The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009838	Yersinia enterocolitica strain 2516-87 chromosome, complete genome	4534244	270424	314457	4534244	transposase,protease	Shigella_phage(14.29%)	33	NA	NA
WP_042663628.1|270424_271627_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_013650139.1|271694_272345_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_072077086.1|272762_272897_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	66.7	8.4e-06
WP_013650141.1|273118_273523_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	62.7	8.2e-36
WP_013650144.1|275018_276050_+	methyltransferase	NA	NA	NA	NA	NA
WP_013650145.1|276298_277033_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_005159375.1|277308_278745_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_013650146.1|278848_280375_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_013650147.1|280540_281281_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005159363.1|281371_281743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005159359.1|281829_281997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013650148.1|282049_282379_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_013650149.1|282379_282694_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	48.3	9.5e-16
WP_013650150.1|282804_283284_-	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	59.2	1.4e-34
WP_005159354.1|283557_284181_+	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	53.2	1.6e-51
WP_005159352.1|284527_284770_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	70.9	5.1e-25
WP_013650151.1|284934_285870_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_013650152.1|286196_287984_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.9	6.2e-11
WP_005159343.1|288053_289043_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005159340.1|289456_290983_+	MFS transporter	NA	NA	NA	NA	NA
WP_005171542.1|291162_292305_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_005159330.1|292819_293923_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.9	4.6e-113
WP_013650153.1|296371_297526_+	MFS transporter	NA	NA	NA	NA	NA
WP_013650154.1|297548_300242_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_013650155.1|300244_300892_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_020283005.1|301153_304021_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.4	5.8e-43
WP_020282800.1|304285_305305_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013650157.1|305699_308357_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.9	1.0e-102
WP_032904274.1|308560_309289_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_013650159.1|309804_312090_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	65.1	9.3e-286
WP_005159298.1|312175_313306_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	4.0e-173
WP_013650160.1|313385_313691_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	56.1	4.3e-21
WP_020283002.1|313950_314457_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 2
NZ_CP009838	Yersinia enterocolitica strain 2516-87 chromosome, complete genome	4534244	866647	928975	4534244	integrase,transposase,tRNA	Escherichia_phage(13.33%)	59	870562:870588	927849:927875
WP_020282800.1|866647_867667_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013649365.1|868038_870297_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	29.7	7.5e-70
870562:870588	attL	TCCCTGGCGCGGACGCTTTACTCTTCT	NA	NA	NA	NA
WP_013649364.1|870758_871811_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_013649363.1|871829_873092_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_005165085.1|873258_874212_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005165087.1|874208_875369_-	MFS transporter	NA	NA	NA	NA	NA
WP_005165088.1|875705_876602_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005165091.1|876709_877597_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005165094.1|877657_878302_+	DsbA family protein	NA	NA	NA	NA	NA
WP_005165103.1|880062_880533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005165104.1|880517_881228_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005165106.1|881429_881798_+	type II secretion system pilot lipoprotein GspS	NA	NA	NA	NA	NA
WP_013649361.1|881778_882612_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_013649360.1|882626_882908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013649358.1|884262_885210_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_013649357.1|885224_885818_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_071883472.1|885810_886173_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_005165116.1|886210_886660_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_032904335.1|886679_887888_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005165119.1|887874_889380_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_013649355.1|889376_891323_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	31.1	1.6e-31
WP_032904333.1|891359_891812_-	general secretion pathway protein GspC	NA	NA	NA	NA	NA
WP_013649353.1|891939_892356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005165125.1|893058_893814_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_005165127.1|893963_894347_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013649352.1|894449_895199_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	1.9e-17
WP_005165131.1|895266_895572_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_005165133.1|895578_896532_-	curved DNA-binding protein	NA	A0A2L0UZR4	Agrobacterium_phage	30.9	2.5e-22
WP_042663692.1|896756_897776_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005166619.1|898192_899437_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.9	3.1e-17
WP_005166615.1|899519_899915_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_005166614.1|901140_901341_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_013649347.1|901483_902686_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	7.5e-77
WP_005166024.1|902792_903191_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_005166025.1|903190_903487_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_005166026.1|903643_904006_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005166028.1|904071_904332_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	36.0	2.5e-06
WP_032904770.1|905545_906010_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032904342.1|906249_906744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032904343.1|906786_907956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032904344.1|908063_908627_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	38.8	1.8e-20
WP_032904345.1|908835_909270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173425284.1|910346_910616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042663695.1|910605_912114_+|transposase	IS21-like element ISYen2A family transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.2	4.3e-21
WP_013649170.1|912100_912826_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	33.3	4.4e-32
WP_013649345.1|912809_914687_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	25.5	7.3e-10
WP_013649344.1|915020_916538_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.6	2.3e-86
WP_020282590.1|916547_917646_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_013649343.1|918091_919825_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.7	2.8e-64
WP_013649342.1|919831_920548_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_005166040.1|920596_921496_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.2	2.1e-31
WP_005166042.1|921602_922121_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_013649341.1|922179_923601_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_042663699.1|923692_925120_-	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_005166045.1|925130_925829_-	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_005166047.1|925828_926254_-	protein YgfX	NA	NA	NA	NA	NA
WP_013649338.1|926234_926501_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_005166051.1|926767_927760_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_020282800.1|927955_928975_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
927849:927875	attR	AGAAGAGTAAAGCGTCCGCGCCAGGGA	NA	NA	NA	NA
>prophage 4
NZ_CP009838	Yersinia enterocolitica strain 2516-87 chromosome, complete genome	4534244	3250775	3303629	4534244	head,protease,lysis,tail,integrase	uncultured_Caudovirales_phage(29.03%)	53	3245468:3245484	3279699:3279715
3245468:3245484	attL	AATGATGCAGCAAATGG	NA	NA	NA	NA
WP_005179706.1|3250775_3252716_-|protease	PatA/PatG family cyanobactin maturation protease	protease	NA	NA	NA	NA
WP_005158993.1|3253019_3253355_-	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_005158990.1|3253529_3254594_-	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_005158988.1|3254587_3255739_-	galactokinase	NA	NA	NA	NA	NA
WP_013649516.1|3255738_3256845_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_005158984.1|3256854_3257871_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.2	3.8e-82
WP_013649517.1|3258168_3258987_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032904655.1|3259182_3260676_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.5	2.2e-09
WP_013649518.1|3260784_3261576_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_005158974.1|3261810_3261951_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_013649519.1|3262167_3262944_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013649520.1|3263119_3264313_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.7	8.5e-73
WP_013649521.1|3264278_3264479_-	AlpA family phage regulatory protein	NA	A0A0R6PC61	Moraxella_phage	45.3	8.2e-05
WP_032904656.1|3264475_3265876_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	70.6	2.2e-197
WP_013649523.1|3265919_3266414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649524.1|3266415_3266688_-	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	74.4	7.0e-31
WP_013649525.1|3266677_3266902_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032904657.1|3266906_3269006_-	DNA polymerase I	NA	Q775A3	Bordetella_phage	65.0	5.4e-264
WP_013649527.1|3269102_3269882_-	DUF2303 family protein	NA	A0A291AUR3	Sinorhizobium_phage	30.8	6.0e-19
WP_013649528.1|3269938_3270316_-	hypothetical protein	NA	A0A142K8T9	Gordonia_phage	45.7	4.4e-07
WP_013649529.1|3270371_3270920_-	DUF2815 family protein	NA	Q3LZQ2	Bacteriophage	59.0	1.4e-54
WP_042663878.1|3270932_3272243_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	54.4	3.9e-127
WP_013649531.1|3272245_3272980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013649532.1|3273491_3274169_-	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	47.3	1.9e-53
WP_013649533.1|3274309_3274510_+	transcriptional regulator	NA	K7RWG7	Bacteriophage	62.5	3.4e-11
WP_013649534.1|3274513_3276679_+	bifunctional DNA primase/polymerase	NA	B6SD37	Bacteriophage	67.4	3.8e-164
WP_050137016.1|3277009_3277246_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_013649536.1|3277518_3277932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649537.1|3277942_3278161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649538.1|3278163_3279768_+|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	60.9	1.5e-176
3279699:3279715	attR	AATGATGCAGCAAATGG	NA	NA	NA	NA
WP_144405301.1|3279773_3280004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649540.1|3279990_3280794_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	44.5	8.9e-50
WP_013649541.1|3281007_3281916_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	38.1	8.3e-44
WP_013649542.1|3281970_3282531_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	51.3	4.0e-49
WP_013649543.1|3282530_3284504_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.2	2.8e-182
WP_013649544.1|3284509_3284956_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	41.2	6.7e-23
WP_013649545.1|3284959_3285442_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	48.0	2.7e-09
WP_013649546.1|3285438_3287565_+	hypothetical protein	NA	A0A2H4JE92	uncultured_Caudovirales_phage	27.0	1.1e-59
WP_013649547.1|3287570_3288863_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	35.8	3.0e-31
WP_013649548.1|3288859_3291385_+	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	42.7	1.6e-185
WP_032904658.1|3291386_3291794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050148023.1|3291805_3292546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013649551.1|3292587_3292938_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	47.3	1.6e-19
WP_013649553.1|3294556_3295954_+|tail	tail fiber	tail	T1S9Y2	Salmonella_phage	35.4	3.6e-38
WP_013649554.1|3295964_3296432_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_032904659.1|3296543_3296849_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.5	7.3e-21
WP_013649556.1|3296835_3297366_+	lysozyme	NA	Q7Y3V3	Yersinia_phage	70.9	4.0e-67
WP_013649557.1|3297358_3297859_+|lysis	lysis protein	lysis	A0A0A0YR13	Escherichia_phage	41.1	1.4e-24
WP_013649558.1|3297998_3298697_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013649559.1|3298690_3299755_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	1.2e-20
WP_005158965.1|3299997_3300819_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_013649560.1|3301232_3302234_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_005158960.1|3302351_3303629_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	33.2	4.2e-17
>prophage 5
NZ_CP009838	Yersinia enterocolitica strain 2516-87 chromosome, complete genome	4534244	3446099	3456945	4534244		Bacillus_phage(37.5%)	9	NA	NA
WP_005162367.1|3446099_3447686_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.1	6.3e-39
WP_020283358.1|3448167_3449586_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	7.6e-52
WP_020283357.1|3449599_3450985_+	phosphomannomutase ManB protein	NA	A0A127AWJ1	Bacillus_phage	26.8	1.3e-32
WP_013649617.1|3451139_3452030_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.3	4.9e-57
WP_013649618.1|3452095_3452989_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	42.5	9.9e-50
WP_013649619.1|3453132_3454254_+	GDP-mannose 4,6-dehydratase	NA	M1HAR7	Acanthocystis_turfacea_Chlorella_virus	63.6	1.1e-133
WP_162467783.1|3454266_3455355_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L470	Tupanvirus	39.5	7.3e-47
WP_013649621.1|3455410_3456193_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013649622.1|3456189_3456945_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.5	3.7e-13
>prophage 6
NZ_CP009838	Yersinia enterocolitica strain 2516-87 chromosome, complete genome	4534244	3641041	3653705	4534244		Vaccinia_virus(16.67%)	9	NA	NA
WP_013649690.1|3641041_3644194_-	beta-galactosidase	NA	B9U1H7	Vaccinia_virus	62.8	0.0e+00
WP_013649691.1|3644372_3645407_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	50.3	1.4e-84
WP_002210893.1|3645888_3646101_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_032904683.1|3646354_3646546_+	protein DsrB	NA	NA	NA	NA	NA
WP_013649692.1|3646679_3648419_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	1.1e-09
WP_005177865.1|3648666_3649038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005177868.1|3649284_3649524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005177870.1|3650087_3650786_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.0	1.1e-14
WP_005164503.1|3651002_3653705_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.2	2.7e-42
>prophage 7
NZ_CP009838	Yersinia enterocolitica strain 2516-87 chromosome, complete genome	4534244	3702774	3800390	4534244	holin,capsid,lysis,transposase,tail,integrase,plate,tRNA	Salmonella_phage(26.67%)	98	3702651:3702669	3705682:3705700
3702651:3702669	attL	ACGTTATGAATATGGGTGT	NA	NA	NA	NA
WP_071822707.1|3702774_3702930_-|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	83.8	1.0e-07
WP_013649708.1|3703725_3704121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005160362.1|3705116_3705386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005160360.1|3705700_3706303_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
3705682:3705700	attR	ACGTTATGAATATGGGTGT	NA	NA	NA	NA
WP_005160358.1|3706389_3709350_-	metal-dependent phosphohydrolase	NA	NA	NA	NA	NA
WP_020283291.1|3709680_3710550_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005160355.1|3710823_3711186_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_005160351.1|3711197_3711596_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_013649711.1|3711606_3713007_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_013649712.1|3713275_3714385_+	flagellin FliC	NA	NA	NA	NA	NA
WP_013649713.1|3714574_3715684_+	flagellin FliC	NA	NA	NA	NA	NA
WP_013649713.1|3715873_3716983_+	flagellin FliC	NA	NA	NA	NA	NA
WP_005160345.1|3717130_3718336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005160341.1|3718526_3719249_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_005160338.1|3719304_3719814_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_013649714.1|3720192_3721185_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_005160322.1|3721303_3722104_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013649716.1|3722103_3722766_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_005160316.1|3722768_3723524_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	7.1e-33
WP_005160301.1|3723595_3723967_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013649717.1|3723966_3724260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013649718.1|3724559_3728549_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013649719.1|3729074_3730559_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_005160269.1|3730723_3731053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005160265.1|3731056_3732124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005177992.1|3732914_3733775_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_032904699.1|3733791_3734922_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_013649721.1|3734930_3736232_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_005160258.1|3736433_3737033_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_013649722.1|3737202_3737685_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005160254.1|3738018_3739197_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_005178006.1|3740814_3741363_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	64.5	1.9e-27
WP_013649723.1|3741412_3742003_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_013649724.1|3742014_3742851_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_005169991.1|3742883_3743270_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_072077028.1|3743319_3744012_-	pyrimidine utilization protein B	NA	NA	NA	NA	NA
WP_042663910.1|3744662_3745331_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_005160227.1|3745388_3746819_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_032904704.1|3748892_3749627_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	40.3	1.8e-49
WP_005160202.1|3750030_3750528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005160200.1|3750609_3750939_-	DHCW motif cupin fold protein	NA	NA	NA	NA	NA
WP_013649731.1|3751083_3752583_+	alpha-amylase	NA	NA	NA	NA	NA
WP_013649732.1|3752834_3753089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005160193.1|3753119_3753458_-	GlpM family protein	NA	NA	NA	NA	NA
WP_005160184.1|3753568_3753793_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_042663914.1|3754486_3755143_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_032904707.1|3755135_3756968_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_005160174.1|3757026_3757575_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_013649733.1|3758239_3758455_-	ogr/Delta-like zinc finger family protein	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
WP_020282800.1|3758764_3759784_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_042663916.1|3760115_3761183_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	66.6	7.8e-118
WP_004705491.1|3763778_3763898_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_080366163.1|3763912_3764191_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	53.6	5.3e-18
WP_013649736.1|3764336_3764852_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	68.0	2.5e-61
WP_042663918.1|3764863_3766039_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.3	1.5e-178
WP_013649738.1|3766348_3766534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072077075.1|3767097_3767982_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	46.3	5.7e-74
WP_013649740.1|3768187_3768364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013649741.1|3768805_3769126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013649742.1|3769115_3769322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005161469.1|3769463_3769631_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	48.0	1.2e-06
WP_005161466.1|3769702_3769963_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_042663920.1|3769969_3770248_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_164492677.1|3770912_3772076_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.2	9.9e-34
WP_013649745.1|3772177_3772459_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	72.5	1.4e-31
WP_032904715.1|3772451_3772997_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	77.1	1.2e-79
WP_013649747.1|3772989_3773898_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	74.2	3.8e-121
WP_005161449.1|3773897_3774254_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	60.0	4.4e-33
WP_013649748.1|3774250_3774886_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	62.4	4.9e-67
WP_005161438.1|3775022_3775295_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_005161435.1|3775275_3775566_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	34.5	8.3e-06
WP_005161434.1|3775631_3776693_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_005161432.1|3776731_3777178_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	48.0	9.4e-33
WP_013649749.1|3777174_3777642_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	55.9	3.7e-40
WP_032904717.1|3777743_3778169_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	43.0	3.6e-18
WP_013649751.1|3778172_3778568_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	5.9e-47
WP_013649752.1|3778554_3778734_-|holin	holin	holin	NA	NA	NA	NA
WP_071822708.1|3778718_3779030_-|capsid	P2 family phage major capsid protein	capsid	A0A077KEQ8	Ralstonia_phage	62.4	2.7e-26
WP_005176946.1|3780715_3781918_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_005161398.1|3782573_3783491_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013649756.1|3784092_3784512_-	helix-turn-helix domain-containing protein	NA	A0A0M4REM4	Salmonella_phage	31.1	9.8e-16
WP_005161394.1|3784912_3785557_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	31.3	8.0e-17
WP_013649757.1|3786301_3786721_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	63.9	1.3e-39
WP_005161372.1|3786897_3787074_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_005161370.1|3787300_3787477_+	hypothetical protein	NA	B6SD15	Bacteriophage	60.7	2.2e-14
WP_032904719.1|3787478_3787961_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	63.8	2.1e-54
WP_005161363.1|3788333_3789218_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_005161358.1|3789519_3790176_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_013649759.1|3790282_3791167_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013649760.1|3791301_3792468_+	class C beta-lactamase	NA	NA	NA	NA	NA
WP_013649761.1|3792614_3793706_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_005161346.1|3793973_3794432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649762.1|3794486_3795080_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005161340.1|3795411_3795684_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004390739.1|3796170_3797118_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.2	2.7e-45
WP_013649763.1|3797315_3798197_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_013649764.1|3798198_3798822_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_013649765.1|3799127_3800390_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP009838	Yersinia enterocolitica strain 2516-87 chromosome, complete genome	4534244	3873136	3936529	4534244	coat,transposase,tRNA,protease	Bacillus_virus(20.0%)	58	NA	NA
WP_013649793.1|3873136_3874933_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	26.0	3.8e-08
WP_042663928.1|3875020_3875503_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_005165984.1|3875529_3876273_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005163071.1|3876637_3877159_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	32.4	6.5e-09
WP_013649794.1|3877281_3877899_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005163065.1|3877934_3878939_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.3	8.1e-08
WP_013649795.1|3878989_3880471_-	dipeptide/tripeptide permease DtpB	NA	NA	NA	NA	NA
WP_005163061.1|3880737_3881523_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_005163059.1|3881519_3882278_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.8	4.2e-17
WP_013649796.1|3882353_3883316_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_032904209.1|3883330_3884647_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	41.7	1.4e-15
WP_005163051.1|3884730_3885696_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_032904222.1|3886168_3887431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032904221.1|3887544_3888747_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	3.4e-77
WP_005169197.1|3888890_3890333_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_005163035.1|3890552_3891422_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005163030.1|3891774_3893259_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.6	3.4e-79
WP_005163029.1|3893564_3894206_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_005163026.1|3894890_3895268_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_005163022.1|3895254_3895584_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_005163018.1|3895745_3896090_-	RidA family protein	NA	NA	NA	NA	NA
WP_013649799.1|3896218_3898123_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.1	4.2e-90
WP_042664094.1|3898197_3898896_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_072077073.1|3899052_3899604_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_032904219.1|3899944_3901639_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	1.8e-31
WP_005163003.1|3901733_3902855_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|3902984_3903254_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_005163000.1|3903257_3904070_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_013649803.1|3904095_3904782_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_005162996.1|3905332_3905695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005162995.1|3905972_3906245_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_005162994.1|3906283_3907354_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_013649805.1|3907434_3908091_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005162992.1|3908205_3908652_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005162991.1|3908716_3909073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649809.1|3910779_3911625_-	EamA family transporter	NA	NA	NA	NA	NA
WP_013649810.1|3911858_3912116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164915.1|3912277_3913318_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_013649811.1|3913498_3914134_+	glutathione transferase	NA	NA	NA	NA	NA
WP_032904217.1|3914202_3914751_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005164919.1|3915251_3915485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164921.1|3916207_3916597_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005164922.1|3916714_3916957_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_013649813.1|3917069_3918779_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_005164926.1|3919001_3920012_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_032905225.1|3920042_3922484_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_005164928.1|3922570_3923320_-	molecular chaperone	NA	NA	NA	NA	NA
WP_013649814.1|3923366_3923924_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_005164933.1|3923935_3924493_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_013649815.1|3924498_3925035_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_013649816.1|3925362_3926787_-	MFS transporter	NA	NA	NA	NA	NA
WP_013649817.1|3926914_3927835_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032904216.1|3927847_3930478_-	PqiB family protein	NA	NA	NA	NA	NA
WP_013649819.1|3930446_3931694_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_013649820.1|3931934_3932432_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_005170218.1|3932527_3933256_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_013649821.1|3933275_3935351_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.4	4.3e-88
WP_005164945.1|3935647_3936529_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 9
NZ_CP009838	Yersinia enterocolitica strain 2516-87 chromosome, complete genome	4534244	3972815	3980647	4534244	tRNA	Tupanvirus(33.33%)	9	NA	NA
WP_005170086.1|3972815_3974744_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	7.4e-127
WP_011816226.1|3974747_3975299_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_004713020.1|3975395_3975593_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004393357.1|3975630_3975987_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152414234.1|3976055_3976103_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005161570.1|3976451_3977435_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_005161568.1|3977449_3979837_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
WP_002211830.1|3979841_3980138_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_005161566.1|3980350_3980647_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	68.8	6.2e-17
>prophage 10
NZ_CP009838	Yersinia enterocolitica strain 2516-87 chromosome, complete genome	4534244	4356624	4416693	4534244	integrase,transposase,tRNA,tail	Escherichia_phage(25.0%)	48	4343835:4343849	4417212:4417226
4343835:4343849	attL	ACCGCCTGAACGGCA	NA	NA	NA	NA
WP_013649973.1|4356624_4358355_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	35.1	4.5e-91
WP_144405295.1|4358478_4359913_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.3	5.8e-84
WP_005169005.1|4360056_4360845_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.8	1.6e-88
WP_005164388.1|4361373_4362081_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013649976.1|4362296_4362764_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_005164390.1|4362760_4364095_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_005164391.1|4364084_4366109_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_013649978.1|4369268_4370486_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_005164396.1|4370536_4371307_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_005164398.1|4371464_4372091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005164400.1|4372180_4373113_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005164401.1|4373163_4374033_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_013649980.1|4374177_4374492_-	cytochrome c	NA	NA	NA	NA	NA
WP_005164403.1|4374491_4374980_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_005164408.1|4374969_4375683_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.8e-31
WP_172665129.1|4375686_4376799_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032904240.1|4376833_4378126_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_032904239.1|4378128_4379532_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_004390794.1|4379667_4380195_-	iron transporter	NA	NA	NA	NA	NA
WP_014608895.1|4380275_4382213_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_013649984.1|4382386_4382905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649985.1|4383021_4384662_-	MFS transporter	NA	NA	NA	NA	NA
WP_013649986.1|4384773_4385781_-	glutaminase A	NA	NA	NA	NA	NA
WP_013649987.1|4386346_4387126_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_013649988.1|4387128_4387752_-	aldolase	NA	A0A077SK32	Escherichia_phage	78.2	6.8e-90
WP_032904238.1|4387748_4389011_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.0	1.3e-135
WP_005164436.1|4389533_4390313_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	63.9	1.7e-82
WP_005164439.1|4390557_4392234_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_005164442.1|4392226_4392946_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_005164444.1|4393242_4394601_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	69.9	3.9e-29
WP_013649989.1|4395656_4397171_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_005164450.1|4397319_4397673_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_032904237.1|4397958_4398984_+	ROK family protein	NA	NA	NA	NA	NA
WP_005164455.1|4399220_4400393_+	MFS transporter	NA	NA	NA	NA	NA
WP_005164457.1|4400573_4401392_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_042663999.1|4402448_4403651_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	9.8e-77
WP_013649992.1|4403843_4404365_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_005166647.1|4404502_4405159_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042664001.1|4406000_4407203_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	1.7e-76
WP_013649994.1|4407405_4408107_-	PAS domain-containing protein	NA	Q2A088	Sodalis_phage	39.0	7.3e-16
WP_032904248.1|4408160_4409474_-	cytosine permease	NA	NA	NA	NA	NA
WP_005163571.1|4409677_4410442_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_013649997.1|4411356_4412574_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	41.0	3.8e-60
WP_005163578.1|4412576_4413029_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	63.2	2.7e-48
WP_013649998.1|4413025_4414168_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	67.3	6.1e-145
WP_071822716.1|4414260_4414482_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	66.2	1.3e-22
WP_005163581.1|4414566_4415382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032904249.1|4415694_4416693_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	58.0	2.6e-107
4417212:4417226	attR	ACCGCCTGAACGGCA	NA	NA	NA	NA
>prophage 1
NZ_CP009837	Yersinia enterocolitica strain 2516-87 plasmid pCD, complete sequence	69701	11170	18901	69701	transposase	uncultured_Caudovirales_phage(57.14%)	9	NA	NA
WP_013749490.1|11170_11869_-	arsenic resistance NADPH-dependent reductase ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	7.7e-90
WP_013749489.1|11954_12275_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.7	1.7e-20
WP_010891245.1|12320_13610_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.2	1.6e-165
WP_010891244.1|13622_14048_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	5.6e-51
WP_010891243.1|14065_14647_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	2.6e-22
WP_071598611.1|14822_15659_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.5	4.2e-18
WP_010891241.1|15814_16267_+	PprA	NA	NA	NA	NA	NA
WP_013749484.1|16588_17464_-	DMT family transporter	NA	NA	NA	NA	NA
WP_013749483.1|17533_18901_-	trimeric autotransporter adhesin YadA	NA	Q9MCI8	Enterobacteria_phage	55.6	2.5e-12
