The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009715	Yersinia pestis Pestoides F chromosome, complete genome	4519828	1288940	1368327	4519828	plate,transposase,tRNA	Yellowstone_lake_phycodnavirus(18.18%)	58	NA	NA
WP_002210509.1|1288940_1291757_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.1	1.0e-63
WP_002210508.1|1291756_1292266_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_002228112.1|1292333_1292792_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210506.1|1292772_1293726_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_002210504.1|1294307_1295129_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_002224759.1|1295601_1296777_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.3	6.9e-51
WP_011191702.1|1296792_1300026_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_002210501.1|1300253_1300868_-	LysE family translocator	NA	NA	NA	NA	NA
WP_002210499.1|1301191_1301992_+	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_002210498.1|1301988_1302444_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002210497.1|1302593_1303076_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	42.6	4.7e-30
WP_071525509.1|1303464_1303779_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_011906415.1|1303905_1304370_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002210492.1|1304459_1305329_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	NA	NA	NA	NA
WP_002210491.1|1305345_1305723_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_002210490.1|1305736_1306555_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_002210489.1|1306547_1307543_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_002210488.1|1307526_1308831_-	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_016674007.1|1308898_1311241_-	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_002210486.1|1311425_1312259_+	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_002210485.1|1312556_1313177_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_002214747.1|1314399_1315143_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_002210482.1|1315472_1316486_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002210481.1|1316496_1317057_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002210480.1|1317065_1318568_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002210479.1|1318730_1319249_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002210478.1|1319322_1319766_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002210477.1|1319798_1321643_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210476.1|1321635_1322619_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210475.1|1322636_1325225_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210474.1|1325328_1327677_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002224087.1|1327689_1329909_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|1329934_1331038_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|1331030_1331648_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214737.1|1331653_1332019_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210471.1|1332011_1332503_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002210470.1|1332622_1333978_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011906413.1|1333974_1335564_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210468.1|1339088_1339442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220588.1|1339697_1342604_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210466.1|1343048_1345418_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002210465.1|1345613_1346381_+	DedA family protein	NA	NA	NA	NA	NA
WP_002210464.1|1346449_1347160_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002214276.1|1347146_1348754_-	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002214274.1|1348729_1349722_-	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002210461.1|1350661_1352323_-	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002224086.1|1352986_1354168_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210456.1|1354408_1355011_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002210455.1|1355025_1356456_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210454.1|1356457_1357549_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210453.1|1357551_1359114_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210452.1|1359436_1359652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002216434.1|1360330_1361287_+	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002216437.1|1361857_1363663_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002209743.1|1363737_1364946_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_011906411.1|1365445_1367173_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	2.3e-58
WP_002424260.1|1367145_1367670_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002213775.1|1367868_1368327_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP009715	Yersinia pestis Pestoides F chromosome, complete genome	4519828	1544635	1621302	4519828	plate,transposase	Escherichia_phage(25.0%)	51	NA	NA
WP_002213775.1|1544635_1545094_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002209332.1|1545336_1546761_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.0e-40
WP_002209330.1|1547066_1548596_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_002209329.1|1548609_1551273_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_002216080.1|1551468_1552233_-	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_002209327.1|1553095_1554493_+	amino acid permease	NA	NA	NA	NA	NA
WP_002209326.1|1554925_1555780_-	beta-lactamase regulator AmpE	NA	NA	NA	NA	NA
WP_002209325.1|1556069_1556621_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_002209324.1|1556733_1557642_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_002209323.1|1557844_1558309_+	prepilin peptidase-dependent pilin	NA	NA	NA	NA	NA
WP_002216083.1|1558301_1559840_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_002209321.1|1559836_1561036_+	protein transport protein HofC	NA	NA	NA	NA	NA
WP_002209320.1|1561430_1562474_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	6.3e-104
WP_002209319.1|1562769_1563390_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002209318.1|1563386_1564139_+	cell division protein ZapD	NA	NA	NA	NA	NA
WP_002209317.1|1564324_1564531_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_002213759.1|1564720_1565179_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_011901829.1|1565289_1566312_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|1566311_1567091_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002209465.1|1567357_1568479_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002228330.1|1568583_1569741_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002213759.1|1570023_1570482_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209468.1|1570813_1571176_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_002209469.1|1571530_1572262_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002231132.1|1572397_1573375_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_002209471.1|1573376_1574108_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002217405.1|1574237_1576811_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	2.4e-128
WP_002218887.1|1577136_1577322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212076.1|1583512_1584442_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002212077.1|1584862_1586461_+	malate synthase A	NA	NA	NA	NA	NA
WP_002212078.1|1586507_1587815_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_002212079.1|1588070_1589798_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_002230619.1|1589917_1590760_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_011906136.1|1590974_1594670_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	4.6e-24
WP_032485879.1|1599743_1601432_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_011906137.1|1601999_1603385_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_002212085.1|1603754_1605401_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_011906138.1|1605535_1605943_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_002212087.1|1606085_1606976_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_002212088.1|1606989_1608567_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_011906139.1|1608753_1609965_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_002221973.1|1610552_1610789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212091.1|1610792_1611902_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	5.0e-27
WP_002212092.1|1611972_1613244_+	maltoporin	NA	NA	NA	NA	NA
WP_002212093.1|1613484_1614396_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_002212095.1|1614866_1615145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212097.1|1615296_1615815_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002212098.1|1616338_1616836_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002230616.1|1616903_1618385_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002212100.1|1618391_1618832_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_100067904.1|1619947_1621302_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 3
NZ_CP009715	Yersinia pestis Pestoides F chromosome, complete genome	4519828	1717325	1779621	4519828	tail,protease,transposase	uncultured_Mediterranean_phage(18.18%)	55	NA	NA
WP_002210082.1|1717325_1718771_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002210083.1|1718973_1721832_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002228695.1|1721856_1724697_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210086.1|1724897_1725257_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_011906147.1|1725253_1725655_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	60.2	1.1e-35
WP_002214300.1|1725667_1725970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210089.1|1726103_1730594_-	toxin	NA	NA	NA	NA	NA
WP_002220204.1|1730650_1734244_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002210090.1|1734284_1736786_-	toxin	NA	NA	NA	NA	NA
WP_002214297.1|1737021_1737888_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210092.1|1738148_1739060_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002210093.1|1739362_1739566_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002210094.1|1739573_1740509_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210095.1|1740510_1742466_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002214288.1|1744395_1744869_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210098.1|1744873_1745155_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002210099.1|1745266_1745815_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210100.1|1745995_1747336_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011055205.1|1747584_1748229_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210102.1|1748436_1748823_+	cytochrome b562	NA	NA	NA	NA	NA
WP_002210103.1|1749046_1749457_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210104.1|1749809_1751477_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002215779.1|1751571_1752987_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210106.1|1753397_1754351_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002210107.1|1754584_1755061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210109.1|1755359_1755746_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|1755883_1756348_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|1756359_1757295_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|1757632_1757905_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|1757901_1758756_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|1759061_1759544_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|1759972_1761406_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_011906149.1|1761467_1762193_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|1762199_1762745_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|1762728_1763292_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|1763288_1763852_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|1763960_1764947_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002210120.1|1765057_1766032_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|1766296_1767115_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|1767332_1768115_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|1768119_1768677_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|1768689_1769313_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|1769348_1769651_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|1769797_1770052_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|1770205_1771468_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|1771648_1772737_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002213775.1|1772962_1773421_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002218066.1|1773537_1774911_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002210130.1|1775181_1775586_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002210131.1|1775809_1776937_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210132.1|1777249_1777678_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210133.1|1777692_1778085_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002230558.1|1778081_1778279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210135.1|1778458_1779100_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002216203.1|1779105_1779621_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 4
NZ_CP009715	Yersinia pestis Pestoides F chromosome, complete genome	4519828	2001767	2082733	4519828	plate,protease,transposase,tRNA	Staphylococcus_phage(22.22%)	59	NA	NA
WP_002215902.1|2001767_2002418_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215900.1|2002868_2003264_+	lipoprotein	NA	NA	NA	NA	NA
WP_002213014.1|2005539_2006040_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_041175540.1|2006082_2007633_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|2007644_2008997_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|2008993_2009680_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|2009679_2011416_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|2011419_2011911_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002210013.1|2012328_2014977_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_011906172.1|2014973_2017322_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	1.2e-17
WP_002210009.1|2017337_2019635_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|2019621_2020389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016632.1|2020484_2021181_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210005.1|2021789_2022425_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|2023753_2025916_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210001.1|2026471_2027431_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210000.1|2027476_2028976_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002209999.1|2029008_2029992_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209998.1|2030074_2032108_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209997.1|2032211_2033312_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209995.1|2033610_2034687_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002230648.1|2034869_2035142_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002228057.1|2035319_2036435_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209991.1|2036772_2037492_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002209990.1|2037491_2037818_+	YggL family protein	NA	NA	NA	NA	NA
WP_002209989.1|2037928_2038855_+	glutaminase B	NA	NA	NA	NA	NA
WP_011906173.1|2040195_2049528_+	virulence determinant	NA	NA	NA	NA	NA
WP_002209987.1|2049717_2050848_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002215614.1|2050840_2051434_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002215612.1|2051533_2051824_-	YggU family protein	NA	NA	NA	NA	NA
WP_002209984.1|2051820_2052375_-	YggT family protein	NA	NA	NA	NA	NA
WP_002209983.1|2052662_2053484_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002215609.1|2053616_2054315_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209981.1|2054334_2055459_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002209980.1|2055567_2056683_-	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209979.1|2056686_2057571_-	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209978.1|2057750_2058173_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209977.1|2058172_2058736_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209976.1|2058851_2059811_-	glutathione synthase	NA	NA	NA	NA	NA
WP_002209975.1|2059836_2060568_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209973.1|2060819_2061527_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002228653.1|2061624_2062137_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|2062329_2063484_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|2064690_2066670_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209968.1|2066829_2067150_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_071525520.1|2067183_2067294_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209967.1|2067439_2068192_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_002209965.1|2068682_2070677_+	transketolase	NA	NA	NA	NA	NA
WP_002213759.1|2070984_2071443_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209964.1|2071783_2072800_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002209963.1|2072902_2074066_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_002209962.1|2074185_2075265_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002209961.1|2075702_2076572_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_002209960.1|2076834_2077452_+	arginine exporter ArgO	NA	NA	NA	NA	NA
WP_002209959.1|2077641_2078421_+	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_002209958.1|2078431_2079340_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_002209957.1|2079681_2080338_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_002209956.1|2080644_2081886_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
WP_002213775.1|2082274_2082733_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP009715	Yersinia pestis Pestoides F chromosome, complete genome	4519828	2392837	2460523	4519828	plate,protease,transposase	Escherichia_phage(28.57%)	53	NA	NA
WP_002213775.1|2392837_2393296_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_001297096.1|2394456_2395236_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_011901829.1|2395235_2396258_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_002211286.1|2396891_2397080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220006.1|2397345_2397864_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_032485934.1|2397932_2399684_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002226586.1|2399894_2400350_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002213775.1|2400518_2400977_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213066.1|2401167_2402229_-	porin OmpA	NA	NA	NA	NA	NA
WP_002213065.1|2402586_2403093_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213064.1|2403321_2403957_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213063.1|2404058_2406197_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213062.1|2406226_2406673_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002221095.1|2406866_2408921_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213060.1|2408981_2409446_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213058.1|2409624_2410305_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213056.1|2410620_2411037_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213054.1|2411145_2411463_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213052.1|2411523_2412714_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213049.1|2412807_2413086_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002213046.1|2413137_2413467_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213039.1|2417112_2419530_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213038.1|2419683_2420430_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213036.1|2421160_2421379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213034.1|2421642_2422167_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213032.1|2422156_2423440_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|2423441_2424179_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011906264.1|2424194_2425433_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213026.1|2425425_2426145_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213025.1|2426146_2426899_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213024.1|2426901_2427690_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002228570.1|2427776_2428217_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213017.1|2428254_2428503_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002213016.1|2428601_2429450_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213014.1|2430437_2430938_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002214707.1|2430980_2432531_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213011.1|2432542_2433895_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|2433891_2434578_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002214568.1|2434577_2436314_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|2436317_2436809_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211927.1|2437196_2439839_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.6	1.6e-92
WP_002211928.1|2439841_2442190_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.1	4.5e-17
WP_013060322.1|2442205_2444506_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002211930.1|2444502_2445276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211931.1|2445429_2445690_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002211932.1|2445705_2447889_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002214564.1|2448061_2448532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211935.1|2450696_2451929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211936.1|2451925_2455348_+	type VI secretion system membrane subunit	NA	NA	NA	NA	NA
WP_002211937.1|2455391_2456993_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002211938.1|2457010_2458069_+	PAAR domain protein	NA	NA	NA	NA	NA
WP_002211939.1|2458083_2458539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211940.1|2458759_2460523_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 6
NZ_CP009715	Yersinia pestis Pestoides F chromosome, complete genome	4519828	2957207	3052214	4519828	tail,lysis,tRNA,integrase,transposase,terminase	Escherichia_phage(12.5%)	93	2967754:2967784	3007566:3007596
WP_002211184.1|2957207_2957906_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_087768167.1|2958643_2958751_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002220632.1|2959285_2960974_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_002211181.1|2961133_2962255_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|2962491_2962761_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211179.1|2962764_2963577_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002220631.1|2963601_2964288_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211743.1|2965008_2965281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215627.1|2965421_2966507_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211740.1|2966577_2967234_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211739.1|2967336_2967783_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
2967754:2967784	attL	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211738.1|2967809_2969048_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_000255944.1|2969117_2970140_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2970139_2970919_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215632.1|2971086_2971347_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_071525537.1|2971646_2972396_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002211736.1|2972371_2972818_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_002211735.1|2972891_2973497_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002215636.1|2973497_2973887_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002215638.1|2973890_2974109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|2974157_2974721_+	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002211731.1|2975144_2975354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215644.1|2975350_2975626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002430108.1|2975871_2976069_+	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002211730.1|2976099_2976612_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002211729.1|2976596_2977055_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211727.1|2977600_2978314_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211725.1|2978770_2979406_+	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211724.1|2979436_2979886_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_011906214.1|2979895_2981386_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	76.5	7.8e-225
WP_002228445.1|2981385_2982114_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002228446.1|2982132_2982774_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002211721.1|2982774_2983887_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002211720.1|2984008_2984782_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211719.1|2984795_2986001_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211718.1|2986048_2986531_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211717.1|2986527_2986782_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211715.1|2987136_2987721_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|2987717_2988125_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|2988190_2989111_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|2989123_2989435_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071525538.1|2989482_2989743_+	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_011906212.1|2989743_2993259_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_002211710.1|2993261_2993603_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002213759.1|2993908_2994367_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002213775.1|2994618_2995077_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002211709.1|2995196_2995949_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002211708.1|2995951_2996662_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211706.1|2997644_2998076_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211705.1|2998199_2998367_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211704.1|2998440_2999448_+	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002214482.1|2999546_3000098_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211701.1|3000240_3000456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|3000511_3001132_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002359202.1|3001306_3001528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|3001703_3004907_+	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211697.1|3004906_3005905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211696.1|3005921_3006839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097608205.1|3006900_3007269_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002211693.1|3008855_3010055_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
3007566:3007596	attR	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211692.1|3010071_3010812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214494.1|3011903_3012260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227934.1|3012676_3013207_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002211689.1|3013442_3015017_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002211688.1|3015260_3015980_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211687.1|3016197_3017733_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_011906208.1|3018198_3019503_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002216508.1|3019518_3020721_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211685.1|3020985_3021855_-	pirin family protein	NA	NA	NA	NA	NA
WP_002211684.1|3022052_3022958_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211683.1|3022992_3024111_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002216501.1|3024218_3025493_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_011906207.1|3025642_3027577_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002430110.1|3028020_3028770_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211679.1|3028842_3029718_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_011906206.1|3030031_3031027_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211677.1|3031374_3031788_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002217933.1|3031858_3032131_+	YeaC family protein	NA	NA	NA	NA	NA
WP_002211676.1|3032264_3032912_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002211675.1|3032926_3033943_-	asparaginase	NA	NA	NA	NA	NA
WP_011192431.1|3034059_3035910_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211673.1|3036072_3036624_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211670.1|3037840_3039766_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211669.1|3039762_3040053_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211668.1|3040065_3040452_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211667.1|3040549_3041356_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211665.1|3042165_3043026_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209743.1|3043244_3044453_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002230891.1|3045089_3045938_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	7.0e-13
WP_002210666.1|3046021_3046486_-	YchJ family protein	NA	NA	NA	NA	NA
WP_002210665.1|3047819_3048836_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210664.1|3049142_3050489_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002209743.1|3051005_3052214_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 7
NZ_CP009715	Yersinia pestis Pestoides F chromosome, complete genome	4519828	3323529	3382369	4519828	coat,protease,transposase,tRNA	Tupanvirus(18.18%)	52	NA	NA
WP_011906184.1|3323529_3325917_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002211832.1|3325930_3326914_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_152328947.1|3327270_3327318_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002211833.1|3327412_3327769_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002211834.1|3327806_3328004_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002227898.1|3328100_3328652_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_002211836.1|3328655_3330584_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.1e-127
WP_002216696.1|3330974_3331187_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_002211839.1|3331945_3332197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211840.1|3332515_3333199_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_002216686.1|3333320_3333983_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_002211842.1|3334194_3335163_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_002211843.1|3335159_3336050_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
WP_002211844.1|3336049_3336934_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_002211845.1|3336930_3337824_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_002216683.1|3337891_3338104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211846.1|3338128_3339004_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002211847.1|3339132_3339687_-	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_002220277.1|3340097_3340763_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_002209743.1|3340997_3342206_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210828.1|3342253_3342604_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002210829.1|3342939_3343776_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210830.1|3343867_3344629_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210831.1|3344964_3346632_+	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210832.1|3346672_3347563_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210833.1|3347555_3348476_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210834.1|3348489_3349617_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210835.1|3349632_3350925_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210836.1|3351222_3351933_+	porin	NA	NA	NA	NA	NA
WP_002210837.1|3352502_3353051_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210838.1|3353254_3354646_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210839.1|3354860_3355712_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210840.1|3356096_3356888_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210841.1|3357074_3358241_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210842.1|3358567_3359935_+	MFS transporter	NA	NA	NA	NA	NA
WP_002210843.1|3359988_3360792_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002215120.1|3360788_3361952_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210844.1|3361948_3364561_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215118.1|3364642_3365422_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210846.1|3365574_3366117_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210847.1|3366774_3367656_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210848.1|3368110_3370183_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210849.1|3370202_3370916_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210850.1|3371011_3371509_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002367629.1|3371740_3372988_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002216616.1|3372956_3375608_+	PqiB family protein	NA	NA	NA	NA	NA
WP_002210852.1|3376087_3376642_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|3376647_3377178_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216611.1|3377198_3377756_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210856.1|3377786_3378539_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210857.1|3378726_3381174_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011906287.1|3381379_3382369_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 8
NZ_CP009715	Yersinia pestis Pestoides F chromosome, complete genome	4519828	4126841	4197462	4519828	tail,transposase,coat,plate	Vibrio_phage(16.67%)	59	NA	NA
WP_002213759.1|4126841_4127300_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208786.1|4127498_4129010_-	amino acid permease	NA	NA	NA	NA	NA
WP_002208788.1|4129267_4130140_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208790.1|4130797_4131886_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_002208791.1|4132049_4132907_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.0	6.9e-24
WP_002208792.1|4132977_4135449_-	fimbrial biogenesis usher protein PsaC	NA	NA	NA	NA	NA
WP_002208793.1|4135532_4136354_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002208794.1|4136480_4136957_-	adhesin PsaA	NA	NA	NA	NA	NA
WP_002216523.1|4137501_4137990_-	protein PsaF	NA	NA	NA	NA	NA
WP_002208796.1|4137986_4138631_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002208797.1|4138955_4140656_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002208798.1|4140670_4141609_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002208799.1|4141605_4142739_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_002208801.1|4143000_4143456_+	NUDIX domain-containing protein	NA	D9ICN3	Escherichia_virus	44.3	2.9e-05
WP_002208802.1|4143568_4144567_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208803.1|4144602_4146177_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	2.9e-12
WP_002208804.1|4146285_4147374_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208805.1|4147489_4148200_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_002208806.1|4148219_4149773_-	xylulokinase	NA	NA	NA	NA	NA
WP_002208807.1|4149776_4151273_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002208808.1|4151623_4152766_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002230767.1|4152762_4153728_+	C-terminal binding protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.3	5.2e-28
WP_002208810.1|4153738_4154554_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.6	8.8e-13
WP_002208811.1|4154622_4154877_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002208812.1|4155251_4156496_+	tryptophan permease	NA	NA	NA	NA	NA
WP_002228019.1|4156599_4157172_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_002208813.1|4157311_4158505_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002224659.1|4159108_4160581_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.5	4.9e-46
WP_002208819.1|4162261_4163245_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_002208820.1|4163303_4164005_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002208822.1|4164446_4165031_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	2.8e-13
WP_071525527.1|4165681_4167199_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_002208825.1|4167280_4169089_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208826.1|4169098_4170199_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_002208827.1|4170198_4171227_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002208828.1|4171228_4172821_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.3e-20
WP_002208829.1|4172881_4173226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208831.1|4174210_4175410_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.3e-23
WP_002208832.1|4175513_4176221_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002208833.1|4176754_4178512_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	2.3e-98
WP_002208834.1|4178673_4178958_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_002213775.1|4179096_4179555_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208835.1|4179755_4180760_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002208836.1|4180937_4181165_+	YejL family protein	NA	NA	NA	NA	NA
WP_002208837.1|4181192_4182989_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002230704.1|4183219_4183603_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208839.1|4183959_4185108_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_002208840.1|4185120_4185609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208841.1|4186308_4186671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208842.1|4186796_4188233_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208843.1|4188523_4189264_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208845.1|4189561_4190341_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208846.1|4190437_4190785_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002215458.1|4190781_4191042_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208847.1|4191038_4192175_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002208848.1|4192178_4192634_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208850.1|4193243_4194299_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208852.1|4194295_4195702_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208853.1|4195968_4197462_-|coat	coat protein	coat	NA	NA	NA	NA
>prophage 9
NZ_CP009715	Yersinia pestis Pestoides F chromosome, complete genome	4519828	4200640	4210655	4519828		Escherichia_phage(42.86%)	10	NA	NA
WP_002208859.1|4200640_4200931_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208860.1|4201527_4202322_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208861.1|4202297_4203110_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_116463120.1|4203112_4203808_-	aldolase	NA	A0A077SK32	Escherichia_phage	55.4	5.9e-58
WP_002208862.1|4203840_4205145_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002215470.1|4205355_4205835_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208864.1|4206108_4206831_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002208866.1|4207036_4207279_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208867.1|4207450_4208386_+	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_011906348.1|4208867_4210655_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
>prophage 10
NZ_CP009715	Yersinia pestis Pestoides F chromosome, complete genome	4519828	4233748	4290397	4519828	protease,transposase,tRNA,holin	Enterobacteria_phage(16.67%)	46	NA	NA
WP_002210815.1|4233748_4234258_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210814.1|4234315_4235509_-	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_002221775.1|4236127_4237336_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_002210812.1|4237592_4238135_-	membrane protein	NA	NA	NA	NA	NA
WP_002228030.1|4238492_4239935_+	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	4.9e-99
WP_002210810.1|4240002_4242183_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.1e-44
WP_002210809.1|4242452_4243568_+	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	2.1e-110
WP_002210807.1|4243979_4244870_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002210806.1|4244994_4245198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|4246422_4247631_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210804.1|4249014_4250349_-	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_002353933.1|4250898_4251597_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210802.1|4251731_4252670_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	6.4e-23
WP_002210801.1|4252666_4253821_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011191984.1|4254081_4255014_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210799.1|4255749_4256604_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_002210798.1|4256821_4258237_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002210797.1|4258260_4259118_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_002223523.1|4259232_4259931_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.4e-12
WP_032465620.1|4260024_4260795_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	3.9e-10
WP_002210794.1|4260857_4261934_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_002210793.1|4261933_4263535_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_002210792.1|4263658_4264927_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210791.1|4265354_4265828_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
WP_002210790.1|4266073_4266955_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210789.1|4266957_4267818_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_011906354.1|4267920_4268850_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210787.1|4268886_4269723_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.1e-17
WP_002210786.1|4269930_4270179_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002210785.1|4270363_4271467_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_011906355.1|4271779_4272121_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_002210782.1|4272146_4272686_-	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_002210781.1|4272895_4274608_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002210780.1|4274728_4275664_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_002210778.1|4276002_4276182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228612.1|4276255_4277194_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210776.1|4277493_4278423_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002213759.1|4278837_4279296_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002214195.1|4280224_4281088_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|4281433_4282282_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|4282319_4283213_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|4283444_4285493_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|4285857_4286454_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002218281.1|4286511_4287984_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011906357.1|4288006_4289710_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	1.0e-55
WP_011906358.1|4289938_4290397_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP009715	Yersinia pestis Pestoides F chromosome, complete genome	4519828	4360923	4370065	4519828	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_002210709.1|4360923_4361124_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|4361123_4361666_+	ash family protein	NA	NA	NA	NA	NA
WP_011906363.1|4361658_4362618_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	2.8e-50
WP_002210707.1|4362614_4363703_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|4364051_4364366_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|4364371_4364689_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_011901829.1|4365293_4366316_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	1.2e-200
WP_001297096.1|4366315_4367095_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215393.1|4367987_4368173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002212204.1|4368335_4368587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215390.1|4369297_4370065_+	esterase	NA	G1DB77	Mycobacterium_phage	36.0	3.4e-06
>prophage 1
NZ_CP009713	Yersinia pestis Pestoides F plasmid pCD, complete sequence	71507	0	47958	71507	transposase	Escherichia_phage(50.0%)	51	NA	NA
WP_042469136.1|3334_3604_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|3672_4131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213008.1|4302_4620_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213294.1|4643_5051_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_002233137.1|5467_5716_+	phospholipase	NA	A0A1B2LRT6	Wolbachia_phage	47.1	9.2e-06
WP_002229817.1|5853_6108_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_002233140.1|6349_6424_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_002213292.1|6404_7283_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_002213291.1|8455_8695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002233145.1|9440_9869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213290.1|9886_12085_+	T3SS effector protein kinase YopO/YpkA	NA	NA	NA	NA	NA
WP_002213287.1|12480_13347_+	type III secretion system effector acetyltransferase YopJ	NA	NA	NA	NA	NA
WP_011901819.1|15029_16436_+	T3SS effector protein-tyrosine-phosphatase YopH	NA	NA	NA	NA	NA
WP_001297096.1|17150_17930_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|17929_18952_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002212907.1|20484_20832_-	type III secretion system exported negative regulator LcrQ/YscM1	NA	NA	NA	NA	NA
WP_002212909.1|21056_21689_-	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_002361471.1|21667_22297_-	type III secretion system sorting platform protein YscK	NA	NA	NA	NA	NA
WP_002212912.1|22296_23031_-	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_002212914.1|23037_23385_-	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_002212915.1|23385_23883_-	YopR family type III secretion effector	NA	NA	NA	NA	NA
WP_011901822.1|23879_24227_-	YscG family type III secretion protein	NA	NA	NA	NA	NA
WP_002212916.1|24228_24492_-	type III secretion system needle filament subunit SctF	NA	NA	NA	NA	NA
WP_002212917.1|24492_24693_-	EscE/YscE/SsaE family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_002212919.1|24689_25949_-	type III secretion system inner membrane ring subunit SctD	NA	NA	NA	NA	NA
WP_002212923.1|25945_27769_-	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_002212925.1|27774_28188_-	type III secretion system chaperone YscB	NA	NA	NA	NA	NA
WP_002229797.1|28413_28512_-	type III secretion system protein YscA	NA	NA	NA	NA	NA
WP_002212931.1|28590_29406_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002222527.1|29529_29925_-	type III secretion system chaperone YscW	NA	NA	NA	NA	NA
WP_011901823.1|30499_31564_-	type III secretion system export apparatus switch protein YscU	NA	NA	NA	NA	NA
WP_002212938.1|31563_32349_-	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_002212945.1|32345_32612_-	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_002212947.1|32613_33267_-	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_002212948.1|33263_34187_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_011901824.1|34183_35551_-	type III secretion system needle length determinant	NA	NA	NA	NA	NA
WP_002212952.1|35550_36015_-	type III secretion system central stalk protein YscO	NA	NA	NA	NA	NA
WP_011901825.1|36011_37331_-	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_002212958.1|37528_38410_+	type III secretion system gatekeeper subunit YopN	NA	NA	NA	NA	NA
WP_002212965.1|38390_38669_+	type III secretion system gatekeeper subunit TyeA	NA	NA	NA	NA	NA
WP_002229794.1|38655_39027_+	type III secretion chaperone SycN	NA	NA	NA	NA	NA
WP_002212969.1|39023_39392_+	type III secretion system protein YscX	NA	NA	NA	NA	NA
WP_002229791.1|39388_39733_+	type III secretion system chaperone YscY	NA	NA	NA	NA	NA
WP_002212971.1|39719_41834_+	type III secretion system export apparatus subunit SctV	NA	NA	NA	NA	NA
WP_002220918.1|41830_42271_+	type III secretion system regulator LcrR	NA	NA	NA	NA	NA
WP_002212973.1|42312_42600_+	type III secretion protein LcrG	NA	NA	NA	NA	NA
WP_011171995.1|42601_43576_+	type III secretion system protein LcrV	NA	NA	NA	NA	NA
WP_002222758.1|43578_44085_+	type III secretion system chaperone LcrH	NA	NA	NA	NA	NA
WP_002212985.1|44062_45268_+	type III secretion system translocon subunit YopB	NA	NA	NA	NA	NA
WP_002212987.1|45286_46207_+	type III secretion system translocon subunit YopD	NA	NA	NA	NA	NA
WP_002209743.1|46749_47958_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 2
NZ_CP009713	Yersinia pestis Pestoides F plasmid pCD, complete sequence	71507	58499	60628	71507		Yersinia_phage(100.0%)	2	NA	NA
WP_002220902.1|58499_59666_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002213354.1|59662_60628_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
>prophage 3
NZ_CP009713	Yersinia pestis Pestoides F plasmid pCD, complete sequence	71507	64529	69751	71507	transposase	Enterobacteria_phage(66.67%)	6	NA	NA
WP_002220893.1|64529_65702_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
WP_002213267.1|66476_66902_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_086016640.1|67049_68149_-|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002229829.1|68248_68578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224338.1|68716_69181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|69199_69751_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
>prophage 1
NZ_CP009714	Yersinia pestis Pestoides F plasmid pMT, complete sequence	136983	0	63978	136983	tail,transposase,integrase,terminase	Salmonella_phage(95.16%)	67	57763:57780	70819:70836
WP_002211773.1|3479_4067_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|4054_4852_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_011901831.1|4844_5543_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	6.4e-137
WP_000440566.1|5632_5968_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|6009_10587_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|10594_10819_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|10944_11262_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|11321_12068_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|12142_12526_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|12527_13001_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|12991_13336_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|13433_14267_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|14266_14701_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|14744_15407_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|15481_16357_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002231160.1|16383_17280_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_025476623.1|17302_18877_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.4	6.4e-302
WP_002211787.1|18910_20167_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|20169_20811_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|21006_21273_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|21282_22173_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|22178_22433_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|22425_23064_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|23060_23729_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|23728_24427_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|24495_26055_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|26057_26336_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|26395_26818_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|26822_27350_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|27673_28324_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|28408_28636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213759.1|28861_29320_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002211801.1|29995_30478_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|30683_30965_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213775.1|31164_31623_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_011901832.1|31861_32617_-	hypothetical protein	NA	J9Q742	Salmonella_phage	98.4	3.8e-135
WP_002231164.1|32815_33958_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_002231165.1|34065_36381_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	98.8	0.0e+00
WP_011201798.1|36458_37028_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	3.8e-103
WP_002213303.1|37040_37787_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_038918515.1|37776_38136_-	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213300.1|39922_41008_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002213298.1|41423_42446_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002389821.1|42805_43030_-	hypothetical protein	NA	J9Q739	Salmonella_phage	97.3	1.5e-34
WP_002214164.1|44214_45279_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|45847_46060_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|46059_46395_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|46391_46571_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|46611_46887_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|46954_47365_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|47348_47720_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|47873_48704_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|48707_48908_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|48998_50030_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|50077_50344_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|50343_51288_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|51348_52377_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|52496_52928_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|53148_53400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011201800.1|53472_54036_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	65.1	2.6e-64
WP_002425587.1|54065_54491_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|54505_58030_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
57763:57780	attL	CCAATGATTCCATACATC	NA	NA	NA	NA
WP_002211767.1|58210_59446_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|59542_61909_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002228800.1|62018_62231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228802.1|62493_62880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353208.1|62874_63978_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
70819:70836	attR	GATGTATGGAATCATTGG	NA	NA	NA	NA
>prophage 2
NZ_CP009714	Yersinia pestis Pestoides F plasmid pMT, complete sequence	136983	70378	135753	136983	transposase,tail	Salmonella_phage(33.33%)	62	NA	NA
WP_002224363.1|70378_70684_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
WP_002224361.1|70829_71045_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
WP_011901835.1|71204_72527_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.9	8.1e-258
WP_016256030.1|72561_72819_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	95.3	3.4e-35
WP_002224265.1|73119_73914_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	3.7e-141
WP_002224263.1|74166_74889_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|74922_76131_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_011901836.1|76251_79071_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_011201821.1|79070_80444_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_011901837.1|80440_80986_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_011901838.1|80975_81224_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_011201818.1|81240_81990_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_016674191.1|82020_82209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011201817.1|82240_84091_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_016674192.1|84087_84717_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_032485960.1|84733_85720_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_011901841.1|85722_86370_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_011201813.1|86369_86717_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_011901842.1|86713_89344_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_011201812.1|89336_89903_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_016674193.1|89892_90297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016674194.1|90280_90466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016674195.1|90469_90694_-	molecular chaperone DnaK	NA	NA	NA	NA	NA
WP_011201809.1|90813_91353_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_011901843.1|91374_92769_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_011201807.1|92755_93499_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_011201806.1|93485_94052_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_011201805.1|94066_94372_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_011901844.1|94522_94873_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_071589830.1|94930_95059_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|95082_96291_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_016674166.1|96372_98484_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_011901846.1|98483_103724_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_011901847.1|103725_104463_+	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_008324922.1|104529_105249_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_011901848.1|105241_106033_+	DsbA family protein	NA	NA	NA	NA	NA
WP_011201827.1|106180_106735_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	7.8e-21
WP_100228227.1|106712_106856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011201829.1|107074_107152_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_086028848.1|107132_108008_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_002211760.1|109214_110237_+|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002211758.1|112312_114076_-	phospholipase D	NA	NA	NA	NA	NA
WP_002211757.1|114153_114642_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211756.1|115380_115656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215065.1|115678_116620_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211754.1|116685_117306_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215068.1|117505_117832_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211753.1|117831_118059_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002211752.1|118360_119566_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002215070.1|119562_120534_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002228775.1|120912_122310_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002211750.1|122471_122672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|123172_123850_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211748.1|123849_124071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|124081_124501_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211747.1|124554_125334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211746.1|125732_126239_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211745.1|126951_127182_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211744.1|127254_129264_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_002211769.1|131295_131904_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|132205_135094_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|135174_135753_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
