The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	118190	170273	4569625	transposase,tRNA,integrase,tail,lysis	Cronobacter_phage(14.29%)	63	128741:128771	170464:170494
WP_002211184.1|118190_118889_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_087768167.1|119630_119738_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002211182.1|120272_121961_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	1.8e-31
WP_002211181.1|122120_123242_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|123478_123748_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211179.1|123751_124564_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002220631.1|124588_125275_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211743.1|125995_126268_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_002215627.1|126408_127494_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211740.1|127564_128221_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211739.1|128323_128770_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
128741:128771	attL	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211738.1|128796_130035_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_001297096.1|131125_131905_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215632.1|132072_132333_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_071525537.1|132632_133382_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002211736.1|133357_133804_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_002211735.1|133877_134483_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002215636.1|134483_134873_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002215638.1|134876_135095_+	ash family protein	NA	NA	NA	NA	NA
WP_002211732.1|135143_135707_+	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002211731.1|136130_136340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215644.1|136336_136612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002430108.1|136857_137055_+	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002211730.1|137085_137598_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002211729.1|137582_138041_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211727.1|138586_139300_+	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211725.1|139756_140392_+	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211724.1|140422_140872_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211723.1|140875_141460_+	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002209743.1|141507_142716_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211722.1|142720_143695_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002228445.1|143694_144423_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002228446.1|144441_145083_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002211721.1|145083_146196_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002211720.1|146317_147091_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211719.1|147104_148310_+	Ig-like domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211718.1|148357_148840_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211717.1|148836_149091_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211716.1|149092_149443_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211715.1|149444_150029_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|150025_150433_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|150498_151419_+	Ig-like domain-containing protein	NA	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|151431_151743_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071525538.1|151790_152051_+	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211711.1|152051_155555_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_002211710.1|155557_155899_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002213759.1|156203_156662_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211709.1|156782_157535_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002211708.1|157537_158248_+	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211707.1|158508_159141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211706.1|159219_159651_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211705.1|159774_159942_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211704.1|160015_161023_+	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002214482.1|161121_161673_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211701.1|161815_162031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|162086_162707_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211699.1|162748_162913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002359202.1|162881_163103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|163278_166482_+	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211697.1|166481_167480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211696.1|167496_168414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211695.1|168424_168844_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.0	5.7e-08
WP_002209743.1|169064_170273_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
170464:170494	attR	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
>prophage 2
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	874896	930147	4569625	tRNA,transposase,integrase	uncultured_virus(20.0%)	57	874789:874848	929581:930292
874789:874848	attL	AATAAATATCCTCCGGCATAGCCGGAGGTTTTTCATATGCGCCTATAAGGCTCTGTTACC	NA	NA	NA	NA
WP_002213775.1|874896_875355_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002209726.1|875633_876644_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002209727.1|876643_877525_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002209728.1|877681_878344_+	DedA family protein	NA	NA	NA	NA	NA
WP_002209729.1|878574_879489_+	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_002209730.1|879737_881042_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002209731.1|881161_881884_+	cell division protein DedD	NA	NA	NA	NA	NA
WP_002209732.1|882195_882705_+	colicin V production protein	NA	NA	NA	NA	NA
WP_002209733.1|882717_884235_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	5.0e-86
WP_002209734.1|884481_885054_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_002216029.1|885578_886361_+	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_002209736.1|886463_887150_+	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
WP_002209737.1|887146_887863_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209738.1|887876_888674_+	histidine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	33.5	7.1e-23
WP_002209739.1|888797_889706_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_002209740.1|890059_890752_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002227850.1|890952_891528_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_002209742.1|891749_892298_+	NUDIX hydrolase YfcD	NA	NA	NA	NA	NA
WP_002222248.1|892414_893671_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_002209743.1|893810_895019_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_071525544.1|895082_896585_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_002209745.1|896797_897043_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	64.2	7.2e-19
WP_002216002.1|897715_898297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209746.1|898564_898966_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002209748.1|899198_899600_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002209749.1|899611_900184_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002227852.1|900207_900459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209751.1|900497_900737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209752.1|901545_903462_+	autotransporter adhesin YapC	NA	NA	NA	NA	NA
WP_002224869.1|903585_903708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209753.1|903996_904578_+	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|904979_906188_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209756.1|906639_908847_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_002209757.1|908839_909370_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_002209758.1|909528_911910_+	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002209759.1|911988_913617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209762.1|914089_914941_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	1.2e-49
WP_002209763.1|914966_915956_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002209764.1|916010_916904_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000255944.1|916997_918020_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|918019_918799_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215253.1|919165_919471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209765.1|919567_919969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209766.1|919950_921270_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_002209767.1|921262_923026_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002209768.1|923022_923655_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002209769.1|923664_924594_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002209770.1|924586_925189_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002354559.1|925588_925795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079866998.1|926006_926285_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.5	4.2e-31
WP_002215266.1|926367_926706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228356.1|926841_927339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215268.1|927452_927653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215270.1|927911_928094_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_002209774.1|928448_929315_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
WP_002209775.1|929329_929542_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002213775.1|929688_930147_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
929581:930292	attR	AATAAATATCCTCCGGCATAGCCGGAGGTTTTTCATATGCGCCTATAAGGCTCTGTTACCAGCCGCGCCCTAACAGGCGCATCGCGATCTGACATTTGCATCTATGGATTACTTACGGCCCGTAAACGGGCTACCGGGATACGGGATCGAGAGTTGCTCACCCATTTTATCCTCTTCCAATTGGTGCTTTATGTATTCTTGTATCCTGGCCGTGTTTTTCCCTACCGTATCAACGTAATACCCTCGACACCAAAACTCCCTGTTACGGTATTTGAACTTCAAATCGCCAAACTGCTCATAAAGCATCAGACTGCTCTTTCCCTTCAGGTACCCCATAAATCCCGAGACACTCATCTTGGGCGGGATCTCCAGAAGCATATGGATGTGATCCACACAGCATTCTGCTTCCAGGATATTCACGTTTTTCCATTCGCACAGTTTTCTTAAAATACTGCCAATCGCTCTGCGTTTTTCCCTGTAGAACACCTGCCTTCGGTACTTCGGCGCAAAAACTATATGATATTTACAGTTCCATCGGGTGTGCGCTAAGCTCTTTTCATCCCTCATTGGGACCCCCTTTTGATTTCTTGTTGAACATTTGCAGTTGCCAGACCGCAAACTGTTTTAACAAATCAAAAGGGGTTTTTATAACTGACCCAAAGCTGAAAGCTTTACTGAACCCCCAGCCTAGCTGGGGGTTTTCTGGGCACAA	NA	NA	NA	NA
>prophage 3
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	988076	1056160	4569625	tRNA,transposase,plate	Bacillus_phage(12.5%)	57	NA	NA
WP_042669057.1|988076_988535_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209814.1|988753_989935_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_002209815.1|989946_990582_-	YfgM family protein	NA	NA	NA	NA	NA
WP_002209816.1|990595_991870_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002209817.1|992078_993206_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_002209818.1|993267_994305_-	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_002209819.1|994294_995044_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_002209820.1|995197_996394_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_002209821.1|996655_997084_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_002215515.1|997410_999831_-	peptidase inhibitor family I36 protein	NA	NA	NA	NA	NA
WP_146737630.1|1000520_1004909_+	autotransporter YapA	NA	NA	NA	NA	NA
WP_002215508.1|1005466_1008625_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_002215505.1|1008590_1008911_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_071525548.1|1008989_1009115_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209828.1|1009248_1010202_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_002209829.1|1010280_1011579_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	39.0	9.7e-38
WP_002209830.1|1011718_1011919_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002209831.1|1011948_1012284_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_002209832.1|1012286_1014239_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	37.8	1.8e-96
WP_002209833.1|1014481_1015006_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_002209834.1|1015116_1015440_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	7.8e-21
WP_002209835.1|1015709_1016096_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	5.4e-53
WP_002209836.1|1016126_1017356_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	33.1	8.6e-36
WP_002222202.1|1017409_1017904_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_002217034.1|1018059_1018833_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_002213305.1|1018951_1019755_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_002213775.1|1019958_1020417_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002217028.1|1020563_1021586_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_002213310.1|1021576_1022251_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_002213314.1|1022392_1023754_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_002213316.1|1023750_1024908_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_002227864.1|1025259_1025808_-	attachment invasion locus protein Ail	NA	A0A1B0VBR9	Salmonella_phage	36.7	6.8e-25
WP_002223388.1|1025917_1026100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211552.1|1026251_1027505_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.5	2.8e-98
WP_002211553.1|1028045_1029236_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002211554.1|1030768_1031107_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_002211555.1|1031121_1032744_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.5	1.1e-94
WP_002211556.1|1032903_1034241_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.4	1.2e-11
WP_072120864.1|1034203_1035226_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_002216114.1|1035274_1036711_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.8	3.1e-13
WP_002213759.1|1036931_1037390_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002216113.1|1037379_1037604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211559.1|1038616_1039177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211560.1|1039628_1040078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032487261.1|1040385_1040493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211561.1|1040489_1044380_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.5	8.8e-127
WP_002211562.1|1044695_1046156_+	membrane-bound lytic murein transglycosylase MltF	NA	I1VXB7	Halocynthia_phage	41.4	7.1e-13
WP_002211563.1|1046264_1046867_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	34.1	6.5e-05
WP_002211564.1|1046937_1047633_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_002211565.1|1047859_1048747_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_002211566.1|1048954_1049794_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211567.1|1049955_1050216_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	9.3e-17
WP_002213775.1|1050371_1050830_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002211568.1|1051031_1051412_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002211569.1|1051411_1052143_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_042669058.1|1053178_1054132_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-179
WP_002211571.1|1054810_1056160_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 4
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	1402484	1457589	4569625	tRNA,transposase	Escherichia_phage(50.0%)	44	NA	NA
WP_023278042.1|1402484_1403507_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|1403506_1404286_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002418742.1|1404336_1405236_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002208732.1|1405291_1406038_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	3.4e-35
WP_002208733.1|1406018_1406672_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002208734.1|1406668_1407337_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002208735.1|1407349_1408138_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002208736.1|1408465_1409299_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208738.1|1409608_1409812_+	oxalurate catabolism protein HpxX	NA	NA	NA	NA	NA
WP_002208739.1|1409808_1411206_+	AtzE family amidohydrolase	NA	NA	NA	NA	NA
WP_002264506.1|1411315_1411702_+	oxalurate catabolism protein HpxZ	NA	NA	NA	NA	NA
WP_002208741.1|1411929_1413129_+	MFS transporter	NA	NA	NA	NA	NA
WP_002208742.1|1413288_1414062_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002208743.1|1414058_1414400_+	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_002208744.1|1414571_1415084_+	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_002208745.1|1415467_1416640_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_002208746.1|1416678_1418214_+	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_002208747.1|1418336_1419503_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002216643.1|1419754_1420192_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	36.6	2.6e-11
WP_002208749.1|1420361_1421111_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_002208750.1|1421153_1423796_+	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002208751.1|1423971_1425327_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002208752.1|1425388_1425730_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002217405.1|1431832_1434406_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	2.4e-128
WP_002209471.1|1434535_1435267_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002209470.1|1435268_1436246_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_002209469.1|1436381_1437113_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002209468.1|1437467_1437830_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_002213775.1|1438160_1438619_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_000255944.1|1439921_1440944_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002209466.1|1441798_1442017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209465.1|1442121_1443243_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002228238.1|1443255_1444326_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	1.5e-89
WP_002209463.1|1444558_1445275_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002209462.1|1447370_1448138_+	YdiY family protein	NA	NA	NA	NA	NA
WP_002213759.1|1448440_1448899_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209461.1|1449110_1449458_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002222284.1|1449538_1450279_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002209459.1|1450317_1450866_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002209458.1|1450887_1451136_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002209456.1|1451363_1452725_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002209455.1|1452890_1453682_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_144406008.1|1454464_1455418_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	97.6	7.8e-162
WP_002213759.1|1457130_1457589_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	1729155	1781487	4569625	transposase,protease	Escherichia_phage(20.0%)	53	NA	NA
WP_002213775.1|1729155_1729614_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210156.1|1729809_1730262_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_002210155.1|1730301_1730529_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002210154.1|1730533_1730854_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_002210153.1|1730859_1731252_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002210152.1|1731618_1732320_-	esterase	NA	NA	NA	NA	NA
WP_000255944.1|1732376_1733399_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_042669063.1|1733398_1734178_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.0e-138
WP_002210151.1|1735258_1736152_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210150.1|1736413_1737118_+	pirin family protein	NA	NA	NA	NA	NA
WP_002210149.1|1737828_1738728_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.4	1.0e-49
WP_002228200.1|1738790_1740764_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002210147.1|1740847_1741201_+	YraN family protein	NA	NA	NA	NA	NA
WP_002210146.1|1741471_1742062_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.0	3.2e-12
WP_002210145.1|1742072_1742648_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002210144.1|1742854_1743580_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002210143.1|1743576_1744230_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002210142.1|1744471_1746808_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.4	9.9e-41
WP_002210140.1|1747071_1747995_-	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_002229651.1|1748817_1753284_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_002210138.1|1753293_1754712_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002210137.1|1755152_1755638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216203.1|1755790_1756306_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
WP_002210135.1|1756311_1756953_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002230558.1|1757132_1757330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210133.1|1757326_1757719_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002210132.1|1757733_1758162_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210131.1|1758475_1759603_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210130.1|1759826_1760231_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002218066.1|1760501_1761875_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002213775.1|1761991_1762450_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210128.1|1762675_1763764_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002210127.1|1763944_1765207_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210126.1|1765360_1765615_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210125.1|1765761_1766064_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210124.1|1766099_1766723_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210123.1|1766735_1767293_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210122.1|1767297_1768080_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210121.1|1768297_1769116_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210120.1|1769380_1770355_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210119.1|1770465_1771452_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002228203.1|1771700_1772264_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002218352.1|1772260_1772824_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002210117.1|1772807_1773353_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002210116.1|1773359_1774085_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210115.1|1774146_1775580_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002213952.1|1776008_1776491_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210113.1|1776796_1777651_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002210112.1|1777647_1777920_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210111.1|1778257_1779193_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210110.1|1779204_1779669_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210109.1|1779806_1780193_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_001436717.1|1780533_1781487_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	8.3e-180
>prophage 6
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	1911053	1993333	4569625	transposase,plate	Bacillus_phage(16.67%)	55	NA	NA
WP_002212105.1|1911053_1912400_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002212104.1|1912402_1912948_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002212103.1|1912947_1914264_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_002213885.1|1914389_1915478_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_100067904.1|1916235_1917589_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002212100.1|1918704_1919145_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002212099.1|1919151_1920633_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002212098.1|1920700_1921198_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002212097.1|1921721_1922240_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002212095.1|1922391_1922670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212093.1|1923140_1924052_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_002212092.1|1924292_1925564_-	maltoporin	NA	NA	NA	NA	NA
WP_002212091.1|1925634_1926744_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	5.0e-27
WP_002221973.1|1926747_1926984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212089.1|1927545_1928757_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_002212088.1|1928943_1930521_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_002212087.1|1930534_1931425_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_002212086.1|1931567_1931975_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_002212085.1|1932109_1933756_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002212084.1|1934125_1935511_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_002228189.1|1936078_1937764_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_002212081.1|1937833_1942741_+	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_002212080.1|1942836_1946532_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	4.6e-24
WP_002212079.1|1947710_1949438_-	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_002212078.1|1949693_1951001_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_002212077.1|1951047_1952646_-	malate synthase A	NA	NA	NA	NA	NA
WP_002212076.1|1953066_1953996_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002210692.1|1960592_1962182_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002210691.1|1962241_1963528_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002355296.1|1963675_1964329_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210689.1|1964378_1964654_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002210688.1|1964842_1965433_-	YjaG family protein	NA	NA	NA	NA	NA
WP_002210687.1|1965478_1966219_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210686.1|1966248_1967316_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210685.1|1967434_1968220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210684.1|1968312_1969095_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210683.1|1969191_1969701_+	sigma D regulator	NA	NA	NA	NA	NA
WP_002210682.1|1970076_1972122_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210681.1|1972108_1972783_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210680.1|1972772_1973570_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002217275.1|1973566_1973782_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002217273.1|1973783_1974599_+	thiazole synthase	NA	NA	NA	NA	NA
WP_002210678.1|1974591_1975722_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002213775.1|1976153_1976612_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210677.1|1976738_1980959_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_002210676.1|1981087_1985116_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_042669064.1|1985458_1985854_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210674.1|1985920_1986418_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210673.1|1986782_1987487_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210672.1|1987490_1987919_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210671.1|1988109_1988655_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210670.1|1988656_1989040_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210669.1|1989290_1990475_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_001297096.1|1991531_1992311_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1992310_1993333_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 7
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	2942387	2988859	4569625	tRNA,transposase,plate	Bodo_saltans_virus(20.0%)	40	NA	NA
WP_002210509.1|2942387_2945204_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.1	1.0e-63
WP_002210508.1|2945203_2945713_+	signal peptidase II	NA	NA	NA	NA	NA
WP_002228112.1|2945780_2946239_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210506.1|2946219_2947173_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_042669068.1|2947554_2948013_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210504.1|2948465_2949287_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_002224759.1|2949759_2950935_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	6.9e-51
WP_002210502.1|2950950_2954184_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_002210501.1|2954411_2955026_-	LysE family translocator	NA	NA	NA	NA	NA
WP_002210499.1|2955349_2956150_+	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_002210498.1|2956146_2956602_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002210497.1|2956751_2957234_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.6	4.7e-30
WP_002213775.1|2957445_2957904_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_071525509.1|2958345_2958660_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002210493.1|2958786_2959251_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002210492.1|2959340_2960210_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	NA	NA	NA	NA
WP_002210491.1|2960226_2960604_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_002210490.1|2960617_2961436_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002210489.1|2961428_2962424_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_002210488.1|2962407_2963712_-	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_002228111.1|2963779_2966122_-	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_002210486.1|2966306_2967140_+	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_002210485.1|2967437_2968058_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_002214747.1|2969280_2970024_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_002210482.1|2970353_2971367_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002210481.1|2971377_2971938_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002210480.1|2971946_2973449_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002210479.1|2973611_2974130_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002210478.1|2974203_2974647_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002210477.1|2974679_2976524_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210476.1|2976516_2977500_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210475.1|2977517_2980106_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210474.1|2980209_2982558_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002228110.1|2982570_2983143_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002228109.1|2983167_2984790_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|2984815_2985919_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|2985911_2986529_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214737.1|2986534_2986900_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210471.1|2986892_2987384_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002210470.1|2987503_2988859_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	3009681	3066283	4569625	transposase,holin	Escherichia_phage(50.0%)	53	NA	NA
WP_000255944.1|3009681_3010704_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002397472.1|3010791_3011043_+	sugar transporter	NA	NA	NA	NA	NA
WP_002210456.1|3011283_3011886_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002210455.1|3011900_3013331_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210454.1|3013332_3014424_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210453.1|3014426_3015989_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002213775.1|3016135_3016594_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210452.1|3017022_3017238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002216434.1|3017915_3018872_+	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002216437.1|3019408_3021214_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002228103.1|3021673_3023401_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002210448.1|3023403_3023898_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002213759.1|3024096_3024555_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210447.1|3025059_3026070_+	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002210446.1|3026200_3026641_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_087768171.1|3027098_3027188_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210443.1|3027742_3028201_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_002210442.1|3028203_3029166_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210441.1|3029162_3029480_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210440.1|3029545_3031309_+	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210439.1|3031295_3032783_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210438.1|3032779_3034156_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210437.1|3034149_3035232_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210436.1|3035234_3036551_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210435.1|3036550_3037753_+	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210434.1|3037749_3038820_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002216457.1|3038957_3040433_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210432.1|3040425_3041346_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002228100.1|3041347_3042175_+	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210431.1|3042201_3043458_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002210430.1|3043530_3044682_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002228285.1|3044781_3045702_+	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210428.1|3045868_3046393_-	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002210427.1|3046421_3046955_+	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210426.1|3047032_3049747_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210424.1|3050041_3050428_+	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_001297096.1|3050689_3051469_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3051468_3052491_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002210421.1|3052769_3053165_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002210420.1|3053468_3053753_-	YqjK-like family protein	NA	NA	NA	NA	NA
WP_002210419.1|3053749_3054145_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002210418.1|3054147_3054453_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_002210416.1|3054607_3054988_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_002210415.1|3055213_3055603_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_002210414.1|3055599_3056298_-	DedA family protein	NA	NA	NA	NA	NA
WP_002218957.1|3056575_3057109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210412.1|3057357_3058152_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_002353699.1|3058414_3059716_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210410.1|3060463_3061873_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210409.1|3062071_3063523_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_002210408.1|3063533_3065024_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_002210407.1|3065176_3065707_+	YgjV family protein	NA	NA	NA	NA	NA
WP_002213775.1|3065824_3066283_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	3279772	3297281	4569625	transposase	Tupanvirus(50.0%)	7	NA	NA
WP_002211388.1|3279772_3285592_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	31.3	1.3e-41
WP_002214915.1|3285604_3287293_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	3.1e-36
WP_002211387.1|3287300_3293759_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	8.5e-42
WP_001297096.1|3293966_3294746_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3294745_3295768_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_099156340.1|3295849_3296146_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_002211384.1|3296486_3297281_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.9	8.9e-119
>prophage 10
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	3451331	3527554	4569625	tRNA,transposase,plate,protease	Escherichia_phage(22.22%)	57	NA	NA
WP_000255944.1|3451331_3452354_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213759.1|3452935_3453394_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209965.1|3453701_3455696_-	transketolase	NA	NA	NA	NA	NA
WP_002209967.1|3456186_3456939_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_071525520.1|3457084_3457195_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209968.1|3457228_3457549_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_002209969.1|3457708_3459688_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209971.1|3460894_3462049_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002228059.1|3462241_3462754_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209973.1|3462851_3463559_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002209975.1|3463810_3464542_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209976.1|3464567_3465527_+	glutathione synthase	NA	NA	NA	NA	NA
WP_002209977.1|3465642_3466206_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209978.1|3466205_3466628_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209979.1|3466807_3467692_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209980.1|3467695_3468811_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209981.1|3468919_3470044_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002215609.1|3470063_3470762_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209983.1|3470894_3471716_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002209984.1|3472003_3472558_+	YggT family protein	NA	NA	NA	NA	NA
WP_002215612.1|3472554_3472845_+	YggU family protein	NA	NA	NA	NA	NA
WP_002215614.1|3472944_3473538_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002209987.1|3473530_3474661_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002224905.1|3474850_3484183_-	phage minor structural protein	NA	NA	NA	NA	NA
WP_002228655.1|3484681_3484912_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_002228656.1|3484884_3485415_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_002209989.1|3485526_3486453_-	glutaminase B	NA	NA	NA	NA	NA
WP_002209990.1|3486563_3486890_-	YggL family protein	NA	NA	NA	NA	NA
WP_002209991.1|3486889_3487609_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002228057.1|3487946_3489062_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209994.1|3489239_3489512_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002209995.1|3489694_3490771_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002209997.1|3491070_3492171_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209998.1|3492274_3494308_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209999.1|3494390_3495374_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210000.1|3495406_3496906_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002210001.1|3496951_3497911_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|3498466_3500629_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210005.1|3501957_3502593_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_086016632.1|3503199_3503897_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210008.1|3503992_3504760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210009.1|3504746_3507044_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210010.1|3507059_3507695_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002216110.1|3508919_3509114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016590715.1|3509277_3509625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210011.1|3509768_3511991_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_002210012.1|3512005_3514354_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_002210013.1|3514350_3516999_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_002210014.1|3517416_3517908_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002228049.1|3517911_3519648_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210015.1|3519647_3520334_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002211664.1|3520330_3521683_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002215896.1|3521694_3523239_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211662.1|3523281_3523782_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211661.1|3524983_3525139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215900.1|3526057_3526453_-	lipoprotein	NA	NA	NA	NA	NA
WP_002215902.1|3526903_3527554_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	3669721	3675893	4569625	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001297096.1|3669721_3670501_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3670500_3671523_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215951.1|3672127_3672445_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_002210705.1|3672450_3672765_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002210707.1|3673113_3674202_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002215950.1|3674198_3675158_-	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002215949.1|3675150_3675693_-	ash family protein	NA	NA	NA	NA	NA
WP_002210709.1|3675692_3675893_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
>prophage 12
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	3747571	3858777	4569625	transposase,tRNA,protease,coat,holin,tail,plate	Enterobacteria_phage(15.15%)	97	NA	NA
WP_002213775.1|3747571_3748030_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002220180.1|3748258_3749962_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002218281.1|3749984_3751457_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002218278.1|3751514_3752111_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002228035.1|3752475_3754524_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002214199.1|3754755_3755649_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002214197.1|3755686_3756535_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002214195.1|3756880_3757744_+	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002213775.1|3758672_3759131_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210776.1|3759545_3760475_+	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002228612.1|3760774_3761713_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210778.1|3761786_3761966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210780.1|3762304_3763240_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_002210781.1|3763360_3765073_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002210782.1|3765282_3765822_+	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_002214185.1|3765847_3766189_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_002210785.1|3766501_3767605_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_002210786.1|3767789_3768038_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002210787.1|3768245_3769082_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.1e-17
WP_002210788.1|3769118_3770048_+	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210789.1|3770150_3771011_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210790.1|3771013_3771895_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210791.1|3772140_3772614_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
WP_002210792.1|3773048_3774317_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210793.1|3774440_3776042_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_002210794.1|3776041_3777118_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_002210795.1|3777114_3777951_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	4.2e-10
WP_002223523.1|3778044_3778743_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.4e-12
WP_002210797.1|3778857_3779715_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_002210798.1|3779738_3781154_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002210799.1|3781308_3782163_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_002214183.1|3782898_3783366_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_079993142.1|3783369_3783831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210801.1|3784091_3785246_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210802.1|3785242_3786181_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	6.4e-23
WP_002353933.1|3786315_3787014_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210804.1|3787491_3788826_+	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_002210805.1|3788895_3791202_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_002210806.1|3791319_3791523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210807.1|3791647_3792538_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002210809.1|3792949_3794065_-	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	2.1e-110
WP_002210810.1|3794334_3796515_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.1e-44
WP_002210811.1|3796582_3798022_-	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	4.9e-99
WP_002210812.1|3798382_3798925_+	membrane protein	NA	NA	NA	NA	NA
WP_002221775.1|3799181_3800390_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_002210814.1|3801008_3802202_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_002210815.1|3802259_3802769_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210816.1|3802803_3803061_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210817.1|3803064_3804195_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210818.1|3804357_3806646_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210820.1|3807139_3807868_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210821.1|3808129_3810805_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_002228028.1|3810992_3813866_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210824.1|3813933_3814587_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002216094.1|3814589_3815162_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_002216093.1|3815329_3817282_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002210825.1|3817305_3818460_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210826.1|3819562_3820678_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002213775.1|3820879_3821338_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213759.1|3821590_3822049_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002228026.1|3822838_3824005_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002208871.1|3824122_3824293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208870.1|3824279_3825806_-	MFS transporter	NA	NA	NA	NA	NA
WP_002208869.1|3826182_3827211_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208868.1|3827284_3829072_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|3829493_3830429_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208866.1|3830600_3830843_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208864.1|3831048_3831771_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|3832044_3832524_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|3832734_3834039_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002208861.1|3834747_3835560_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|3835535_3836330_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|3836943_3837234_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|3837279_3837897_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|3837901_3838096_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208856.1|3838092_3839601_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208855.1|3839622_3839991_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_002208854.1|3839992_3840292_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208853.1|3840412_3841906_+|coat	coat protein	coat	NA	NA	NA	NA
WP_002208852.1|3842172_3843579_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|3843575_3844631_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002215460.1|3844646_3845243_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208848.1|3845239_3845695_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|3845698_3846835_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|3846831_3847092_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|3847088_3847436_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002208845.1|3847532_3848312_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208843.1|3848609_3849350_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208842.1|3849640_3851077_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208841.1|3851202_3851565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208840.1|3852264_3852753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208839.1|3852765_3853914_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_002230704.1|3854270_3854654_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208837.1|3854884_3856681_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002208836.1|3856708_3856936_-	YejL family protein	NA	NA	NA	NA	NA
WP_002208835.1|3857113_3858118_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002213775.1|3858318_3858777_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	4059422	4125689	4569625	transposase,plate,protease	Escherichia_phage(16.67%)	52	NA	NA
WP_000255944.1|4059422_4060445_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211286.1|4061078_4061267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220006.1|4061532_4062051_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002224683.1|4062119_4063871_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002226586.1|4064081_4064537_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002213775.1|4064705_4065164_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213066.1|4065353_4066415_-	porin OmpA	NA	NA	NA	NA	NA
WP_002213065.1|4066772_4067279_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213064.1|4067507_4068143_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213063.1|4068244_4070383_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213062.1|4070412_4070859_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002213061.1|4071052_4073038_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	28.4	5.3e-19
WP_002213060.1|4073098_4073563_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213058.1|4073741_4074422_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213056.1|4074737_4075154_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213054.1|4075262_4075580_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213052.1|4075640_4076831_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213049.1|4076924_4077203_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002213046.1|4077254_4077584_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213039.1|4081229_4083647_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213038.1|4083800_4084547_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213036.1|4085277_4085496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213034.1|4085759_4086284_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213032.1|4086273_4087557_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|4087558_4088296_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213028.1|4088311_4089550_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213026.1|4089542_4090262_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213025.1|4090263_4091016_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213024.1|4091018_4091807_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002228570.1|4091893_4092334_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213017.1|4092371_4092620_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002213016.1|4092718_4093567_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213014.1|4094555_4095056_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002214707.1|4095098_4096649_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213011.1|4096660_4098013_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|4098009_4098696_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002214568.1|4098695_4100432_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|4100435_4100927_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211927.1|4101314_4103957_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	1.6e-92
WP_002211928.1|4103959_4106308_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_002211929.1|4106323_4108624_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211930.1|4108620_4109394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211931.1|4109546_4109807_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002211932.1|4109822_4112006_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002214564.1|4112178_4112649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211935.1|4114813_4116046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211936.1|4116042_4119465_+	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211937.1|4119508_4121110_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002211938.1|4121127_4122186_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002211939.1|4122200_4122656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211940.1|4122876_4124640_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211941.1|4124603_4125689_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 14
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	4245244	4281880	4569625	transposase	uncultured_virus(42.86%)	37	NA	NA
WP_002209743.1|4245244_4246453_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002217041.1|4246415_4246712_-	biofilm formation regulator BssS	NA	NA	NA	NA	NA
WP_002213110.1|4247217_4247463_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	51.3	2.6e-13
WP_002213109.1|4247775_4248822_-	dihydroorotase	NA	NA	NA	NA	NA
WP_002213107.1|4249056_4249344_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002209743.1|4249620_4250829_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002354074.1|4250924_4254581_-	ribonuclease E	NA	NA	NA	NA	NA
WP_002210927.1|4255164_4256127_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_002213759.1|4256346_4256805_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210928.1|4256959_4257556_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002210930.1|4257697_4258222_+	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_002210931.1|4258234_4258402_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002210932.1|4258435_4259470_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002210933.1|4259476_4260427_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002210934.1|4260464_4261394_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002210935.1|4261407_4262142_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	7.7e-16
WP_002220787.1|4262295_4262532_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	7.7e-10
WP_002213079.1|4262626_4263868_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_002213775.1|4264066_4264525_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213080.1|4264940_4265747_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_002217396.1|4266035_4267061_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002213082.1|4267050_4267689_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	4.6e-25
WP_002213083.1|4267688_4268711_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_002213084.1|4268725_4269535_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002213085.1|4269840_4271274_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002213759.1|4271463_4271922_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002215853.1|4272364_4273183_+	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002213087.1|4273356_4273710_+	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_002213088.1|4273744_4274134_+	YcfL family protein	NA	NA	NA	NA	NA
WP_002213089.1|4274174_4274750_+	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_002213090.1|4274730_4275597_+	thiamine kinase	NA	NA	NA	NA	NA
WP_002215854.1|4275679_4276699_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002213095.1|4276826_4277369_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002213097.1|4277743_4279048_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002215856.1|4279585_4280155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213101.1|4280162_4280576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|4280671_4281880_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 15
NZ_CP009840	Yersinia pestis A1122 chromosome 1, complete sequence	4569625	4367876	4385864	4569625	coat,transposase,protease	Escherichia_phage(50.0%)	15	NA	NA
WP_000255944.1|4367876_4368899_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215943.1|4369305_4369695_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_002210859.1|4369804_4370044_-	YebV family protein	NA	NA	NA	NA	NA
WP_002210858.1|4370251_4371241_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_002210857.1|4371446_4373894_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210856.1|4374081_4374834_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002216611.1|4374864_4375422_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|4375442_4375973_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210852.1|4375978_4376533_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216616.1|4377011_4379663_-	PqiB family protein	NA	NA	NA	NA	NA
WP_002367629.1|4379631_4380879_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002210850.1|4381110_4381608_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002210849.1|4381703_4382417_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210848.1|4382436_4384509_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210847.1|4384982_4385864_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 1
NZ_CP009841	Yersinia pestis A1122 plasmid pMT, complete sequence	95328	13258	94348	95328	integrase,terminase,transposase,tail	Salmonella_phage(87.5%)	78	19430:19444	45293:45307
WP_002215065.1|13258_14200_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211756.1|14222_14498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211757.1|15237_15726_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211758.1|15803_17567_+	phospholipase D	NA	NA	NA	NA	NA
19430:19444	attL	TCTGCTCTTCAGTAA	NA	NA	NA	NA
WP_002211760.1|19642_20665_-|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002209743.1|21133_22342_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211761.1|22690_23596_-	F1 operon transcriptional regulator Caf1R	NA	NA	NA	NA	NA
WP_002211762.1|23923_24700_+	F1 capsule chaperone Caf1M	NA	NA	NA	NA	NA
WP_002211763.1|24724_27226_+	F1 capsule-anchoring usher protein Caf1A	NA	NA	NA	NA	NA
WP_002216410.1|27306_27819_+	F1 capsule protein Caf1	NA	NA	NA	NA	NA
WP_002353208.1|28578_29682_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002228802.1|29676_30063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228800.1|30325_30538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211766.1|30647_33014_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002211767.1|33110_34346_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_000255944.1|37653_38676_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|38675_39455_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|39588_40197_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|40498_43387_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|43467_44046_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|44102_48734_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
45293:45307	attR	TCTGCTCTTCAGTAA	NA	NA	NA	NA
WP_002211773.1|48755_49343_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|49330_50128_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211775.1|50120_50819_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_000440566.1|50908_51244_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|51285_55863_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|55870_56095_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|56220_56538_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|56597_57344_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|57418_57802_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|57803_58277_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|58267_58612_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|58709_59543_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|59542_59977_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|60020_60683_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|60757_61633_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002211785.1|61659_62493_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	91.3	5.8e-137
WP_002211786.1|62515_64090_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	2.4e-301
WP_002211787.1|64123_65380_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|65382_66024_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|66219_66486_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|66495_67386_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|67391_67646_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|67638_68277_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|68273_68942_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|68941_69640_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|69704_71264_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|71266_71545_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|71604_72027_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|72031_72559_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|72880_73531_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|73615_73843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211801.1|74481_74964_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|75169_75451_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213759.1|75650_76109_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214145.1|76317_76887_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|76899_77646_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_002214148.1|77635_79552_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
WP_002213300.1|79781_80867_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002214154.1|81015_81204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213298.1|81282_82305_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002214160.1|82664_83309_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
WP_002214164.1|84053_85118_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|85686_85899_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|85898_86234_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|86230_86410_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|86450_86726_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|86793_87204_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|87187_87559_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|87712_88543_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|88546_88747_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_000920226.1|89916_90183_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|90182_91127_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|91187_92216_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|92335_92767_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|92987_93239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|93311_93875_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002213143.1|93904_94348_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.8e-72
