_+	maltoporin	NA	NA	NA	NA	NA
WP_002212093.1|484197_485109_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_002212095.1|485579_485858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212097.1|486009_486528_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002212098.1|487051_487549_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002212099.1|487616_489098_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002212100.1|489104_489545_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000255944.1|491899_492922_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213885.1|494735_495824_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002212103.1|495949_497266_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_002212104.1|497265_497811_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002212105.1|497813_499160_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 2
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	590037	654423	4654228	holin,protease,transposase	uncultured_Mediterranean_phage(18.18%)	56	NA	NA
WP_002210082.1|590037_591483_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002210083.1|591685_594544_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210084.1|594568_597400_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210086.1|597600_597960_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_002210087.1|597956_598358_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
WP_002214300.1|598370_598673_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002210089.1|598806_603297_-	toxin	NA	NA	NA	NA	NA
WP_002229661.1|603353_605495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002229660.1|605563_606946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210090.1|606986_609488_-	toxin	NA	NA	NA	NA	NA
WP_002214297.1|609723_610590_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210092.1|610850_611762_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002210093.1|612064_612268_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002210094.1|612275_613211_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210095.1|613212_615168_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002214288.1|617097_617571_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210098.1|617575_617857_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002210099.1|617968_618517_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210100.1|618697_620038_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011055205.1|620286_620931_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210102.1|621138_621525_+	cytochrome b562	NA	NA	NA	NA	NA
WP_002210103.1|621748_622159_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210104.1|622511_624179_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002215779.1|624273_625689_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210106.1|626099_627053_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002210107.1|627286_627763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210109.1|630020_630407_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|630544_631009_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|631020_631956_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|632293_632566_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|632562_633417_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|633722_634205_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|634633_636067_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002210116.1|636128_636854_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|636860_637406_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|637389_637953_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|637949_638513_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|638761_639748_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002210120.1|639858_640833_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|641097_641916_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|642133_642916_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|642920_643478_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|643490_644114_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|644149_644452_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|644598_644853_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|645006_646269_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|646449_647538_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002213775.1|647763_648222_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002218066.1|648338_649712_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002210130.1|649982_650387_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002210131.1|650610_651738_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210132.1|652051_652480_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210133.1|652494_652887_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002230558.1|652883_653081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210135.1|653260_653902_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002216203.1|653907_654423_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 3
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	913699	968232	4654228	tRNA,transposase	Escherichia_phage(50.0%)	47	NA	NA
WP_002213775.1|913699_914158_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002216011.1|914408_915413_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002209424.1|915573_916383_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002209426.1|917085_917781_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_002209427.1|918243_920694_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.2e-219
WP_002209428.1|920705_921323_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	1.8e-74
WP_002209429.1|921324_922185_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	33.7	7.6e-23
WP_002209430.1|922330_923041_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.5	4.8e-23
WP_002215100.1|923297_923828_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	42.1	1.6e-15
WP_002215101.1|923975_924359_-	cytochrome b562	NA	NA	NA	NA	NA
WP_002209433.1|924435_926649_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_002209434.1|927184_928126_+	D-ribose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209435.1|928218_928836_+	DUF2291 family protein	NA	NA	NA	NA	NA
WP_002209436.1|928835_930359_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	9.1e-19
WP_002209437.1|930355_931501_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209438.1|931756_932587_+	transketolase	NA	NA	NA	NA	NA
WP_002209439.1|932579_933524_+	transketolase family protein	NA	NA	NA	NA	NA
WP_002209440.1|933526_935014_+	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_002209441.1|935034_936459_+	fucose isomerase	NA	NA	NA	NA	NA
WP_002209443.1|936680_937625_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002209444.1|937872_939213_-	MFS transporter	NA	NA	NA	NA	NA
WP_002209445.1|939529_940018_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.0	2.6e-28
WP_002209446.1|940132_941203_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.3	4.1e-111
WP_002209447.1|941340_941904_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002209448.1|942043_944671_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.3	1.8e-78
WP_002209449.1|944920_945106_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_002209450.1|946530_947097_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_002209451.1|947093_947522_+	DedA family protein	NA	NA	NA	NA	NA
WP_002209452.1|947565_949164_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_002209453.1|949331_949847_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_042665633.1|950050_950509_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002213759.1|950761_951220_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002354744.1|951357_952638_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002209455.1|952709_953501_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002209456.1|953666_955028_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002209458.1|955255_955504_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002209459.1|955525_956074_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002222284.1|956112_956853_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002209461.1|956933_957281_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002213759.1|957493_957952_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209462.1|958254_959022_-	YdiY family protein	NA	NA	NA	NA	NA
WP_002209463.1|961117_961834_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002228238.1|962066_963137_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	1.5e-89
WP_002209465.1|963149_964271_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002209466.1|964375_964594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|965448_966471_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213775.1|967773_968232_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	1274111	1327720	4654228	tRNA,plate,transposase	Agrobacterium_phage(15.38%)	45	NA	NA
WP_002217034.1|1274111_1274885_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_002213305.1|1275003_1275807_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_002213775.1|1276010_1276469_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002217028.1|1276615_1277638_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_002213310.1|1277628_1278303_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_002213314.1|1278444_1279806_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_002213316.1|1279802_1280960_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_002227864.1|1281311_1281860_-	attachment invasion locus protein Ail	NA	A0A1B0VBR9	Salmonella_phage	36.7	6.8e-25
WP_002223388.1|1281969_1282152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211552.1|1282303_1283557_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.5	2.8e-98
WP_002211553.1|1284097_1285288_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002211554.1|1286820_1287159_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_002211555.1|1287173_1288796_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.5	1.1e-94
WP_002211556.1|1288955_1290293_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.4	1.2e-11
WP_072120864.1|1290255_1291278_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_002216114.1|1291326_1292763_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.8	3.1e-13
WP_002216113.1|1293433_1293658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211559.1|1294670_1295231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211560.1|1295682_1296132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032487261.1|1296439_1296547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211561.1|1296543_1300434_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.5	8.8e-127
WP_002211562.1|1300749_1302210_+	membrane-bound lytic murein transglycosylase MltF	NA	I1VXB7	Halocynthia_phage	41.4	7.1e-13
WP_002211563.1|1302318_1302921_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	34.1	6.5e-05
WP_002211564.1|1302991_1303687_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_002211565.1|1303913_1304801_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_002211566.1|1305008_1305848_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211567.1|1306009_1306270_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	9.3e-17
WP_002213775.1|1306425_1306884_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002211568.1|1307085_1307466_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002211569.1|1307465_1308197_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_042665652.1|1308386_1309169_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.1	3.6e-136
WP_000255944.1|1309168_1310191_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211571.1|1310869_1312219_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002211572.1|1312222_1312762_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211573.1|1313035_1313521_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211574.1|1313846_1315349_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211575.1|1315372_1315897_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211576.1|1316001_1316610_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211577.1|1316594_1317785_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|1317809_1319018_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002215157.1|1319039_1320590_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211579.1|1320717_1321479_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002211580.1|1321635_1322181_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002215317.1|1322381_1325057_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211582.1|1325839_1327720_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	2177350	2277009	4654228	lysis,integrase,tRNA,tail,transposase	Escherichia_phage(13.46%)	103	2224703:2224733	2266428:2266458
WP_000255944.1|2177350_2178373_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2178372_2179152_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210659.1|2179520_2180111_-	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_002210661.1|2180860_2181259_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210664.1|2181693_2183040_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210665.1|2183346_2184363_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210666.1|2185696_2186161_+	YchJ family protein	NA	NA	NA	NA	NA
WP_002210667.1|2186244_2187114_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	5.5e-13
WP_002211665.1|2189157_2190018_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211667.1|2190827_2191634_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211668.1|2191731_2192118_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|2192130_2192421_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211670.1|2192417_2194343_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211671.1|2194404_2195451_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211673.1|2195675_2196227_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211674.1|2196389_2198240_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211675.1|2198356_2199373_+	asparaginase	NA	NA	NA	NA	NA
WP_002211676.1|2199387_2200035_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002217933.1|2200168_2200441_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002211677.1|2200511_2200925_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002224141.1|2201272_2202268_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211679.1|2202581_2203457_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002430110.1|2203529_2204279_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211681.1|2204722_2206657_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002216501.1|2206806_2208081_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211683.1|2208188_2209307_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211684.1|2209341_2210247_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211685.1|2210444_2211314_+	pirin family protein	NA	NA	NA	NA	NA
WP_002216508.1|2211578_2212781_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211686.1|2212796_2214101_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002211687.1|2214565_2216101_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211688.1|2216318_2217038_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211689.1|2217281_2218856_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002227934.1|2219091_2219622_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002214494.1|2220038_2220395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|2221486_2222227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211693.1|2222243_2223443_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002214492.1|2223446_2224619_+	MFS transporter	NA	NA	NA	NA	NA
2224703:2224733	attL	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002209743.1|2224923_2226132_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211695.1|2226352_2226772_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.0	5.7e-08
WP_002211696.1|2226782_2227700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211697.1|2227716_2228715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|2228714_2231918_-	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002359202.1|2232093_2232315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211699.1|2232283_2232448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|2232489_2233110_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211701.1|2233165_2233381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214482.1|2233523_2234075_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211704.1|2234173_2235181_-	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002211705.1|2235254_2235422_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211706.1|2235545_2235977_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211707.1|2236055_2236688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211708.1|2236948_2237659_-	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211709.1|2237661_2238414_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002213759.1|2238534_2238993_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211710.1|2239297_2239639_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002211711.1|2239641_2243145_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_071525538.1|2243145_2243406_-	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211712.1|2243453_2243765_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_002211713.1|2243777_2244698_-	Ig-like domain-containing protein	NA	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211714.1|2244763_2245171_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211715.1|2245167_2245752_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211716.1|2245753_2246104_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211717.1|2246105_2246360_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211718.1|2246356_2246839_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211719.1|2246886_2248092_-	Ig-like domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211720.1|2248105_2248879_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211721.1|2249000_2250113_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002228446.1|2250113_2250755_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002228445.1|2250773_2251502_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002211722.1|2251501_2252476_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002209743.1|2252480_2253689_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211723.1|2253736_2254321_-	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002211724.1|2254324_2254774_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211725.1|2254804_2255440_-	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211727.1|2255896_2256610_-	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211729.1|2257155_2257614_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211730.1|2257598_2258111_-	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002430108.1|2258141_2258339_-	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002215644.1|2258584_2258860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211731.1|2258856_2259066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002393183.1|2259228_2259405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|2259489_2260053_-	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002215638.1|2260101_2260320_-	ash family protein	NA	NA	NA	NA	NA
WP_002215636.1|2260323_2260713_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002211735.1|2260713_2261319_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002211736.1|2261392_2261839_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_071525537.1|2261814_2262564_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002215632.1|2262863_2263124_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_000255944.1|2264071_2265094_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211738.1|2265163_2266402_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_002211739.1|2266428_2266875_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
2266428:2266458	attR	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002211740.1|2266977_2267634_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002215627.1|2267704_2268790_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211743.1|2268930_2269203_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_002220631.1|2269923_2270610_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211179.1|2270634_2271447_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002211180.1|2271450_2271720_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211181.1|2271956_2273078_-	ribonuclease D	NA	NA	NA	NA	NA
WP_002211182.1|2273237_2274926_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	1.8e-31
WP_087768167.1|2275460_2275568_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002211183.1|2275568_2276174_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_002211184.1|2276310_2277009_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	2654101	2695401	4654228	protease,coat,transposase	uncultured_virus(16.67%)	33	NA	NA
WP_002209743.1|2654101_2655310_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|2655357_2655708_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|2656043_2656880_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|2656971_2657733_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210831.1|2658068_2659736_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210832.1|2659776_2660667_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|2660659_2661580_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|2661593_2662721_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|2662736_2664029_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|2664326_2665037_+	porin	NA	NA	NA	NA	NA
WP_002210837.1|2665516_2666065_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210838.1|2666268_2667660_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|2667874_2668726_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|2669110_2669902_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|2670088_2671255_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|2671581_2672949_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|2673002_2673806_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|2673802_2674966_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210844.1|2674962_2677575_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|2677656_2678436_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|2678588_2679131_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|2679788_2680670_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|2681143_2683216_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|2683235_2683949_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|2684044_2684542_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|2684773_2686021_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002216616.1|2685989_2688641_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|2689119_2689674_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|2689679_2690210_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|2690230_2690788_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210856.1|2690818_2691571_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210857.1|2691758_2694206_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210858.1|2694411_2695401_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 7
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	2762653	2816049	4654228	tRNA,transposase	Escherichia_phage(20.0%)	50	NA	NA
WP_002210913.1|2762653_2763769_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002210914.1|2763826_2764453_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_002210915.1|2764513_2765884_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	2.0e-110
WP_002210916.1|2766071_2766695_+	porin family protein	NA	NA	NA	NA	NA
WP_002210917.1|2766905_2767577_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_002210918.1|2767582_2769037_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_002210919.1|2769120_2770242_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210920.1|2770474_2771710_-	peptidase T	NA	NA	NA	NA	NA
WP_002210921.1|2772039_2772876_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	2.6e-20
WP_002216178.1|2772924_2773077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002216175.1|2773069_2773840_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_002210922.1|2773858_2775106_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002210923.1|2775105_2775810_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	43.3	1.4e-35
WP_002222341.1|2775802_2777005_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_002210924.1|2777274_2780721_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002210925.1|2780959_2781499_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_000255944.1|2781603_2782626_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2782625_2783405_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_042665714.1|2783788_2784997_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.3	2.1e-50
WP_002213101.1|2785092_2785506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215856.1|2785513_2786083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213097.1|2786620_2787925_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002213095.1|2788299_2788842_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002215854.1|2788969_2789989_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002213090.1|2790071_2790938_-	thiamine kinase	NA	NA	NA	NA	NA
WP_002213089.1|2790918_2791494_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_002213088.1|2791534_2791924_-	YcfL family protein	NA	NA	NA	NA	NA
WP_002213087.1|2791958_2792312_-	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_002215853.1|2792485_2793304_-	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002213775.1|2793746_2794205_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213085.1|2794394_2795828_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002213084.1|2796133_2796943_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002213083.1|2796957_2797980_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_002213082.1|2797979_2798618_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	4.6e-25
WP_002217396.1|2798607_2799633_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002213080.1|2799921_2800728_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_002213775.1|2801143_2801602_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213079.1|2801801_2803043_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_002220787.1|2803137_2803374_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	7.7e-10
WP_002210935.1|2803527_2804262_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	7.7e-16
WP_002210934.1|2804275_2805205_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002210933.1|2805242_2806193_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002210932.1|2806199_2807234_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002210931.1|2807267_2807435_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002210930.1|2807447_2807972_-	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_002210928.1|2808113_2808710_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002213759.1|2808864_2809323_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210927.1|2809542_2810505_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_002354074.1|2811088_2814745_+	ribonuclease E	NA	NA	NA	NA	NA
WP_002209743.1|2814840_2816049_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 8
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	2896287	2941051	4654228	plate,tRNA,lysis,transposase	Escherichia_phage(22.22%)	36	NA	NA
WP_002211870.1|2896287_2898315_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002213775.1|2898478_2898937_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_000255944.1|2899047_2900070_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2900069_2900849_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002228565.1|2901113_2901776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|2902473_2903550_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211973.1|2905152_2906334_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211971.1|2906575_2906983_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211970.1|2906979_2907675_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211969.1|2908000_2908885_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211968.1|2909240_2910938_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211966.1|2911218_2911956_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002211965.1|2912400_2913411_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_002211964.1|2913431_2914952_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
WP_002215885.1|2915181_2916189_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211961.1|2916936_2918103_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211960.1|2918157_2918820_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|2919003_2920155_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|2920290_2921160_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211957.1|2921433_2922573_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	5.2e-35
WP_002211956.1|2922593_2923436_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002227980.1|2923692_2923905_+	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002215886.1|2923988_2926349_+	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002211952.1|2926350_2927613_+	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211951.1|2927614_2928283_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_002211950.1|2928292_2929603_+	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211949.1|2930137_2931412_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211948.1|2931413_2932184_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002209743.1|2932319_2933528_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211947.1|2933571_2934225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|2934452_2936048_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211945.1|2936730_2937354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211944.1|2937565_2938933_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002211943.1|2938957_2939410_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002214552.1|2939409_2939991_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211941.1|2939965_2941051_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 9
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	2967642	3035009	4654228	protease,tRNA,plate,transposase	Streptococcus_phage(25.0%)	55	NA	NA
WP_002213011.1|2967642_2968995_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002214707.1|2969006_2970557_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213014.1|2970599_2971100_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002213016.1|2972088_2972937_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213017.1|2973035_2973284_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_002228570.1|2973321_2973762_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213024.1|2973848_2974637_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213025.1|2974639_2975392_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213026.1|2975393_2976113_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213028.1|2976105_2977344_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|2977359_2978097_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213032.1|2978098_2979382_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213034.1|2979371_2979896_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213036.1|2980159_2980378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213038.1|2981108_2981855_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213039.1|2982008_2984426_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213046.1|2988071_2988401_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213049.1|2988452_2988731_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002213052.1|2988824_2990015_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213054.1|2990075_2990393_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213056.1|2990501_2990918_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213058.1|2991233_2991914_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213060.1|2992092_2992557_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213061.1|2992617_2994603_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	28.4	5.3e-19
WP_002213062.1|2994796_2995243_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002213063.1|2995272_2997411_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213064.1|2997512_2998148_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213065.1|2998376_2998883_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213066.1|2999240_3000302_+	porin OmpA	NA	NA	NA	NA	NA
WP_002213775.1|3000491_3000950_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002226586.1|3001118_3001574_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002224683.1|3001784_3003536_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002220006.1|3003604_3004123_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002211286.1|3004388_3004577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|3008173_3008632_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228015.1|3008829_3008997_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_002211289.1|3009266_3009845_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002211290.1|3009841_3011494_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_002211291.1|3011480_3012767_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_002211292.1|3012895_3014809_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.5e-47
WP_002211293.1|3014814_3016935_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_002211294.1|3017034_3018147_+	YcbX family protein	NA	NA	NA	NA	NA
WP_002211295.1|3018172_3018724_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002211296.1|3018906_3019917_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002220013.1|3020534_3023150_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_002228013.1|3023865_3025071_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002211301.1|3025569_3026970_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_002354007.1|3027270_3028350_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	56.5	3.2e-111
WP_002213759.1|3028567_3029026_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211303.1|3029316_3030507_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002430096.1|3030660_3030777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211304.1|3030930_3031578_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	2.2e-22
WP_002211305.1|3031638_3032187_-	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_002217987.1|3032410_3034267_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002213759.1|3034550_3035009_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	3207557	3225922	4654228	coat,plate,tail,transposase	Vibrio_phage(25.0%)	19	NA	NA
WP_002213775.1|3207557_3208016_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208835.1|3208216_3209221_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002208836.1|3209398_3209626_+	YejL family protein	NA	NA	NA	NA	NA
WP_002208837.1|3209653_3211450_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002230704.1|3211680_3212064_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208839.1|3212420_3213569_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_002208840.1|3213581_3214070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208841.1|3214769_3215132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208842.1|3215257_3216694_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208843.1|3216984_3217725_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208845.1|3218022_3218802_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208846.1|3218898_3219246_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002215458.1|3219242_3219503_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208847.1|3219499_3220636_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002208848.1|3220639_3221095_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002215460.1|3221091_3221688_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208850.1|3221703_3222759_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208852.1|3222755_3224162_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208853.1|3224428_3225922_-|coat	coat protein	coat	NA	NA	NA	NA
>prophage 11
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	3244285	3318775	4654228	protease,tRNA,holin,transposase	Enterobacteria_phage(17.65%)	57	NA	NA
WP_002213759.1|3244285_3244744_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210826.1|3245655_3246771_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002210825.1|3247873_3249028_+	MFS transporter	NA	NA	NA	NA	NA
WP_002216093.1|3249051_3251004_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002216094.1|3251171_3251744_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_002210824.1|3251746_3252400_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002228028.1|3252467_3255341_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210821.1|3255528_3258204_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_002210820.1|3258465_3259194_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210818.1|3259687_3261976_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210817.1|3262138_3263269_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210816.1|3263272_3263530_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210815.1|3263564_3264074_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210814.1|3264131_3265325_-	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_002221775.1|3265943_3267152_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_002210812.1|3267408_3267951_-	membrane protein	NA	NA	NA	NA	NA
WP_002210811.1|3268311_3269751_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	4.9e-99
WP_002210810.1|3269818_3271999_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.1e-44
WP_002210809.1|3272268_3273384_+	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	2.1e-110
WP_002210807.1|3273795_3274686_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002210806.1|3274810_3275014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210805.1|3275131_3277438_-	arginine decarboxylase	NA	NA	NA	NA	NA
WP_002210804.1|3277507_3278842_-	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_002353933.1|3279331_3280030_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210802.1|3280164_3281103_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	6.4e-23
WP_002210801.1|3281099_3282254_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210799.1|3284182_3285037_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_002210798.1|3285191_3286607_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002210797.1|3286630_3287488_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_002223523.1|3287602_3288301_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.4e-12
WP_002210795.1|3288394_3289231_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	4.2e-10
WP_002210794.1|3289227_3290304_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_002210793.1|3290303_3291905_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_002210792.1|3292028_3293297_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210791.1|3293731_3294205_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
WP_002210790.1|3294450_3295332_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210789.1|3295334_3296195_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210788.1|3296297_3297227_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210787.1|3297263_3298100_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.1e-17
WP_002210786.1|3298307_3298556_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002210785.1|3298740_3299844_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_002214185.1|3300156_3300498_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_002210782.1|3300523_3301063_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_002210781.1|3301272_3302985_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002210780.1|3303105_3304041_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_002210778.1|3304379_3304559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228612.1|3304632_3305571_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210776.1|3305870_3306800_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002213775.1|3307214_3307673_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002214195.1|3308602_3309466_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|3309811_3310660_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|3310697_3311591_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|3311822_3313871_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|3314235_3314832_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002218281.1|3314889_3316362_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002220180.1|3316384_3318088_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002213775.1|3318316_3318775_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	3341499	3396642	4654228	integrase,protease,transposase	Escherichia_phage(33.33%)	56	3383400:3383459	3394466:3394550
WP_002210751.1|3341499_3342318_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002210750.1|3342677_3343694_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.8	3.0e-79
WP_002210749.1|3343703_3344756_+	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002210748.1|3344752_3345904_+	galactokinase	NA	NA	NA	NA	NA
WP_002216814.1|3345897_3346050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216812.1|3346070_3346967_+	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_002210747.1|3347259_3347595_+	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_002210746.1|3347941_3348694_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002210745.1|3348875_3349001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|3349059_3350082_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3350081_3350861_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210744.1|3350870_3351887_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.8	2.8e-72
WP_002210743.1|3352335_3353274_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	42.0	1.2e-10
WP_002210742.1|3353388_3354114_-	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	28.6	8.7e-20
WP_002210741.1|3354235_3355297_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_002210740.1|3356132_3356942_-	cell division protein CpoB	NA	NA	NA	NA	NA
WP_002210739.1|3356951_3357458_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_002210738.1|3357508_3358801_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_002210737.1|3358920_3360087_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_002210736.1|3360198_3360627_-	colicin uptake protein TolR	NA	NA	NA	NA	NA
WP_002210735.1|3360639_3361326_-	Tol-Pal system protein TolQ	NA	NA	NA	NA	NA
WP_002210734.1|3361325_3361727_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011191945.1|3361858_3362146_-	cyd operon protein YbgE	NA	NA	NA	NA	NA
WP_002210732.1|3362135_3362270_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_002210731.1|3362282_3363422_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_002210730.1|3363436_3365005_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_002210729.1|3365771_3366644_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	34.7	3.6e-20
WP_002210728.1|3366643_3367810_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_002210727.1|3367922_3369146_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_002210726.1|3369175_3371983_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_002210725.1|3372338_3373055_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_002210724.1|3373104_3374871_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_002210723.1|3374871_3375219_-	succinate dehydrogenase membrane anchor subunit	NA	NA	NA	NA	NA
WP_002210722.1|3375212_3375602_-	succinate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_002210721.1|3376311_3377592_+	citrate synthase	NA	NA	NA	NA	NA
WP_002210720.1|3377699_3378278_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002210719.1|3378401_3379283_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002210718.1|3379369_3381031_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002210717.1|3381144_3381486_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002210716.1|3381635_3381920_-	RnfH family protein	NA	NA	NA	NA	NA
WP_011055694.1|3381912_3382449_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002210714.1|3382507_3382990_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	3.4e-28
3383400:3383459	attL	CCAAATGTTAAACCGGTTATTACCAGATAAGTCCGGTGAAGTACGGAAAGCCCGCATCCC	NA	NA	NA	NA
WP_002213775.1|3383624_3384083_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210713.1|3384306_3385506_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.2	2.2e-108
WP_002210712.1|3385584_3386673_+	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_002215945.1|3386723_3388394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215946.1|3388555_3388783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210710.1|3389590_3390478_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_002210709.1|3390470_3390671_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|3390670_3391213_+	ash family protein	NA	NA	NA	NA	NA
WP_002215950.1|3391205_3392165_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002210707.1|3392161_3393250_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|3393598_3393913_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|3393918_3394236_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_000255944.1|3394840_3395863_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
3394466:3394550	attR	CCAAATGTTAAACCGGTTATTACCAGATAAGTCCGGTGAAGTACGGAAAGCCCGCATCCCTTCTAGGTTTGCGGGCTTTTTTGTG	NA	NA	NA	NA
WP_001297096.1|3395862_3396642_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 13
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	3538806	3614632	4654228	tRNA,plate,protease,transposase	Escherichia_phage(22.22%)	57	NA	NA
WP_002215902.1|3538806_3539457_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215900.1|3539907_3540303_+	lipoprotein	NA	NA	NA	NA	NA
WP_002211661.1|3541221_3541377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211662.1|3542578_3543079_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215896.1|3543121_3544666_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|3544677_3546030_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|3546026_3546713_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|3546712_3548449_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|3548452_3548944_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002210013.1|3549361_3552010_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_002210012.1|3552006_3554355_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_002210011.1|3554369_3556592_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_016590715.1|3556735_3557083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216110.1|3557246_3557441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210010.1|3558665_3559301_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210009.1|3559316_3561614_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|3561600_3562368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016632.1|3562463_3563160_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210005.1|3563768_3564404_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|3565732_3567895_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210001.1|3568450_3569410_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210000.1|3569455_3570955_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002209999.1|3570987_3571971_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209998.1|3572053_3574087_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209997.1|3574190_3575291_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209995.1|3575590_3576667_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002209994.1|3576849_3577122_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002228057.1|3577299_3578415_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209991.1|3578752_3579472_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002209990.1|3579471_3579798_+	YggL family protein	NA	NA	NA	NA	NA
WP_002209989.1|3579908_3580835_+	glutaminase B	NA	NA	NA	NA	NA
WP_002228656.1|3580946_3581477_+	DUF2884 family protein	NA	NA	NA	NA	NA
WP_011566213.1|3581434_3581680_+	DUF2884 family protein	NA	NA	NA	NA	NA
WP_002224905.1|3582178_3591511_+	phage minor structural protein	NA	NA	NA	NA	NA
WP_002209987.1|3591700_3592831_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002215614.1|3592823_3593417_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002215612.1|3593516_3593807_-	YggU family protein	NA	NA	NA	NA	NA
WP_002209984.1|3593803_3594358_-	YggT family protein	NA	NA	NA	NA	NA
WP_002209983.1|3594645_3595467_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002215609.1|3595599_3596298_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209981.1|3596317_3597442_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002209980.1|3597550_3598666_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209979.1|3598669_3599554_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209978.1|3599733_3600156_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209977.1|3600155_3600719_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209976.1|3600834_3601794_-	glutathione synthase	NA	NA	NA	NA	NA
WP_002209975.1|3601819_3602551_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209973.1|3602802_3603510_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002228059.1|3603607_3604120_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|3604312_3605467_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|3606673_3608653_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209968.1|3608812_3609133_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_071525520.1|3609166_3609277_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209967.1|3609422_3610175_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209965.1|3610665_3612660_+	transketolase	NA	NA	NA	NA	NA
WP_002213759.1|3612967_3613426_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_000255944.1|3613609_3614632_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 14
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	3768677	3786186	4654228	transposase	Tupanvirus(50.0%)	7	NA	NA
WP_002211384.1|3768677_3769472_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.9	8.9e-119
WP_099156340.1|3769812_3770109_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_000255944.1|3770190_3771213_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3771212_3771992_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211387.1|3772199_3778658_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	8.5e-42
WP_002214915.1|3778665_3780354_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	3.1e-36
WP_002211388.1|3780366_3786186_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	31.3	1.3e-41
>prophage 15
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	4000296	4056899	4654228	holin,transposase	Escherichia_phage(50.0%)	53	NA	NA
WP_002213775.1|4000296_4000755_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210407.1|4000872_4001403_-	YgjV family protein	NA	NA	NA	NA	NA
WP_002210408.1|4001555_4003046_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_002210409.1|4003056_4004508_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_002210410.1|4004706_4006116_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_002353699.1|4006863_4008165_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210412.1|4008427_4009222_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_002218957.1|4009470_4010004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210414.1|4010281_4010980_+	DedA family protein	NA	NA	NA	NA	NA
WP_002210415.1|4010976_4011366_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_002210416.1|4011591_4011972_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_002210418.1|4012126_4012432_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_002210419.1|4012434_4012830_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002210420.1|4012826_4013111_+	YqjK-like family protein	NA	NA	NA	NA	NA
WP_002210421.1|4013414_4013810_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000255944.1|4014088_4015111_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|4015110_4015890_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|4016151_4016538_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|4016832_4019547_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|4019624_4020158_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|4020186_4020711_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|4020877_4021798_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|4021897_4023049_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|4023121_4024378_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|4024404_4025232_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|4025233_4026154_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|4026146_4027622_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|4027759_4028830_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|4028826_4030029_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|4030028_4031345_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|4031347_4032430_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|4032423_4033800_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|4033796_4035284_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210440.1|4035270_4037034_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|4037099_4037417_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|4037413_4038376_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|4038378_4038837_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|4039391_4039481_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|4039938_4040379_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|4040509_4041520_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213775.1|4042024_4042483_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210448.1|4042681_4043176_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002228103.1|4043178_4044906_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002216437.1|4045365_4047171_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|4047707_4048664_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|4049341_4049557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|4049985_4050444_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210453.1|4050590_4052153_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|4052155_4053247_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|4053248_4054679_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|4054693_4055296_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002397472.1|4055536_4055788_-	sugar transporter	NA	NA	NA	NA	NA
WP_000255944.1|4055876_4056899_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 16
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	4077720	4124902	4654228	tRNA,plate,transposase	uncultured_Caudovirales_phage(20.0%)	39	NA	NA
WP_002210470.1|4077720_4079076_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|4079195_4079687_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|4079679_4080045_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|4080050_4080668_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|4080660_4081764_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|4084021_4086370_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|4086473_4089062_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|4089079_4090063_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|4090055_4091900_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210478.1|4091932_4092376_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002210479.1|4092449_4092968_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002210480.1|4093130_4094633_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002210481.1|4094641_4095202_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002210482.1|4095212_4096226_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002214747.1|4096555_4097299_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_002210485.1|4098521_4099142_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_002210486.1|4099439_4100273_-	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_002228111.1|4100457_4102800_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_002210488.1|4102867_4104172_+	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_002210489.1|4104155_4105151_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_002210490.1|4105143_4105962_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002210491.1|4105975_4106353_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_002210492.1|4106369_4107239_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	NA	NA	NA	NA
WP_002210493.1|4107328_4107793_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_071525509.1|4107919_4108234_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002213775.1|4108675_4109134_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210497.1|4109345_4109828_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.6	4.7e-30
WP_002210498.1|4109977_4110433_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002210499.1|4110429_4111230_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_002210501.1|4111553_4112168_+	LysE family translocator	NA	NA	NA	NA	NA
WP_002210502.1|4112395_4115629_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_002224759.1|4115644_4116820_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	6.9e-51
WP_002210504.1|4117292_4118114_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_002213775.1|4118566_4119025_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213759.1|4119279_4119738_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210506.1|4120116_4121070_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_002228112.1|4121050_4121509_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210508.1|4121576_4122086_-	signal peptidase II	NA	NA	NA	NA	NA
WP_002210509.1|4122085_4124902_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.1	1.0e-63
>prophage 17
NZ_CP009844	Yersinia pestis strain Dodson chromosome 1, complete sequence	4654228	4496655	4541254	4654228	protease,transposase	Escherichia_phage(33.33%)	36	NA	NA
WP_002216348.1|4496655_4497492_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_002208930.1|4497526_4498285_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100067904.1|4498477_4499831_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002208933.1|4500001_4500886_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_002208934.1|4501118_4503554_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_002208935.1|4505093_4505411_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_002208936.1|4505759_4506215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216737.1|4506757_4506973_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002208938.1|4507215_4509414_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_002216730.1|4509766_4510795_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_002208941.1|4510860_4511706_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002208942.1|4511805_4512330_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002208943.1|4512400_4513732_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
WP_002208944.1|4513967_4514885_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002208945.1|4515026_4515512_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_002228141.1|4515628_4516213_-	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_002215873.1|4516842_4517082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208949.1|4517294_4518587_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000255944.1|4519498_4520521_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|4520520_4521300_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213759.1|4523031_4523490_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208953.1|4523693_4523933_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_002208954.1|4524560_4525409_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.5	3.2e-13
WP_002208956.1|4527570_4528317_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_002208957.1|4528657_4529092_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_002208958.1|4529260_4529875_+	DUF1454 family protein	NA	NA	NA	NA	NA
WP_002208959.1|4530003_4530771_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_002208960.1|4531002_4532238_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208961.1|4532374_4533112_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_002208962.1|4533108_4533822_+	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_002208963.1|4533887_4535315_+	anion permease	NA	NA	NA	NA	NA
WP_002218867.1|4535432_4536209_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208965.1|4536458_4537448_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208966.1|4537668_4538652_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002208967.1|4538869_4539772_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_002353252.1|4540333_4541254_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	8.6e-73
>prophage 1
NZ_CP009842	Yersinia pestis strain Dodson plasmid pCD, complete sequence	70305	29822	56252	70305	transposase,protease	Yersinia_phage(28.57%)	23	NA	NA
WP_116442925.1|29822_30068_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002222515.1|30816_31236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213004.1|31940_32339_-	type III secretion system chaperone SycT	NA	NA	NA	NA	NA
WP_002213006.1|32338_33307_-|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_002213007.1|33806_34355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229770.1|34952_35582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220902.1|37593_38760_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002213354.1|38756_39722_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
WP_154020274.1|39881_40118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213357.1|40266_40440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224342.1|40983_41226_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213360.1|41218_41518_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002229754.1|41657_42317_-	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213403.1|42510_42903_+	type III secretion system chaperone SycE/YerA	NA	NA	NA	NA	NA
WP_001297096.1|44027_44807_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|44806_45829_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213267.1|47617_48043_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_086016640.1|48190_49290_-|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002229829.1|49389_49719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224338.1|49857_50322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|50340_50892_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002213256.1|51055_53371_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
WP_042469136.1|55982_56252_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP009843	Yersinia pestis strain Dodson plasmid pMT, complete sequence	53435	0	13112	53435	transposase	Salmonella_phage(33.33%)	15	NA	NA
WP_002214148.1|278_2195_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
WP_002213303.1|2184_2931_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_002214145.1|2943_3513_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213759.1|3721_4180_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002215082.1|4289_4709_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211748.1|4719_4941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|4940_5618_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211750.1|6118_6319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228775.1|6480_7878_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002215070.1|8256_9228_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002211752.1|9224_10430_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002211753.1|10731_10959_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002215068.1|10958_11285_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211754.1|11484_12105_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215065.1|12170_13112_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
>prophage 2
NZ_CP009843	Yersinia pestis strain Dodson plasmid pMT, complete sequence	53435	20045	21254	53435	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_002209743.1|20045_21254_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 3
NZ_CP009843	Yersinia pestis strain Dodson plasmid pMT, complete sequence	53435	27490	33258	53435	integrase	Salmonella_phage(66.67%)	5	25951:25965	38800:38814
25951:25965	attL	CATCCAGCTCTGGCA	NA	NA	NA	NA
WP_002353208.1|27490_28594_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002228802.1|28588_28975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228800.1|29237_29450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211766.1|29559_31926_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002211767.1|32022_33258_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
38800:38814	attR	TGCCAGAGCTGGATG	NA	NA	NA	NA
>prophage 4
NZ_CP009843	Yersinia pestis strain Dodson plasmid pMT, complete sequence	53435	38935	50601	53435		Salmonella_phage(100.0%)	17	NA	NA
WP_002425587.1|38935_39361_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002213141.1|39390_39954_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002215095.1|40026_40278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213135.1|40498_40930_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002213132.1|41049_42078_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002225551.1|42138_43083_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_000920226.1|43082_43349_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002213439.1|44518_44719_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_002222866.1|44722_45553_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002222868.1|45706_46078_+	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222869.1|46061_46472_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002228797.1|46539_46815_+	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002228796.1|46855_47035_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002227818.1|47031_47367_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002222711.1|47366_47579_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002214164.1|48147_49212_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002214160.1|49956_50601_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
