The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009723	Yersinia pestis strain Shasta chromosome, complete genome	4659530	214066	268598	4659530	tRNA,transposase	Escherichia_phage(53.85%)	48	NA	NA
WP_002213775.1|214066_214525_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002216011.1|214775_215780_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002209424.1|215940_216750_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002209426.1|217452_218148_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_002209427.1|218610_221061_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	1.2e-219
WP_002209428.1|221072_221690_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	1.8e-74
WP_002209429.1|221691_222552_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	33.7	7.6e-23
WP_002209430.1|222697_223408_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.5	4.8e-23
WP_002215100.1|223664_224195_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	42.1	1.6e-15
WP_002215101.1|224342_224726_-	cytochrome b562	NA	NA	NA	NA	NA
WP_002209433.1|224802_227016_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_002209434.1|227551_228493_+	D-ribose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209435.1|228585_229203_+	DUF2291 family protein	NA	NA	NA	NA	NA
WP_002209436.1|229202_230726_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	9.1e-19
WP_002209437.1|230722_231868_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209438.1|232123_232954_+	transketolase	NA	NA	NA	NA	NA
WP_002209439.1|232946_233891_+	transketolase family protein	NA	NA	NA	NA	NA
WP_002209440.1|233893_235381_+	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_002209441.1|235401_236826_+	fucose isomerase	NA	NA	NA	NA	NA
WP_002209443.1|237047_237992_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002209444.1|238239_239580_-	MFS transporter	NA	NA	NA	NA	NA
WP_002209445.1|239896_240385_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.0	2.6e-28
WP_002209446.1|240499_241570_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.3	4.1e-111
WP_002209447.1|241707_242271_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002209448.1|242410_245038_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.3	1.8e-78
WP_002209449.1|245287_245473_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_002209450.1|246897_247464_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_002209451.1|247460_247889_+	DedA family protein	NA	NA	NA	NA	NA
WP_002209452.1|247932_249531_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_002209453.1|249698_250214_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_002213775.1|250417_250876_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213759.1|251128_251587_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002354744.1|251724_253005_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002209455.1|253076_253868_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002209456.1|254033_255395_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002209458.1|255622_255871_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002209459.1|255892_256441_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002222284.1|256479_257220_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002209461.1|257300_257648_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002213759.1|257859_258318_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209462.1|258620_259388_-	YdiY family protein	NA	NA	NA	NA	NA
WP_002209463.1|261483_262200_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002228238.1|262432_263503_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	1.5e-89
WP_002209465.1|263515_264637_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002209466.1|264741_264960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|265036_265816_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_042593132.1|265883_266837_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-179
WP_002213775.1|268139_268598_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP009723	Yersinia pestis strain Shasta chromosome, complete genome	4659530	583075	651887	4659530	tRNA,transposase,plate	Escherichia_phage(38.46%)	60	NA	NA
WP_002213759.1|583075_583534_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208491.1|583676_584186_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002208490.1|584234_585962_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	3.0e-18
WP_002208488.1|586010_586268_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002222180.1|586766_587735_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.8	4.8e-74
WP_002213487.1|587891_588626_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002227089.1|588874_589861_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002213368.1|589951_591964_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.2	1.7e-142
WP_002213369.1|591983_592199_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_002213372.1|592299_592647_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_002213374.1|592778_593384_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_002213775.1|594097_594556_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002222185.1|594748_596164_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002211622.1|597277_598462_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_002211621.1|598896_600126_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_002216909.1|600218_600632_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002211618.1|600802_601792_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002211617.1|601927_602806_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211616.1|602908_603385_+	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_002211615.1|603565_604537_+	glucokinase	NA	NA	NA	NA	NA
WP_002211614.1|604614_605862_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_002211613.1|606127_607363_+	alanine transaminase	NA	NA	NA	NA	NA
WP_002211611.1|607607_608132_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_002211610.1|608226_608658_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002215847.1|609247_609919_+	lipoprotein	NA	NA	NA	NA	NA
WP_002215846.1|609945_610302_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_002211607.1|610298_610955_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_002211606.1|611200_611770_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_002228419.1|611766_612363_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_002211604.1|612844_613621_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002211603.1|613622_614240_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211602.1|614251_616678_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.4	1.1e-255
WP_002211601.1|617508_618357_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002354621.1|618586_619066_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211599.1|619532_620057_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_002211598.1|620129_621179_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
WP_002215840.1|621175_622762_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211596.1|622817_623837_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211594.1|624165_625260_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_002211590.1|626514_627117_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215321.1|627474_627957_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_002211588.1|627953_629636_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002211587.1|629636_630320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211586.1|630316_631654_-	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
WP_002215319.1|631693_632725_-	fimbrial protein	NA	NA	NA	NA	NA
WP_002211584.1|632731_633913_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002211583.1|634011_635037_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211582.1|635036_636917_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002215317.1|637699_640375_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211580.1|640575_641121_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211579.1|641277_642039_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002215157.1|642166_643717_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|643738_644947_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211577.1|644971_646162_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211576.1|646146_646755_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211575.1|646859_647384_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211574.1|647407_648910_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211573.1|649235_649721_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211572.1|649994_650534_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211571.1|650537_651887_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 3
NZ_CP009723	Yersinia pestis strain Shasta chromosome, complete genome	4659530	1486190	1585846	4659530	tRNA,transposase,lysis,integrase,tail	Escherichia_phage(14.81%)	105	1533542:1533572	1575265:1575295
WP_001618661.1|1486190_1487213_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	2.0e-200
WP_042593139.1|1487212_1487992_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_002210659.1|1488360_1488951_-	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_002210661.1|1489700_1490099_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210664.1|1490533_1491880_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210665.1|1492186_1493203_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210666.1|1494536_1495001_+	YchJ family protein	NA	NA	NA	NA	NA
WP_002210667.1|1495084_1495954_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	5.5e-13
WP_002209743.1|1495916_1497125_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211665.1|1497996_1498857_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211667.1|1499666_1500473_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211668.1|1500570_1500957_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|1500969_1501260_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211670.1|1501256_1503182_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211671.1|1503243_1504290_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211673.1|1504514_1505066_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211674.1|1505228_1507079_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211675.1|1507195_1508212_+	asparaginase	NA	NA	NA	NA	NA
WP_002211676.1|1508226_1508874_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002217933.1|1509007_1509280_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002211677.1|1509350_1509764_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002224141.1|1510111_1511107_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211679.1|1511420_1512296_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002430110.1|1512368_1513118_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211681.1|1513561_1515496_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002216501.1|1515645_1516920_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211683.1|1517027_1518146_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211684.1|1518180_1519086_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211685.1|1519283_1520153_+	pirin family protein	NA	NA	NA	NA	NA
WP_002216508.1|1520417_1521620_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211686.1|1521635_1522940_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002211687.1|1523404_1524940_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211688.1|1525157_1525877_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211689.1|1526120_1527695_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002227934.1|1527930_1528461_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002214494.1|1528877_1529234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|1530325_1531066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211693.1|1531082_1532282_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002214492.1|1532285_1533458_+	MFS transporter	NA	NA	NA	NA	NA
1533542:1533572	attL	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002209743.1|1533762_1534971_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211695.1|1535191_1535611_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.0	5.7e-08
WP_002211696.1|1535621_1536539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211697.1|1536555_1537554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|1537553_1540757_-	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002359202.1|1540932_1541154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211699.1|1541122_1541287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|1541328_1541949_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211701.1|1542004_1542220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214482.1|1542362_1542914_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211704.1|1543012_1544020_-	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002211705.1|1544093_1544261_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211706.1|1544384_1544816_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211707.1|1544894_1545527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211708.1|1545787_1546498_-	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211709.1|1546500_1547253_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002214658.1|1547373_1547751_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_002211710.1|1548135_1548477_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002211711.1|1548479_1551983_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_071525538.1|1551983_1552244_-	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211712.1|1552291_1552603_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_002211713.1|1552615_1553536_-	Ig-like domain-containing protein	NA	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211714.1|1553601_1554009_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211715.1|1554005_1554590_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211716.1|1554591_1554942_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211717.1|1554943_1555198_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211718.1|1555194_1555677_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211719.1|1555724_1556930_-	Ig-like domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211720.1|1556943_1557717_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211721.1|1557838_1558951_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002228446.1|1558951_1559593_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002228445.1|1559611_1560340_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002211722.1|1560339_1561314_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002209743.1|1561318_1562527_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211723.1|1562574_1563159_-	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002211724.1|1563162_1563612_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211725.1|1563642_1564278_-	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211727.1|1564734_1565448_-	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211729.1|1565993_1566452_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211730.1|1566436_1566949_-	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002430108.1|1566979_1567177_-	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002215644.1|1567422_1567698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211731.1|1567694_1567904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002393183.1|1568066_1568243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|1568327_1568891_-	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002215638.1|1568939_1569158_-	ash family protein	NA	NA	NA	NA	NA
WP_002215636.1|1569161_1569551_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002211735.1|1569551_1570157_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002211736.1|1570230_1570677_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_071525537.1|1570652_1571402_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002215632.1|1571701_1571962_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_001297096.1|1572129_1572909_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1572908_1573931_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211738.1|1574000_1575239_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_002211739.1|1575265_1575712_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
1575265:1575295	attR	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002211740.1|1575814_1576471_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002215627.1|1576541_1577627_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211743.1|1577767_1578040_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_002220631.1|1578760_1579447_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211179.1|1579471_1580284_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002211180.1|1580287_1580557_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211181.1|1580793_1581915_-	ribonuclease D	NA	NA	NA	NA	NA
WP_002211182.1|1582074_1583763_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	1.8e-31
WP_087768167.1|1584297_1584405_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002211183.1|1584405_1585011_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_002211184.1|1585147_1585846_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP009723	Yersinia pestis strain Shasta chromosome, complete genome	4659530	1960563	1999648	4659530	coat,protease,transposase	Escherichia_phage(14.29%)	31	NA	NA
WP_000255944.1|1960563_1961586_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002209743.1|1962961_1964170_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|1964217_1964568_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|1964903_1965740_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|1965831_1966593_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210831.1|1966928_1968596_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210832.1|1968636_1969527_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|1969519_1970440_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|1970453_1971581_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|1971596_1972889_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|1973186_1973897_+	porin	NA	NA	NA	NA	NA
WP_002210837.1|1974376_1974925_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210838.1|1975128_1976520_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|1976734_1977586_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|1977970_1978762_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|1978948_1980115_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|1980441_1981809_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|1981862_1982666_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|1982662_1983826_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210844.1|1983822_1986435_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|1986516_1987296_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|1987448_1987991_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|1988648_1989530_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|1990003_1992076_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|1992095_1992809_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|1992904_1993402_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|1993633_1994881_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002216616.1|1994849_1997501_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|1997979_1998534_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|1998539_1999070_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|1999090_1999648_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 5
NZ_CP009723	Yersinia pestis strain Shasta chromosome, complete genome	4659530	2071513	2124909	4659530	tRNA,transposase	Escherichia_phage(20.0%)	50	NA	NA
WP_002210913.1|2071513_2072629_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002210914.1|2072686_2073313_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_002210915.1|2073373_2074744_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.8	2.0e-110
WP_002210916.1|2074931_2075555_+	porin family protein	NA	NA	NA	NA	NA
WP_002210917.1|2075765_2076437_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_002210918.1|2076442_2077897_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_002210919.1|2077980_2079102_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210920.1|2079334_2080570_-	peptidase T	NA	NA	NA	NA	NA
WP_002210921.1|2080899_2081736_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	2.6e-20
WP_002216178.1|2081784_2081937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002216175.1|2081929_2082700_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_002210922.1|2082718_2083966_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_002210923.1|2083965_2084670_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	43.3	1.4e-35
WP_002222341.1|2084662_2085865_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_002210924.1|2086134_2089581_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002210925.1|2089819_2090359_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_000255944.1|2090463_2091486_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2091485_2092265_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002209743.1|2092648_2093857_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002354074.1|2093952_2097609_-	ribonuclease E	NA	NA	NA	NA	NA
WP_002210927.1|2098192_2099155_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_002213759.1|2099374_2099833_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210928.1|2099987_2100584_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002210930.1|2100725_2101250_+	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_002210931.1|2101262_2101430_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002210932.1|2101463_2102498_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002210933.1|2102504_2103455_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002210934.1|2103492_2104422_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002210935.1|2104435_2105170_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	7.7e-16
WP_002220787.1|2105323_2105560_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	7.7e-10
WP_002213079.1|2105654_2106896_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_002213775.1|2107095_2107554_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213080.1|2107969_2108776_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_002217396.1|2109064_2110090_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002213082.1|2110079_2110718_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	4.6e-25
WP_002213083.1|2110717_2111740_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_002213084.1|2111754_2112564_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002213085.1|2112869_2114303_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002213759.1|2114492_2114951_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002215853.1|2115393_2116212_+	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002213087.1|2116385_2116739_+	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_002213088.1|2116773_2117163_+	YcfL family protein	NA	NA	NA	NA	NA
WP_002213089.1|2117203_2117779_+	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_002213090.1|2117759_2118626_+	thiamine kinase	NA	NA	NA	NA	NA
WP_002215854.1|2118708_2119728_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002213095.1|2119855_2120398_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002213097.1|2120772_2122077_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002215856.1|2122614_2123184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213101.1|2123191_2123605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|2123700_2124909_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 6
NZ_CP009723	Yersinia pestis strain Shasta chromosome, complete genome	4659530	2205146	2251636	4659530	lysis,tRNA,plate,transposase	Indivirus(14.29%)	36	NA	NA
WP_002211870.1|2205146_2207174_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002213775.1|2207337_2207796_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228565.1|2209970_2210633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|2211330_2212407_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211974.1|2212424_2213678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211973.1|2214010_2215192_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211971.1|2215433_2215841_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211970.1|2215837_2216533_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211969.1|2216858_2217743_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211968.1|2218098_2219796_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211966.1|2220076_2220814_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002211965.1|2221258_2222269_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_002211964.1|2222289_2223810_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
WP_002215885.1|2224039_2225047_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211961.1|2225794_2226961_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211960.1|2227015_2227678_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|2227861_2229013_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|2229148_2230018_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211957.1|2230291_2231431_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	5.2e-35
WP_002211956.1|2231451_2232294_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002227980.1|2232550_2232763_+	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002215886.1|2232846_2235207_+	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002211952.1|2235208_2236471_+	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211951.1|2236472_2237141_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_002211950.1|2237150_2238461_+	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211949.1|2238995_2240270_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211948.1|2240271_2241042_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002209743.1|2241177_2242386_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211947.1|2242429_2243083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|2243310_2244906_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211945.1|2245588_2246212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211944.1|2246423_2247791_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002211943.1|2247815_2248268_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002214552.1|2248267_2248849_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211941.1|2248823_2249909_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211940.1|2249872_2251636_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NZ_CP009723	Yersinia pestis strain Shasta chromosome, complete genome	4659530	2276500	2343165	4659530	protease,tRNA,transposase,plate	Streptococcus_phage(20.0%)	56	NA	NA
WP_002213011.1|2276500_2277853_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002214707.1|2277864_2279415_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213014.1|2279457_2279958_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002213016.1|2280946_2281795_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213017.1|2281893_2282142_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_002228570.1|2282179_2282620_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213024.1|2282706_2283495_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213025.1|2283497_2284250_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213026.1|2284251_2284971_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213028.1|2284963_2286202_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|2286217_2286955_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213032.1|2286956_2288240_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213034.1|2288229_2288754_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213036.1|2289017_2289236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213038.1|2289966_2290713_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213039.1|2290866_2293284_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213046.1|2296929_2297259_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213049.1|2297310_2297589_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002213052.1|2297682_2298873_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213054.1|2298933_2299251_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213056.1|2299359_2299776_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213058.1|2300091_2300772_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213060.1|2300950_2301415_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213061.1|2301475_2303461_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	28.4	5.3e-19
WP_002213062.1|2303654_2304101_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002213063.1|2304130_2306269_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213064.1|2306370_2307006_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213065.1|2307234_2307741_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213066.1|2308098_2309160_+	porin OmpA	NA	NA	NA	NA	NA
WP_002213775.1|2309349_2309808_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002226586.1|2309976_2310432_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002224683.1|2310642_2312394_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002220006.1|2312462_2312981_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002211286.1|2313246_2313435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|2314068_2315091_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2315090_2315870_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213775.1|2317030_2317489_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228015.1|2317686_2317854_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_002211289.1|2318123_2318702_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002211290.1|2318698_2320351_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_002211291.1|2320337_2321624_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_002211292.1|2321752_2323666_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.5e-47
WP_002211293.1|2323671_2325792_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_002211294.1|2325891_2327004_+	YcbX family protein	NA	NA	NA	NA	NA
WP_002211295.1|2327029_2327581_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002211296.1|2327763_2328774_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002220013.1|2329400_2332016_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_002228013.1|2332731_2333937_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002211301.1|2334435_2335836_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_002354007.1|2336136_2337216_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	56.5	3.2e-111
WP_002211303.1|2337472_2338663_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002430096.1|2338816_2338933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211304.1|2339086_2339734_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	2.2e-22
WP_002211305.1|2339794_2340343_-	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_002217987.1|2340566_2342423_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002213759.1|2342706_2343165_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP009723	Yersinia pestis strain Shasta chromosome, complete genome	4659530	2515736	2572254	4659530	protease,coat,transposase,plate,tail	Pseudomonas_phage(22.73%)	50	NA	NA
WP_042593140.1|2515736_2516195_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208835.1|2516395_2517400_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002208836.1|2517577_2517805_+	YejL family protein	NA	NA	NA	NA	NA
WP_002208837.1|2517832_2519629_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002230704.1|2519859_2520243_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208839.1|2520599_2521748_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_002208840.1|2521760_2522249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208841.1|2522948_2523311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208842.1|2523436_2524873_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208843.1|2525163_2525904_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208845.1|2526201_2526981_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208846.1|2527077_2527425_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002215458.1|2527421_2527682_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208847.1|2527678_2528815_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002208848.1|2528818_2529274_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002215460.1|2529270_2529867_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208850.1|2529882_2530938_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208852.1|2530934_2532341_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208853.1|2532607_2534101_-|coat	coat protein	coat	NA	NA	NA	NA
WP_002208854.1|2534221_2534521_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208855.1|2534522_2534891_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_002208856.1|2534912_2536421_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208857.1|2536417_2536612_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208858.1|2536616_2537234_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208859.1|2537279_2537570_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208860.1|2538183_2538978_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208861.1|2538953_2539766_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208862.1|2540474_2541779_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002215470.1|2541989_2542469_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208864.1|2542742_2543465_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002208866.1|2543670_2543913_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208867.1|2544084_2545020_+	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208868.1|2545441_2547229_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208869.1|2547302_2548331_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208870.1|2548707_2550234_+	MFS transporter	NA	NA	NA	NA	NA
WP_002228026.1|2550508_2551675_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002213759.1|2552464_2552923_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002213775.1|2553175_2553634_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210826.1|2553835_2554951_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002210825.1|2556053_2557208_+	MFS transporter	NA	NA	NA	NA	NA
WP_002216093.1|2557231_2559184_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002216094.1|2559351_2559924_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_002210824.1|2559926_2560580_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002228028.1|2560647_2563521_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210821.1|2563708_2566384_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_002210820.1|2566645_2567374_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210818.1|2567867_2570156_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210817.1|2570318_2571449_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210816.1|2571452_2571710_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210815.1|2571744_2572254_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 9
NZ_CP009723	Yersinia pestis strain Shasta chromosome, complete genome	4659530	2612806	2658221	4659530	holin,protease,tRNA,transposase	Planktothrix_phage(20.0%)	43	NA	NA
WP_002228612.1|2612806_2613745_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210776.1|2614044_2614974_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002213775.1|2615388_2615847_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002214195.1|2616775_2617639_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|2617984_2618833_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|2618870_2619764_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|2619995_2622044_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|2622408_2623005_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002218281.1|2623062_2624535_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002220180.1|2624557_2626261_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002213775.1|2626489_2626948_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210775.1|2627182_2627893_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002210774.1|2628035_2628488_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_002210773.1|2628490_2628736_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_002210772.1|2628732_2629212_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_002210771.1|2629312_2630293_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_002210769.1|2630824_2631748_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	27.8	3.7e-23
WP_002210768.1|2631878_2632124_-	VF530 family DNA-binding protein	NA	NA	NA	NA	NA
WP_002210767.1|2632415_2634431_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_002210766.1|2635520_2636231_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.3	3.5e-13
WP_002216554.1|2636382_2637105_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_002210764.1|2637097_2637901_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_002210763.1|2637884_2639036_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_002210762.1|2639035_2640073_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_002210761.1|2640171_2641440_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.1	2.4e-17
WP_002210760.1|2641624_2642629_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_002210759.1|2642919_2643741_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_002210758.1|2643796_2644876_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.4e-21
WP_002210757.1|2644869_2645565_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002210756.1|2645564_2646344_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002217291.1|2646578_2646731_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_002210754.1|2647030_2647822_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002210753.1|2647931_2649422_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.8	2.8e-12
WP_002210751.1|2649638_2650457_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002210750.1|2650816_2651833_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.8	3.0e-79
WP_002210749.1|2651842_2652895_+	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002210748.1|2652891_2654043_+	galactokinase	NA	NA	NA	NA	NA
WP_002216814.1|2654036_2654189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216812.1|2654209_2655106_+	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_002210747.1|2655398_2655734_+	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_002210746.1|2656080_2656833_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002210745.1|2657014_2657140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|2657198_2658221_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 10
NZ_CP009723	Yersinia pestis strain Shasta chromosome, complete genome	4659530	2698609	2704781	4659530	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_002210709.1|2698609_2698810_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|2698809_2699352_+	ash family protein	NA	NA	NA	NA	NA
WP_002215950.1|2699344_2700304_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002210707.1|2700300_2701389_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|2701737_2702052_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|2702057_2702375_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_000255944.1|2702979_2704002_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2704001_2704781_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 11
NZ_CP009723	Yersinia pestis strain Shasta chromosome, complete genome	4659530	3320648	3398278	4659530	holin,transposase,plate	Escherichia_phage(27.27%)	58	NA	NA
WP_002210419.1|3320648_3321044_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002210420.1|3321040_3321325_+	YqjK-like family protein	NA	NA	NA	NA	NA
WP_002210421.1|3321628_3322024_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000255944.1|3322302_3323325_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3323324_3324104_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|3324365_3324752_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|3325046_3327761_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|3327838_3328372_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|3328400_3328925_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|3329091_3330012_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|3330111_3331263_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|3331335_3332592_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|3332618_3333446_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|3333447_3334368_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|3334360_3335836_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|3335973_3337044_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|3337040_3338243_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|3338242_3339559_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|3339561_3340644_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|3340637_3342014_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|3342010_3343498_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210440.1|3343484_3345248_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|3345313_3345631_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|3345627_3346590_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|3346592_3347051_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|3347605_3347695_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|3348152_3348593_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|3348723_3349734_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002210448.1|3350894_3351389_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002228103.1|3351391_3353119_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002216437.1|3353578_3355384_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|3355920_3356877_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|3357554_3357770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|3358198_3358657_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210453.1|3358803_3360366_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|3360368_3361460_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|3361461_3362892_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|3362906_3363509_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002397472.1|3363749_3364001_-	sugar transporter	NA	NA	NA	NA	NA
WP_000255944.1|3364088_3365111_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002210461.1|3367554_3369216_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|3370155_3371148_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|3371123_3372731_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|3372717_3373428_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|3373496_3374264_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|3374459_3376829_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|3377289_3380196_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|3380451_3380805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214734.1|3380826_3384267_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_002210469.1|3384328_3385939_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002210470.1|3385935_3387291_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|3387410_3387902_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|3387894_3388260_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|3388265_3388883_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|3388875_3389979_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|3392236_3394585_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|3394688_3397277_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|3397294_3398278_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 12
NZ_CP009723	Yersinia pestis strain Shasta chromosome, complete genome	4659530	4363450	4455584	4659530	transposase,plate	Escherichia_phage(15.38%)	59	NA	NA
WP_029788079.1|4363450_4363858_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_002211550.1|4364446_4365898_+	Trk system potassium transporter TrkH	NA	NA	NA	NA	NA
WP_002215920.1|4365919_4366453_+	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_002212288.1|4372589_4373627_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002212289.1|4373623_4374583_+	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_002212290.1|4374617_4375568_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.2	8.7e-28
WP_002355327.1|4375778_4376237_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042593151.1|4376419_4377442_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	2.4e-201
WP_001297096.1|4377441_4378221_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210669.1|4379277_4380462_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_002210670.1|4380712_4381096_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210671.1|4381097_4381643_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210672.1|4381833_4382262_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210673.1|4382265_4382970_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210674.1|4383334_4383832_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210675.1|4383898_4384267_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210676.1|4384609_4388638_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210677.1|4388766_4392987_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_002213775.1|4393113_4393572_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210678.1|4394003_4395134_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002217273.1|4395126_4395942_-	thiazole synthase	NA	NA	NA	NA	NA
WP_002217275.1|4395943_4396159_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002210680.1|4396155_4396953_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002210681.1|4396942_4397617_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210682.1|4397603_4399649_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210683.1|4400024_4400534_-	sigma D regulator	NA	NA	NA	NA	NA
WP_002210684.1|4400630_4401413_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210685.1|4401505_4402291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210686.1|4402409_4403477_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210687.1|4403506_4404247_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210688.1|4404292_4404883_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002210689.1|4405071_4405347_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002355296.1|4405396_4406050_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210691.1|4406197_4407484_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002210692.1|4407543_4409133_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002212076.1|4415976_4416906_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002212077.1|4417326_4418925_+	malate synthase A	NA	NA	NA	NA	NA
WP_002212078.1|4418971_4420279_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_002212079.1|4420534_4422262_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_002212080.1|4423440_4427136_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	4.6e-24
WP_002212081.1|4427231_4432139_-	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_002228189.1|4432208_4433894_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_002212084.1|4434461_4435847_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_002212085.1|4436216_4437863_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002212086.1|4437997_4438405_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_002212087.1|4438547_4439438_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_002212088.1|4439451_4441029_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_002212089.1|4441215_4442427_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_002221973.1|4442988_4443225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212091.1|4443228_4444338_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	5.0e-27
WP_002212092.1|4444408_4445680_+	maltoporin	NA	NA	NA	NA	NA
WP_002212093.1|4445920_4446832_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_002212095.1|4447302_4447581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212097.1|4447732_4448251_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002212098.1|4448774_4449272_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002212099.1|4449339_4450821_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002212100.1|4450827_4451268_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_100067904.1|4452383_4453738_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002213885.1|4454495_4455584_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 13
NZ_CP009723	Yersinia pestis strain Shasta chromosome, complete genome	4659530	4549798	4609473	4659530	holin,protease,transposase	Escherichia_phage(16.67%)	51	NA	NA
WP_002210082.1|4549798_4551244_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002210083.1|4551446_4554305_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210084.1|4554329_4557161_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210086.1|4557361_4557721_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_002210087.1|4557717_4558119_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
WP_002214300.1|4558131_4558434_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002210089.1|4558567_4563058_-	toxin	NA	NA	NA	NA	NA
WP_002229661.1|4563114_4565256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002229660.1|4565324_4566707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210090.1|4566747_4569249_-	toxin	NA	NA	NA	NA	NA
WP_002214297.1|4569484_4570351_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210092.1|4570611_4571523_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002210093.1|4571825_4572029_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002210094.1|4572036_4572972_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210095.1|4572973_4574929_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002214288.1|4576858_4577332_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210098.1|4577336_4577618_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002210099.1|4577729_4578278_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210100.1|4578458_4579799_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011055205.1|4580047_4580692_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210102.1|4580899_4581286_+	cytochrome b562	NA	NA	NA	NA	NA
WP_002210103.1|4581509_4581920_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210104.1|4582272_4583940_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002215779.1|4584034_4585450_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210106.1|4585860_4586814_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002210107.1|4587047_4587524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|4587639_4588419_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_042593152.1|4588418_4589441_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_002210109.1|4589781_4590168_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|4590305_4590770_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|4590781_4591717_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|4592054_4592327_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|4592323_4593178_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|4593483_4593966_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|4594394_4595828_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002210116.1|4595889_4596615_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|4596621_4597167_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|4597150_4597714_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|4597710_4598274_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|4598522_4599509_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002210120.1|4599619_4600594_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|4600858_4601677_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|4601894_4602677_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|4602681_4603239_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|4603251_4603875_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|4603910_4604213_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|4604359_4604614_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|4604767_4606030_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|4606210_4607299_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_042593153.1|4607524_4607983_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002218066.1|4608099_4609473_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
>prophage 1
NZ_CP009721	Yersinia pestis strain Shasta plasmid pCD, complete sequence	70305	19358	47235	70305	transposase,protease	Enterobacteria_phage(28.57%)	24	NA	NA
WP_002213294.1|19358_19766_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	4.7e-07
WP_002213244.1|19789_20107_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|20278_20737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469136.1|20805_21075_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213256.1|23686_26002_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
WP_002213258.1|26165_26717_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002224338.1|26735_27200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229829.1|27338_27668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016640.1|27767_28866_+|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002213267.1|29014_29440_-	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_001297096.1|32249_33029_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213403.1|34153_34546_-	type III secretion system chaperone SycE/YerA	NA	NA	NA	NA	NA
WP_002229754.1|34739_35399_+	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213360.1|35538_35838_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002224342.1|35830_36073_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213357.1|36616_36790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154020274.1|36938_37175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213354.1|37334_38300_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
WP_002220902.1|38296_39463_-	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002213007.1|42702_43251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213006.1|43750_44719_+|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_002213004.1|44718_45117_+	type III secretion system chaperone SycT	NA	NA	NA	NA	NA
WP_002222515.1|45821_46241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116442925.1|46989_47235_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP009722	Yersinia pestis strain Shasta plasmid pMT, complete sequence	96210	0	95391	96210	tail,terminase,integrase,transposase	Salmonella_phage(77.46%)	92	32000:32014	44850:44864
WP_002228788.1|63_1653_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	4.2e-301
WP_002211787.1|1671_2928_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|2930_3572_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|3767_4034_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|4043_4934_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|4939_5194_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|5186_5825_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|5821_6490_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|6489_7188_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|7252_8812_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|8814_9093_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|9152_9575_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|9579_10107_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|10428_11079_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|11163_11391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211801.1|12029_12512_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|12717_12999_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213759.1|13198_13657_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214145.1|13865_14435_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|14447_15194_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_002214148.1|15183_17100_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
WP_002213300.1|17329_18415_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002213298.1|18830_19853_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002214160.1|20212_20857_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
WP_002214164.1|21601_22666_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|23234_23447_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|23446_23782_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|23778_23958_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|23998_24274_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|24341_24752_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|24735_25107_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|25260_26091_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|26094_26295_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_000920226.1|27464_27731_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|27730_28675_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|28735_29764_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|29883_30315_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|30535_30787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|30859_31423_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|31452_31878_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
32000:32014	attL	CATCCAGCTCTGGCA	NA	NA	NA	NA
WP_042593131.1|32447_33227_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	5.8e-139
WP_000255944.1|33226_34249_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211767.1|37556_38792_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|38888_41255_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002228800.1|41364_41577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228802.1|41839_42226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353208.1|42220_43324_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002216410.1|44083_44596_-	F1 capsule protein Caf1	NA	NA	NA	NA	NA
WP_002211763.1|44676_47178_-	F1 capsule-anchoring usher protein Caf1A	NA	NA	NA	NA	NA
44850:44864	attR	TGCCAGAGCTGGATG	NA	NA	NA	NA
WP_002211762.1|47202_47979_-	F1 capsule chaperone Caf1M	NA	NA	NA	NA	NA
WP_002211761.1|48306_49212_+	F1 operon transcriptional regulator Caf1R	NA	NA	NA	NA	NA
WP_002209743.1|49560_50769_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211760.1|51237_52260_+|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002211758.1|54335_56099_-	phospholipase D	NA	NA	NA	NA	NA
WP_002211757.1|56176_56665_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211756.1|57404_57680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215065.1|57702_58644_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211754.1|58709_59330_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215068.1|59529_59856_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211753.1|59855_60083_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002211752.1|60384_61590_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002215070.1|61586_62558_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002228775.1|62936_64334_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002211750.1|64495_64696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|65196_65874_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211748.1|65873_66095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|66105_66525_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211747.1|66578_67358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211746.1|67756_68263_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211745.1|68975_69206_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211744.1|69278_71288_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_000255944.1|71411_72434_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|72433_73213_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|73346_73955_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|74256_77145_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|77225_77804_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|77860_82492_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211773.1|82513_83101_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|83088_83886_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211775.1|83878_84577_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_000440566.1|84666_85002_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|85043_89621_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|89628_89853_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|89978_90296_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|90355_91102_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|91176_91560_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|91561_92035_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|92025_92370_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|92467_93301_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|93300_93735_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|93778_94441_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|94515_95391_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
