The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	378910	435512	4662886	holin,transposase	Escherichia_phage(50.0%)	53	NA	NA
WP_002213775.1|378910_379369_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210407.1|379486_380017_-	YgjV family protein	NA	NA	NA	NA	NA
WP_002210408.1|380169_381660_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_002210409.1|381670_383122_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_002210410.1|383320_384730_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_002353699.1|385477_386779_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210412.1|387041_387836_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_002218957.1|388084_388618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210414.1|388895_389594_+	DedA family protein	NA	NA	NA	NA	NA
WP_002210415.1|389590_389980_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_002210416.1|390205_390586_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_002210418.1|390740_391046_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_002210419.1|391048_391444_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002210420.1|391440_391725_+	YqjK-like family protein	NA	NA	NA	NA	NA
WP_002210421.1|392028_392424_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000255944.1|392702_393725_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|393724_394504_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|394765_395152_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|395446_398161_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|398238_398772_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|398800_399325_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|399491_400412_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|400511_401663_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|401735_402992_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|403018_403846_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|403847_404768_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|404760_406236_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|406373_407444_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|407440_408643_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|408642_409959_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|409961_411044_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|411037_412414_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|412410_413898_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210440.1|413884_415648_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|415713_416031_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|416027_416990_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|416992_417451_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|418005_418095_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|418552_418993_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|419123_420134_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213759.1|420638_421097_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210448.1|421295_421790_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002228103.1|421792_423520_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002216437.1|423979_425785_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|426321_427278_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|427955_428171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|428599_429058_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210453.1|429204_430767_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|430769_431861_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|431862_433293_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|433307_433910_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002397472.1|434150_434402_-	sugar transporter	NA	NA	NA	NA	NA
WP_000255944.1|434489_435512_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 2
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	456335	502807	4662886	plate,transposase,tRNA	uncultured_Caudovirales_phage(20.0%)	38	NA	NA
WP_002210470.1|456335_457691_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|457810_458302_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|458294_458660_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|458665_459283_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|459275_460379_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|462636_464985_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|465088_467677_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|467694_468678_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|468670_470515_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210478.1|470547_470991_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002210479.1|471064_471583_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002210480.1|471745_473248_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002210481.1|473256_473817_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002210482.1|473827_474841_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002214747.1|475170_475914_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_002210485.1|477136_477757_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_002210486.1|478054_478888_-	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_002228111.1|479072_481415_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_002210488.1|481482_482787_+	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_002210489.1|482770_483766_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_002210490.1|483758_484577_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002210491.1|484590_484968_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_002210492.1|484984_485854_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	NA	NA	NA	NA
WP_002210493.1|485943_486408_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_071525509.1|486534_486849_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002213775.1|487290_487749_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210497.1|487960_488443_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.6	4.7e-30
WP_002210498.1|488592_489048_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002210499.1|489044_489845_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_002210501.1|490168_490783_+	LysE family translocator	NA	NA	NA	NA	NA
WP_002210502.1|491010_494244_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_002224759.1|494259_495435_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	6.9e-51
WP_002210504.1|495907_496729_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_002213775.1|497181_497640_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210506.1|498021_498975_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_002228112.1|498955_499414_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210508.1|499481_499991_-	signal peptidase II	NA	NA	NA	NA	NA
WP_002210509.1|499990_502807_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.1	1.0e-63
>prophage 3
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	811789	821766	4662886	transposase	Escherichia_phage(28.57%)	7	NA	NA
WP_002212296.1|811789_813910_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	64.5	6.0e-45
WP_002212295.1|814135_815353_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	4.5e-29
WP_002212294.1|815485_816061_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	61.6	9.8e-67
WP_002215686.1|816303_817845_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	44.5	6.9e-83
WP_002208878.1|818170_818740_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	32.3	1.7e-07
WP_000255944.1|819964_820987_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|820986_821766_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 4
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	876491	921102	4662886	protease,transposase	Escherichia_phage(33.33%)	36	NA	NA
WP_002216348.1|876491_877328_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_002208930.1|877362_878121_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100067904.1|878313_879667_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002208933.1|879845_880730_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_002208934.1|880962_883398_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_002208935.1|884937_885255_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_002208936.1|885603_886059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216737.1|886601_886817_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002208938.1|887059_889258_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_002216730.1|889610_890639_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_002208941.1|890704_891550_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002208942.1|891649_892174_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002208943.1|892244_893576_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
WP_002208944.1|893811_894729_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002208945.1|894870_895356_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_002228141.1|895472_896057_-	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_002215873.1|896686_896926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208949.1|897138_898431_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000255944.1|899342_900365_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|900364_901144_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213759.1|902875_903334_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208953.1|903541_903781_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_002208954.1|904408_905257_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.5	3.2e-13
WP_002208956.1|907418_908165_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_002208957.1|908505_908940_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_002208958.1|909108_909723_+	DUF1454 family protein	NA	NA	NA	NA	NA
WP_002208959.1|909851_910619_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_002208960.1|910850_912086_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208961.1|912222_912960_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_002208962.1|912956_913670_+	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_002208963.1|913735_915163_+	anion permease	NA	NA	NA	NA	NA
WP_002218867.1|915280_916057_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208965.1|916306_917296_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208966.1|917516_918500_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002208967.1|918717_919620_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_002353252.1|920181_921102_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	8.6e-73
>prophage 5
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	1437714	1529899	4662886	plate,transposase	Escherichia_phage(15.38%)	59	NA	NA
WP_002213759.1|1437714_1438173_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211550.1|1438761_1440213_+	Trk system potassium transporter TrkH	NA	NA	NA	NA	NA
WP_002215920.1|1440234_1440768_+	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_002212288.1|1446904_1447942_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002212289.1|1447938_1448898_+	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_002212290.1|1448932_1449883_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.2	8.7e-28
WP_002355327.1|1450093_1450552_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255944.1|1450734_1451757_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1451756_1452536_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210669.1|1453592_1454777_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_002210670.1|1455027_1455411_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210671.1|1455412_1455958_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210672.1|1456148_1456577_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210673.1|1456580_1457285_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210674.1|1457649_1458147_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210675.1|1458213_1458582_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210676.1|1458924_1462953_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210677.1|1463081_1467302_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_042592982.1|1467428_1467887_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_002210678.1|1468318_1469449_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002217273.1|1469441_1470257_-	thiazole synthase	NA	NA	NA	NA	NA
WP_002217275.1|1470258_1470474_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002210680.1|1470470_1471268_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002210681.1|1471257_1471932_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210682.1|1471918_1473964_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210683.1|1474339_1474849_-	sigma D regulator	NA	NA	NA	NA	NA
WP_002210684.1|1474945_1475728_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210685.1|1475820_1476606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210686.1|1476724_1477792_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210687.1|1477821_1478562_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210688.1|1478607_1479198_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002210689.1|1479386_1479662_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002355296.1|1479711_1480365_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210691.1|1480512_1481799_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002210692.1|1481858_1483448_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002212076.1|1490291_1491221_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002212077.1|1491641_1493240_+	malate synthase A	NA	NA	NA	NA	NA
WP_002212078.1|1493286_1494594_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_002212079.1|1494849_1496577_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_002212080.1|1497755_1501451_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	4.6e-24
WP_002212081.1|1501546_1506454_-	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_002228189.1|1506523_1508209_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_002212084.1|1508776_1510162_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_002212085.1|1510531_1512178_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002212086.1|1512312_1512720_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_002212087.1|1512862_1513753_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_002212088.1|1513766_1515344_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_002212089.1|1515530_1516742_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_002221973.1|1517303_1517540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212091.1|1517543_1518653_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	5.0e-27
WP_002212092.1|1518723_1519995_+	maltoporin	NA	NA	NA	NA	NA
WP_002212093.1|1520235_1521147_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_002212095.1|1521617_1521896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212097.1|1522047_1522566_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002212098.1|1523089_1523587_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002212099.1|1523654_1525136_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002212100.1|1525142_1525583_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_100067904.1|1526698_1528053_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002213885.1|1528810_1529899_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	1624113	1688492	4662886	protease,transposase,holin	uncultured_Mediterranean_phage(18.18%)	56	NA	NA
WP_002210082.1|1624113_1625559_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002210083.1|1625761_1628620_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210084.1|1628644_1631476_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210086.1|1631676_1632036_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_002210087.1|1632032_1632434_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
WP_002214300.1|1632446_1632749_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002210089.1|1632882_1637373_-	toxin	NA	NA	NA	NA	NA
WP_002229661.1|1637429_1639571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002229660.1|1639639_1641022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210090.1|1641062_1643564_-	toxin	NA	NA	NA	NA	NA
WP_002214297.1|1643799_1644666_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210092.1|1644926_1645838_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002210093.1|1646140_1646344_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002210094.1|1646351_1647287_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210095.1|1647288_1649244_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002214288.1|1651173_1651647_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210098.1|1651651_1651933_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002210099.1|1652044_1652593_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210100.1|1652773_1654114_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011055205.1|1654362_1655007_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210102.1|1655214_1655601_+	cytochrome b562	NA	NA	NA	NA	NA
WP_002210103.1|1655824_1656235_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210104.1|1656587_1658255_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002215779.1|1658349_1659765_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210106.1|1660175_1661129_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002210107.1|1661362_1661839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210109.1|1664089_1664476_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|1664613_1665078_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|1665089_1666025_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|1666362_1666635_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|1666631_1667486_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|1667791_1668274_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|1668702_1670136_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002210116.1|1670197_1670923_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|1670929_1671475_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|1671458_1672022_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|1672018_1672582_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|1672830_1673817_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002210120.1|1673927_1674902_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|1675166_1675985_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|1676202_1676985_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|1676989_1677547_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|1677559_1678183_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|1678218_1678521_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|1678667_1678922_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|1679075_1680338_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|1680518_1681607_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002213775.1|1681832_1682291_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002218066.1|1682407_1683781_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002210130.1|1684051_1684456_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002210131.1|1684679_1685807_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210132.1|1686120_1686549_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210133.1|1686563_1686956_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002230558.1|1686952_1687150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210135.1|1687329_1687971_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002216203.1|1687976_1688492_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 7
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	2318589	2381791	4662886	plate,tRNA,transposase	Escherichia_phage(42.86%)	54	NA	NA
WP_042593040.1|2318589_2319612_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	3.5e-200
WP_002213759.1|2320085_2320544_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208491.1|2320686_2321196_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002208490.1|2321244_2322972_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	3.0e-18
WP_002208488.1|2323020_2323278_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002222180.1|2323776_2324745_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.8	4.8e-74
WP_002213487.1|2324901_2325636_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002227089.1|2325884_2326871_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002213368.1|2326961_2328974_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.2	1.7e-142
WP_002213369.1|2328993_2329209_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_002213372.1|2329309_2329657_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_002213374.1|2329788_2330394_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_002213775.1|2331107_2331566_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002222185.1|2331758_2333174_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002211622.1|2334121_2335306_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_002211621.1|2335740_2336970_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_002216909.1|2337062_2337476_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002211618.1|2337646_2338636_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002211617.1|2338771_2339650_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211616.1|2339752_2340229_+	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_002211615.1|2340409_2341381_+	glucokinase	NA	NA	NA	NA	NA
WP_002211614.1|2341458_2342706_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_002211613.1|2342971_2344207_+	alanine transaminase	NA	NA	NA	NA	NA
WP_002211611.1|2344451_2344976_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_002211610.1|2345070_2345502_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002215847.1|2346091_2346763_+	lipoprotein	NA	NA	NA	NA	NA
WP_002215846.1|2346789_2347146_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_002211607.1|2347142_2347799_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_002211606.1|2348044_2348614_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_002228419.1|2348610_2349207_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_002211604.1|2349688_2350465_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002211603.1|2350466_2351084_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211602.1|2351095_2353522_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.4	1.1e-255
WP_002211601.1|2354352_2355201_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002354621.1|2355430_2355910_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211599.1|2356376_2356901_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_002211598.1|2356973_2358023_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
WP_002215840.1|2358019_2359606_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211596.1|2359661_2360681_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211594.1|2361009_2362104_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_002211590.1|2363358_2363961_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215321.1|2364318_2364801_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_002211588.1|2364797_2366480_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002211587.1|2366480_2367164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211586.1|2367160_2368498_-	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
WP_002215319.1|2368537_2369569_-	fimbrial protein	NA	NA	NA	NA	NA
WP_002211584.1|2369575_2370757_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002211583.1|2370855_2371881_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211582.1|2371880_2373761_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002215317.1|2374543_2377219_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211580.1|2377419_2377965_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211579.1|2378121_2378883_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002215157.1|2379010_2380561_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|2380582_2381791_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 8
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	3219651	3319307	4662886	tRNA,integrase,transposase,tail,lysis	Escherichia_phage(13.21%)	103	3267003:3267033	3308726:3308756
WP_000255944.1|3219651_3220674_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3220673_3221453_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210659.1|3221821_3222412_-	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_002210661.1|3223161_3223560_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210664.1|3223994_3225341_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210665.1|3225647_3226664_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210666.1|3227997_3228462_+	YchJ family protein	NA	NA	NA	NA	NA
WP_002210667.1|3228545_3229415_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	5.5e-13
WP_002209743.1|3229377_3230586_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211665.1|3231457_3232318_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211667.1|3233127_3233934_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211668.1|3234031_3234418_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|3234430_3234721_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211670.1|3234717_3236643_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211671.1|3236704_3237751_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211673.1|3237975_3238527_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211674.1|3238689_3240540_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211675.1|3240656_3241673_+	asparaginase	NA	NA	NA	NA	NA
WP_002211676.1|3241687_3242335_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002217933.1|3242468_3242741_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002211677.1|3242811_3243225_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002224141.1|3243572_3244568_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211679.1|3244881_3245757_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002430110.1|3245829_3246579_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211681.1|3247022_3248957_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002216501.1|3249106_3250381_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211683.1|3250488_3251607_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211684.1|3251641_3252547_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211685.1|3252744_3253614_+	pirin family protein	NA	NA	NA	NA	NA
WP_002216508.1|3253878_3255081_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211686.1|3255096_3256401_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002211687.1|3256865_3258401_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211688.1|3258618_3259338_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211689.1|3259581_3261156_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002227934.1|3261391_3261922_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002214494.1|3262338_3262695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|3263786_3264527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211693.1|3264543_3265743_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002214492.1|3265746_3266919_+	MFS transporter	NA	NA	NA	NA	NA
3267003:3267033	attL	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002209743.1|3267223_3268432_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211695.1|3268652_3269072_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.0	5.7e-08
WP_002211696.1|3269082_3270000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211697.1|3270016_3271015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|3271014_3274218_-	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002359202.1|3274393_3274615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211699.1|3274583_3274748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|3274789_3275410_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211701.1|3275465_3275681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214482.1|3275823_3276375_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211704.1|3276473_3277481_-	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002211705.1|3277554_3277722_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211706.1|3277845_3278277_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211707.1|3278355_3278988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211708.1|3279248_3279959_-	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211709.1|3279961_3280714_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002213759.1|3280834_3281293_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211710.1|3281597_3281939_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002211711.1|3281941_3285445_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_071525538.1|3285445_3285706_-	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211712.1|3285753_3286065_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_002211713.1|3286077_3286998_-	Ig-like domain-containing protein	NA	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211714.1|3287063_3287471_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211715.1|3287467_3288052_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211716.1|3288053_3288404_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211717.1|3288405_3288660_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211718.1|3288656_3289139_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211719.1|3289186_3290392_-	Ig-like domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211720.1|3290405_3291179_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211721.1|3291300_3292413_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002228446.1|3292413_3293055_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002228445.1|3293073_3293802_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002211722.1|3293801_3294776_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002209743.1|3294780_3295989_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211723.1|3296036_3296621_-	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002211724.1|3296624_3297074_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211725.1|3297104_3297740_-	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211727.1|3298196_3298910_-	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211729.1|3299455_3299914_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211730.1|3299898_3300411_-	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002430108.1|3300441_3300639_-	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002215644.1|3300884_3301160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211731.1|3301156_3301366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|3301789_3302353_-	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002215638.1|3302401_3302620_-	ash family protein	NA	NA	NA	NA	NA
WP_002215636.1|3302623_3303013_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002211735.1|3303013_3303619_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002211736.1|3303692_3304139_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_071525537.1|3304114_3304864_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002215632.1|3305163_3305424_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_000255944.1|3306369_3307392_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211738.1|3307461_3308700_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_002211739.1|3308726_3309173_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
3308726:3308756	attR	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002211740.1|3309275_3309932_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002215627.1|3310002_3311088_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211743.1|3311228_3311501_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_002220631.1|3312221_3312908_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211179.1|3312932_3313745_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002211180.1|3313748_3314018_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211181.1|3314254_3315376_-	ribonuclease D	NA	NA	NA	NA	NA
WP_002211182.1|3315535_3317224_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	1.8e-31
WP_087768167.1|3317758_3317866_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002211183.1|3317866_3318472_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_002211184.1|3318608_3319307_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	3693982	3733067	4662886	coat,protease,transposase	Escherichia_phage(14.29%)	31	NA	NA
WP_000255944.1|3693982_3695005_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002209743.1|3696380_3697589_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|3697636_3697987_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|3698322_3699159_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|3699250_3700012_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210831.1|3700347_3702015_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210832.1|3702055_3702946_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|3702938_3703859_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|3703872_3705000_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|3705015_3706308_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|3706605_3707316_+	porin	NA	NA	NA	NA	NA
WP_002210837.1|3707795_3708344_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210838.1|3708547_3709939_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|3710153_3711005_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|3711389_3712181_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|3712367_3713534_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|3713860_3715228_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|3715281_3716085_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|3716081_3717245_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210844.1|3717241_3719854_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|3719935_3720715_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|3720867_3721410_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|3722067_3722949_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|3723422_3725495_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|3725514_3726228_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|3726323_3726821_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|3727052_3728300_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002216616.1|3728268_3730920_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|3731398_3731953_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|3731958_3732489_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|3732509_3733067_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 10
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	3804916	3862689	4662886	transposase,tRNA	uncultured_virus(27.27%)	54	NA	NA
WP_002210913.1|3804916_3806032_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002210914.1|3806089_3806716_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_002210915.1|3806776_3808147_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	2.0e-110
WP_002210916.1|3808334_3808958_+	porin family protein	NA	NA	NA	NA	NA
WP_002210917.1|3809168_3809840_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_002210918.1|3809845_3811300_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_002210919.1|3811383_3812505_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210920.1|3812737_3813973_-	peptidase T	NA	NA	NA	NA	NA
WP_002210921.1|3814302_3815139_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	2.6e-20
WP_002216178.1|3815187_3815340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002216175.1|3815332_3816103_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_002210922.1|3816121_3817369_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002210923.1|3817368_3818073_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	43.3	1.4e-35
WP_002222341.1|3818065_3819268_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_002210924.1|3819537_3822984_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002210925.1|3823222_3823762_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_001297096.1|3824889_3825669_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002209743.1|3826052_3827261_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002213101.1|3827356_3827770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215856.1|3827777_3828347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213097.1|3828884_3830189_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002213095.1|3830563_3831106_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002215854.1|3831233_3832253_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002213090.1|3832335_3833202_-	thiamine kinase	NA	NA	NA	NA	NA
WP_002213089.1|3833182_3833758_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_002213088.1|3833798_3834188_-	YcfL family protein	NA	NA	NA	NA	NA
WP_002213087.1|3834222_3834576_-	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_002215853.1|3834749_3835568_-	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002213759.1|3836010_3836469_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002213085.1|3836658_3838092_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002213084.1|3838397_3839207_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002213083.1|3839221_3840244_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_002213082.1|3840243_3840882_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	4.6e-25
WP_002217396.1|3840871_3841897_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002213080.1|3842185_3842992_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_002213775.1|3843407_3843866_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213079.1|3844065_3845307_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_002220787.1|3845401_3845638_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	7.7e-10
WP_002210935.1|3845791_3846526_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	7.7e-16
WP_002210934.1|3846539_3847469_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002210933.1|3847506_3848457_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002210932.1|3848463_3849498_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002210931.1|3849531_3849699_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002210930.1|3849711_3850236_-	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_002210928.1|3850377_3850974_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002213759.1|3851128_3851587_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210927.1|3851806_3852769_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_002354074.1|3853352_3857009_+	ribonuclease E	NA	NA	NA	NA	NA
WP_002209743.1|3857104_3858313_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002213107.1|3858589_3858877_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002213109.1|3859111_3860158_+	dihydroorotase	NA	NA	NA	NA	NA
WP_002213110.1|3860470_3860716_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	51.3	2.6e-13
WP_002217041.1|3861221_3861518_+	biofilm formation regulator BssS	NA	NA	NA	NA	NA
WP_002209743.1|3861480_3862689_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 11
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	3938550	4050893	4662886	transposase,tRNA,plate,protease,lysis	Escherichia_phage(20.0%)	89	NA	NA
WP_002211870.1|3938550_3940578_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002213775.1|3940741_3941200_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_042593110.1|3941310_3942333_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	6.0e-200
WP_001297096.1|3942332_3943112_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002228565.1|3943376_3944039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|3944736_3945813_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211974.1|3945830_3947084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211973.1|3947416_3948598_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211971.1|3948839_3949247_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211970.1|3949243_3949939_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211969.1|3950264_3951149_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211968.1|3951504_3953202_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211966.1|3953482_3954220_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002211965.1|3954664_3955675_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_002211964.1|3955695_3957216_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
WP_002215885.1|3957445_3958453_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211961.1|3959200_3960367_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211960.1|3960421_3961084_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|3961267_3962419_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|3962554_3963424_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211957.1|3963697_3964837_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	5.2e-35
WP_002211956.1|3964857_3965700_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002227980.1|3965956_3966169_+	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002215886.1|3966252_3968613_+	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002211952.1|3968614_3969877_+	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211951.1|3969878_3970547_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_002211950.1|3970556_3971867_+	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211949.1|3972401_3973676_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211948.1|3973677_3974448_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002209743.1|3974583_3975792_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211947.1|3975835_3976489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|3976716_3978312_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211945.1|3978994_3979618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211944.1|3979829_3981197_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002211943.1|3981221_3981674_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002214552.1|3981673_3982255_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211941.1|3982229_3983315_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211940.1|3983278_3985042_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211939.1|3985262_3985718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211938.1|3985732_3986791_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002211937.1|3986808_3988410_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002211936.1|3988453_3991876_-	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211935.1|3991872_3993105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214564.1|3995269_3995740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211932.1|3995912_3998096_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211931.1|3998111_3998372_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002211930.1|3998525_3999299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211929.1|3999295_4001596_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211928.1|4001611_4003960_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_002211927.1|4003962_4006605_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	1.6e-92
WP_002210014.1|4006992_4007484_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002214568.1|4007487_4009224_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210015.1|4009223_4009910_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002213011.1|4009906_4011259_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002214707.1|4011270_4012821_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213014.1|4012863_4013364_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002213016.1|4014352_4015201_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213017.1|4015299_4015548_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_002228570.1|4015585_4016026_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213024.1|4016112_4016901_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213025.1|4016903_4017656_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213026.1|4017657_4018377_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213028.1|4018369_4019608_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|4019623_4020361_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213032.1|4020362_4021646_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213034.1|4021635_4022160_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213036.1|4022423_4022642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213038.1|4023372_4024119_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213039.1|4024272_4026690_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213046.1|4030335_4030665_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213049.1|4030716_4030995_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002213052.1|4031088_4032279_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213054.1|4032339_4032657_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213056.1|4032765_4033182_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213058.1|4033497_4034178_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213060.1|4034356_4034821_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213061.1|4034881_4036867_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	28.4	5.3e-19
WP_002213062.1|4037060_4037507_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002213063.1|4037536_4039675_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213064.1|4039776_4040412_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213065.1|4040640_4041147_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213066.1|4041504_4042566_+	porin OmpA	NA	NA	NA	NA	NA
WP_002213775.1|4042755_4043214_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002226586.1|4043382_4043838_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002224683.1|4044048_4045800_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002220006.1|4045868_4046387_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002211286.1|4046652_4046841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|4047474_4048497_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213775.1|4050434_4050893_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	4249101	4305619	4662886	transposase,tail,plate,protease,coat	Pseudomonas_phage(22.73%)	50	NA	NA
WP_002213775.1|4249101_4249560_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208835.1|4249760_4250765_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002208836.1|4250942_4251170_+	YejL family protein	NA	NA	NA	NA	NA
WP_002208837.1|4251197_4252994_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002230704.1|4253224_4253608_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208839.1|4253964_4255113_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_002208840.1|4255125_4255614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208841.1|4256313_4256676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208842.1|4256801_4258238_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208843.1|4258528_4259269_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208845.1|4259566_4260346_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208846.1|4260442_4260790_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002215458.1|4260786_4261047_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208847.1|4261043_4262180_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002208848.1|4262183_4262639_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002215460.1|4262635_4263232_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208850.1|4263247_4264303_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208852.1|4264299_4265706_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208853.1|4265972_4267466_-|coat	coat protein	coat	NA	NA	NA	NA
WP_002208854.1|4267586_4267886_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208855.1|4267887_4268256_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_002208856.1|4268277_4269786_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208857.1|4269782_4269977_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208858.1|4269981_4270599_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208859.1|4270644_4270935_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208860.1|4271548_4272343_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208861.1|4272318_4273131_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208862.1|4273839_4275144_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002215470.1|4275354_4275834_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208864.1|4276107_4276830_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002208866.1|4277035_4277278_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208867.1|4277449_4278385_+	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208868.1|4278806_4280594_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208869.1|4280667_4281696_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208870.1|4282072_4283599_+	MFS transporter	NA	NA	NA	NA	NA
WP_002228026.1|4283873_4285040_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002213759.1|4285829_4286288_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002213775.1|4286540_4286999_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210826.1|4287200_4288316_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002210825.1|4289418_4290573_+	MFS transporter	NA	NA	NA	NA	NA
WP_002216093.1|4290596_4292549_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002216094.1|4292716_4293289_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_002210824.1|4293291_4293945_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002228028.1|4294012_4296886_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210821.1|4297073_4299749_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_002210820.1|4300010_4300739_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210818.1|4301232_4303521_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210817.1|4303683_4304814_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210816.1|4304817_4305075_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210815.1|4305109_4305619_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 13
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	4346190	4391622	4662886	transposase,holin,tRNA,protease	Planktothrix_phage(20.0%)	43	NA	NA
WP_002228612.1|4346190_4347129_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210776.1|4347428_4348358_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002213775.1|4348772_4349231_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002214195.1|4350159_4351023_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|4351368_4352217_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|4352254_4353148_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|4353379_4355428_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|4355792_4356389_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002218281.1|4356446_4357919_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002220180.1|4357941_4359645_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002213775.1|4359873_4360332_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210775.1|4360566_4361277_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002210774.1|4361419_4361872_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_002210773.1|4361874_4362120_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_002210772.1|4362116_4362596_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_002210771.1|4362696_4363677_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_002210769.1|4364208_4365132_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.8	3.7e-23
WP_002210768.1|4365262_4365508_-	VF530 family DNA-binding protein	NA	NA	NA	NA	NA
WP_002210767.1|4365799_4367815_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_002210766.1|4368904_4369615_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.3	3.5e-13
WP_002216554.1|4369766_4370489_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_002210764.1|4370481_4371285_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_002210763.1|4371268_4372420_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_002210762.1|4372419_4373457_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_002210761.1|4373555_4374824_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.1	2.4e-17
WP_002210760.1|4375008_4376013_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_002210759.1|4376303_4377125_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_002210758.1|4377180_4378260_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.4e-21
WP_002210757.1|4378253_4378949_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002210756.1|4378948_4379728_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002217291.1|4379962_4380115_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_002210754.1|4380431_4381223_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002210753.1|4381332_4382823_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.8	2.8e-12
WP_002210751.1|4383039_4383858_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002210750.1|4384217_4385234_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.8	3.0e-79
WP_002210749.1|4385243_4386296_+	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002210748.1|4386292_4387444_+	galactokinase	NA	NA	NA	NA	NA
WP_002216814.1|4387437_4387590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216812.1|4387610_4388507_+	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_002210747.1|4388799_4389135_+	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_002210746.1|4389481_4390234_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002210745.1|4390415_4390541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042593111.1|4390599_4391622_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	4.1e-201
>prophage 14
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	4431907	4438079	4662886	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_002210709.1|4431907_4432108_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|4432107_4432650_+	ash family protein	NA	NA	NA	NA	NA
WP_002215950.1|4432642_4433602_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002210707.1|4433598_4434687_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|4435035_4435350_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|4435355_4435673_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_000255944.1|4436277_4437300_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|4437299_4438079_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 15
NZ_CP009785	Yersinia pestis strain El Dorado chromosome, complete genome	4662886	4580243	4656070	4662886	plate,tRNA,protease,transposase	Escherichia_phage(22.22%)	57	NA	NA
WP_002215902.1|4580243_4580894_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215900.1|4581344_4581740_+	lipoprotein	NA	NA	NA	NA	NA
WP_002211661.1|4582658_4582814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211662.1|4584015_4584516_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215896.1|4584558_4586103_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|4586114_4587467_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|4587463_4588150_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|4588149_4589886_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|4589889_4590381_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002210013.1|4590798_4593447_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_002210012.1|4593443_4595792_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_002210011.1|4595806_4598029_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_016590715.1|4598172_4598520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216110.1|4598683_4598878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210010.1|4600102_4600738_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210009.1|4600753_4603051_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|4603037_4603805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016632.1|4603900_4604597_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210005.1|4605205_4605841_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|4607169_4609332_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210001.1|4609887_4610847_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210000.1|4610892_4612392_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002209999.1|4612424_4613408_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209998.1|4613490_4615524_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209997.1|4615627_4616728_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209995.1|4617027_4618104_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002209994.1|4618286_4618559_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002228057.1|4618736_4619852_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209991.1|4620189_4620909_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002209990.1|4620908_4621235_+	YggL family protein	NA	NA	NA	NA	NA
WP_002209989.1|4621345_4622272_+	glutaminase B	NA	NA	NA	NA	NA
WP_002228656.1|4622383_4622914_+	DUF2884 family protein	NA	NA	NA	NA	NA
WP_011566213.1|4622871_4623117_+	DUF2884 family protein	NA	NA	NA	NA	NA
WP_002224905.1|4623616_4632949_+	phage minor structural protein	NA	NA	NA	NA	NA
WP_002209987.1|4633138_4634269_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002215614.1|4634261_4634855_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002215612.1|4634954_4635245_-	YggU family protein	NA	NA	NA	NA	NA
WP_002209984.1|4635241_4635796_-	YggT family protein	NA	NA	NA	NA	NA
WP_002209983.1|4636083_4636905_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002215609.1|4637037_4637736_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209981.1|4637755_4638880_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002209980.1|4638988_4640104_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209979.1|4640107_4640992_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209978.1|4641171_4641594_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209977.1|4641593_4642157_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209976.1|4642272_4643232_-	glutathione synthase	NA	NA	NA	NA	NA
WP_002209975.1|4643257_4643989_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209973.1|4644240_4644948_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002228059.1|4645045_4645558_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|4645750_4646905_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|4648111_4650091_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209968.1|4650250_4650571_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_071525520.1|4650604_4650715_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209967.1|4650860_4651613_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209965.1|4652103_4654098_+	transketolase	NA	NA	NA	NA	NA
WP_002213759.1|4654405_4654864_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_000255944.1|4655047_4656070_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 1
NZ_CP009783	Yersinia pestis strain El Dorado plasmid pCD, complete sequence	70305	2203	57770	70305	transposase	Enterobacteria_phage(33.33%)	58	NA	NA
WP_116442925.1|2203_2449_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002222517.1|2690_3983_-	T3SS effector E3 ubiquitin ligase YopM	NA	NA	NA	NA	NA
WP_002229781.1|4313_4523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212987.1|5648_6569_-	type III secretion system translocon subunit YopD	NA	NA	NA	NA	NA
WP_002212985.1|6587_7793_-	type III secretion system translocon subunit YopB	NA	NA	NA	NA	NA
WP_002222758.1|7770_8277_-	type III secretion system chaperone SycD/LcrH	NA	NA	NA	NA	NA
WP_002212981.1|8289_9270_-	type III secretion system needle tip protein LcrV	NA	NA	NA	NA	NA
WP_002212973.1|9271_9559_-	type III secretion system chaperone LcrG	NA	NA	NA	NA	NA
WP_002220918.1|9600_10041_-	type III secretion system chaperone LcrR	NA	NA	NA	NA	NA
WP_002212971.1|10037_12152_-	SctV family type III secretion system export apparatus subunit LcrD	NA	NA	NA	NA	NA
WP_002229791.1|12138_12483_-	type III secretion system chaperone YscY	NA	NA	NA	NA	NA
WP_002212969.1|12479_12848_-	type III secretion system protein YscX	NA	NA	NA	NA	NA
WP_002229794.1|12844_13216_-	type III secretion chaperone SycN	NA	NA	NA	NA	NA
WP_002212965.1|13202_13481_-	type III secretion system gatekeeper subunit TyeA	NA	NA	NA	NA	NA
WP_002212958.1|13461_14343_-	SctW family type III secretion system gatekeeper subunit YopN	NA	NA	NA	NA	NA
WP_002212955.1|14540_15860_+	SctN family type III secretion system ATPase YscN	NA	NA	NA	NA	NA
WP_002212952.1|15856_16321_+	type III secretion system central stalk protein YscO	NA	NA	NA	NA	NA
WP_002212950.1|16320_17688_+	type III secretion system needle length determinant YscP	NA	NA	NA	NA	NA
WP_002212948.1|17684_18608_+	SctQ family type III secretion system cytoplasmic ring protein YscQ	NA	NA	NA	NA	NA
WP_002212947.1|18604_19258_+	SctR family type III secretion system export apparatus subunit YscR	NA	NA	NA	NA	NA
WP_002212945.1|19259_19526_+	SctS family type III secretion system export apparatus subunit YscS	NA	NA	NA	NA	NA
WP_002212938.1|19522_20308_+	SctT family type III secretion system export apparatus subunit YscT	NA	NA	NA	NA	NA
WP_002212936.1|20307_21372_+	type III secretion system export apparatus switch protein YscU	NA	NA	NA	NA	NA
WP_002222527.1|21947_22343_+	type III secretion system pilotin YscW	NA	NA	NA	NA	NA
WP_002212931.1|22466_23282_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002229797.1|23360_23459_+	type III secretion system protein YscA	NA	NA	NA	NA	NA
WP_002212925.1|23684_24098_+	type III secretion system chaperone YscB	NA	NA	NA	NA	NA
WP_002212923.1|24103_25927_+	SctC family type III secretion system outer membrane ring subunit YscC	NA	NA	NA	NA	NA
WP_002212919.1|25923_27183_+	SctD family type III secretion system inner membrane ring subunit YscD	NA	NA	NA	NA	NA
WP_002212917.1|27179_27380_+	type III secretion system co-chaperone YscE	NA	NA	NA	NA	NA
WP_002212916.1|27380_27644_+	type III secretion system needle filament protein YscF	NA	NA	NA	NA	NA
WP_002229801.1|27645_27993_+	type III secretion system chaperone YscG	NA	NA	NA	NA	NA
WP_002212915.1|27989_28487_+	T3SS polymerization control protein YopR	NA	NA	NA	NA	NA
WP_002212914.1|28487_28835_+	SctI family type III secretion system inner rod subunit LcrO	NA	NA	NA	NA	NA
WP_002212912.1|28841_29576_+	SctJ family type III secretion inner membrane ring lipoprotein YscJ	NA	NA	NA	NA	NA
WP_002361471.1|29575_30205_+	type III secretion system sorting platform protein YscK	NA	NA	NA	NA	NA
WP_010981371.1|30150_30816_+	SctL family type III secretion system stator protein YscL	NA	NA	NA	NA	NA
WP_002212907.1|31040_31388_+	type III secretion system exported negative regulator LcrQ/YscM1	NA	NA	NA	NA	NA
WP_002213278.1|33476_34883_-	T3SS effector protein-tyrosine-phosphatase YopH	NA	NA	NA	NA	NA
WP_002213287.1|36565_37432_-	type III secretion system effector acetyltransferase YopJ	NA	NA	NA	NA	NA
WP_002213290.1|37827_40026_-	T3SS effector protein kinase YopO/YpkA	NA	NA	NA	NA	NA
WP_002229809.1|40033_40483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213291.1|41228_41468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213292.1|42645_43524_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_002233140.1|43504_43579_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_002229817.1|43820_44075_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_002233137.1|44212_44461_-	phospholipase	NA	A0A1B2LRT6	Wolbachia_phage	47.1	9.2e-06
WP_002213294.1|44877_45285_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	4.7e-07
WP_002213244.1|45308_45626_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|45797_46256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469136.1|46324_46594_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213256.1|49205_51521_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
WP_002213258.1|51684_52236_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002224338.1|52254_52719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229829.1|52857_53187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016640.1|53286_54385_+|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002213267.1|54533_54959_-	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_000255944.1|56747_57770_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 1
NZ_CP009784	Yersinia pestis strain El Dorado plasmid pMT, complete sequence	96921	454	72232	96921	transposase,integrase,terminase,tail	Salmonella_phage(84.85%)	72	344:357	6656:6669
344:357	attL	GTATGGAATCATTG	NA	NA	NA	NA
WP_002353208.1|454_1558_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002228802.1|1552_1939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228800.1|2201_2414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211766.1|2523_4890_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002211767.1|4986_6222_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_023278042.1|9529_10552_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
6656:6669	attR	GTATGGAATCATTG	NA	NA	NA	NA
WP_001297096.1|10551_11331_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|11464_12073_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|12374_15263_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|15343_15922_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|15978_20610_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211773.1|20631_21219_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|21206_22004_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211775.1|21996_22695_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_000440566.1|22784_23120_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|23161_27739_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|27746_27971_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|28096_28414_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|28473_29220_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|29294_29678_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|29679_30153_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|30143_30488_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|30585_31419_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|31418_31853_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|31896_32559_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|32633_33509_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002211785.1|33535_34369_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	91.3	5.8e-137
WP_002211786.1|34391_35966_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	2.4e-301
WP_002211787.1|35999_37256_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|37258_37900_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|38095_38362_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|38371_39262_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|39267_39522_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|39514_40153_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|40149_40818_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|40817_41516_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|41580_43140_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|43142_43421_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|43480_43903_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|43907_44435_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|44756_45407_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|45491_45719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211801.1|46357_46840_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|47045_47327_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213759.1|47526_47985_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214145.1|48193_48763_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|48775_49522_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_002214148.1|49511_51428_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
WP_002213300.1|51657_52743_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002213298.1|53158_54181_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002214160.1|54540_55185_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
WP_002214164.1|55929_56994_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|57562_57775_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|57774_58110_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|58106_58286_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|58326_58602_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|58669_59080_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|59063_59435_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|59588_60419_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|60422_60623_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_000920226.1|61792_62059_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|62058_63003_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|63063_64092_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|64211_64643_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|64863_65115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|65187_65751_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|65780_66206_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_001297096.1|66775_67555_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|67554_68577_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211744.1|68700_70710_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_002211745.1|70782_71013_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211746.1|71725_72232_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
