The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009712	Yersinia pseudotuberculosis IP 32953 strain IP32953 chromosome, complete genome	4743972	659508	799311	4743972	capsid,holin,head,transposase,integrase,tail,portal,lysis,plate,terminase	Erwinia_phage(25.44%)	164	650847:650863	799495:799617
650847:650863	attL	AATGACTTGGTGGCTTC	NA	NA	NA	NA
WP_032467055.1|659508_659763_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	61.1	3.1e-17
650847:650863	attL	AATGACTTGGTGGCTTC	NA	NA	NA	NA
WP_002213212.1|659759_660059_+	lysozyme	NA	A0A218M4K8	Erwinia_phage	64.9	2.6e-23
WP_002215413.1|660075_660363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192343.1|664091_664649_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011192342.1|664623_665790_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_012413697.1|665786_666584_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011192340.1|666583_667438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192339.1|667425_668151_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011192338.1|668140_669874_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012413696.1|669870_671139_-	MFS transporter	NA	NA	NA	NA	NA
WP_086025313.1|672095_673608_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011192335.1|673828_674173_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_144405787.1|674234_674441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213223.1|674470_674653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215401.1|675777_676005_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	57.7	2.1e-12
WP_012413690.1|676563_676788_+|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	76.8	6.6e-19
WP_011192331.1|678101_678482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192329.1|678990_680688_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	62.5	9.0e-76
WP_011192328.1|680708_681077_-	helix-turn-helix domain-containing protein	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	39.8	5.2e-13
WP_012304171.1|681137_681329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192327.1|681341_681545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024063347.1|681556_681763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192326.1|681759_682074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192325.1|682215_682476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304177.1|682506_682812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192323.1|682894_683662_+	hypothetical protein	NA	K7ZRM8	Xanthomonas_citri_phage	49.3	1.9e-09
WP_011192322.1|683718_684372_+	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	62.9	3.0e-56
WP_011192321.1|684368_685187_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	55.9	1.5e-76
WP_011192320.1|685275_687831_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	37.9	8.9e-128
WP_012413686.1|687811_688042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192319.1|688038_688383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041175454.1|689064_690105_-|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	64.3	7.8e-131
WP_011192317.1|690104_691868_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	63.6	3.1e-228
WP_011192316.1|692038_692854_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	71.1	9.6e-76
WP_011192315.1|692890_693946_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	62.8	2.1e-123
WP_011192314.1|693952_694606_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.8	1.7e-43
WP_011192313.1|694839_695331_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	48.4	7.9e-33
WP_011192312.1|695330_695534_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	70.1	1.8e-23
WP_011192311.1|695563_695950_+|holin	holin	holin	NA	NA	NA	NA
WP_011192310.1|695936_696332_+	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.8	3.5e-47
WP_011192309.1|696336_696762_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	48.2	9.2e-22
WP_072083431.1|696649_696874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192308.1|696860_697328_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	57.2	1.8e-42
WP_011192307.1|697324_697771_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	50.7	7.7e-35
WP_012304193.1|698102_698804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192305.1|699134_699770_+|plate	phage baseplate assembly protein V	plate	O80314	Escherichia_phage	62.0	1.3e-64
WP_011192304.1|699766_700120_+|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	59.3	2.4e-31
WP_011192303.1|700122_701031_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	73.2	1.3e-118
WP_011192302.1|701023_701632_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	75.0	1.7e-85
WP_011192301.1|701628_703068_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	77.8	3.8e-75
WP_011192300.1|703079_703559_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	41.9	1.2e-28
WP_011192299.1|703692_704868_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.8	1.3e-179
WP_011192298.1|704879_705395_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	66.3	2.5e-61
WP_011192297.1|705448_705796_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	51.6	8.6e-18
WP_071819140.1|705810_705930_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_011192295.1|705922_708838_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	52.6	2.8e-154
WP_011192294.1|708849_709314_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	56.2	9.4e-44
WP_011192293.1|709310_710405_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	65.7	1.9e-127
WP_012105206.1|710479_710695_+	phage transcriptional activator, Ogr/Delta	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
WP_011192291.1|711532_711937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032466310.1|711938_712160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049800086.1|712187_713846_-	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	54.0	6.3e-167
WP_011192289.1|713808_720210_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	33.9	1.3e-281
WP_011192288.1|720543_721935_-	hypothetical protein	NA	A0A0P0ZD72	Stx2-converting_phage	28.9	5.3e-26
WP_011192287.1|721945_722185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192286.1|722184_722568_-	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	57.6	5.8e-31
WP_011192285.1|722583_723189_-	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	54.9	2.5e-49
WP_011192284.1|723196_723571_-	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	54.7	9.6e-31
WP_011192283.1|723545_724577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192282.1|724643_725750_-	DUF1983 domain-containing protein	NA	A0A2L1IV54	Escherichia_phage	49.3	1.9e-106
WP_011192281.1|725746_727375_-	hypothetical protein	NA	A0A2R2Z356	Escherichia_phage	56.4	3.0e-177
WP_011192280.1|727606_728071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192279.1|728064_728391_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_106470341.1|728403_728817_-|tail	phage tail protein	tail	F1BUK2	Cronobacter_phage	38.0	1.4e-06
WP_011192277.1|728878_731014_-	hypothetical protein	NA	I7K3G3	Yersinia_phage	42.0	4.5e-48
WP_011192276.1|731010_731664_-	hypothetical protein	NA	Q08J85	Stx2-converting_phage	59.5	1.2e-68
WP_011192275.1|731663_732260_-	hypothetical protein	NA	A0A088CE76	Shigella_phage	38.9	7.6e-30
WP_011192274.1|732262_732715_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	52.8	1.8e-31
WP_011192273.1|732780_733164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192272.1|733241_734465_-|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	73.6	2.2e-172
733501:733517	attR	GAAGCCACCAAGTCATT	NA	NA	NA	NA
WP_011192271.1|734524_735574_-	hypothetical protein	NA	A0A0H4J3F0	Shigella_phage	40.4	2.0e-57
733501:733517	attR	GAAGCCACCAAGTCATT	NA	NA	NA	NA
WP_011192270.1|735843_737964_-	hypothetical protein	NA	A0A088CE71	Shigella_phage	65.6	1.2e-258
WP_025383644.1|737963_739628_-|terminase	terminase	terminase	B0FEF1	Escherichia_phage	70.5	9.3e-235
WP_011192268.1|739666_740524_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	39.1	6.0e-44
WP_001297096.1|740641_741421_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|741420_742443_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_011192267.1|742549_742990_-	DUF2829 domain-containing protein	NA	A0A2I7R7I1	Vibrio_phage	62.5	1.7e-26
WP_025383640.1|743015_743204_-	hypothetical protein	NA	A0A2I7RNR1	Vibrio_phage	79.3	7.9e-18
WP_011192266.1|743207_743726_-	hypothetical protein	NA	H9C185	Pectobacterium_phage	42.8	5.2e-19
WP_025383638.1|743857_744340_-	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	57.6	1.2e-49
WP_011192264.1|744345_744558_-|holin	holin	holin	H9C183	Pectobacterium_phage	72.9	1.1e-23
WP_011192263.1|744730_745540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128217.1|745632_745851_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	50.8	3.4e-12
WP_011192262.1|745851_746310_-	VRR-NUC domain-containing protein	NA	M4SRS1	Psychrobacter_phage	33.0	2.3e-10
WP_011192261.1|746306_747242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032466299.1|747313_747634_-	DUF1364 domain-containing protein	NA	A0A2K8HR56	Pseudomonas_phage	44.9	1.3e-15
WP_011192260.1|747635_748283_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	31.2	1.3e-14
WP_011192259.1|748279_750025_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	61.5	7.2e-238
WP_011192258.1|750021_750897_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	52.2	2.4e-85
WP_011192257.1|750893_751820_-	site-specific DNA-methyltransferase	NA	A0A059VK11	Pseudomonas_phage	52.8	1.7e-108
WP_011192256.1|751816_752164_-	hypothetical protein	NA	A0A1I9KG94	Aeromonas_phage	43.4	3.8e-05
WP_011192255.1|752163_753300_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.3	4.9e-94
WP_011192254.1|753303_754080_-	hypothetical protein	NA	H2DE84	Erwinia_phage	51.5	7.3e-49
WP_011192253.1|754083_754929_-	hypothetical protein	NA	H2DE83	Erwinia_phage	47.0	1.0e-43
WP_032466294.1|754937_755117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192252.1|755113_755476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383629.1|755493_755739_-	hypothetical protein	NA	Q8W647	Enterobacteria_phage	64.4	1.1e-16
WP_011192250.1|755863_756550_+	LexA family transcriptional regulator	NA	Q8W648	Enterobacteria_phage	52.0	8.1e-60
WP_011192249.1|756560_757178_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011192248.1|757455_757701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192247.1|757785_758055_+	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	43.4	1.9e-12
WP_032466292.1|758116_758332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144405789.1|758405_758591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041175452.1|758958_759426_+	hypothetical protein	NA	G0YQE7	Erwinia_phage	60.8	2.9e-45
WP_042593118.1|759441_759768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192244.1|760068_760911_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.4	1.8e-69
WP_011192243.1|760897_762502_+	hypothetical protein	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	51.3	3.2e-107
WP_011192242.1|762546_763686_+	hypothetical protein	NA	M4MHC3	Vibrio_phage	26.4	9.1e-32
WP_106470333.1|763685_764111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192240.1|764347_764584_+	hypothetical protein	NA	A0A248SL48	Klebsiella_phage	64.6	8.5e-17
WP_011192239.1|764942_765806_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	38.9	5.9e-23
WP_011192237.1|766369_766873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192236.1|767192_768215_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	70.2	1.1e-137
WP_011192235.1|768549_769596_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_011192234.1|769592_770648_-|integrase	tyrosine-type recombinase/integrase	integrase	Q1I119	Pasteurella_virus	62.1	3.2e-116
WP_011192233.1|770767_771646_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_011192232.1|771645_772917_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011192231.1|772944_773556_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	37.9	3.4e-25
WP_011192230.1|773626_773824_+	hypothetical protein	NA	Q1I116	Pasteurella_virus	39.3	4.7e-05
WP_011192229.1|773878_774388_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	52.4	2.7e-44
WP_041175449.1|774397_774583_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_011192228.1|774594_774906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192227.1|774971_775244_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_011192226.1|775230_777513_+	replication endonuclease	NA	Q858T4	Yersinia_virus	57.0	2.2e-242
WP_011192225.1|777535_777895_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	41.1	6.2e-19
WP_033852502.1|778031_778226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192224.1|778646_779684_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	78.4	1.8e-159
WP_011192223.1|779680_780445_-|terminase	terminase	terminase	O80303	Escherichia_phage	46.6	2.1e-56
WP_011192222.1|780441_782214_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.0	2.9e-287
WP_011192221.1|782362_783217_+|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	61.1	6.5e-91
WP_011192220.1|783293_784532_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	74.6	7.1e-147
WP_011192219.1|784535_785195_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.9	7.2e-82
WP_011192218.1|785294_785768_+|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	56.8	1.7e-40
WP_011192217.1|785767_785971_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	64.2	3.5e-19
WP_038830077.1|785973_786183_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	44.9	1.7e-08
WP_011192215.1|786166_786673_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	62.3	2.0e-55
WP_011192214.1|786674_787091_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	49.6	8.7e-25
WP_071880004.1|787050_787248_+|holin	holin	holin	F1BUQ0	Erwinia_phage	59.3	4.0e-12
WP_011192213.1|787186_787642_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	63.3	4.0e-47
WP_011192212.1|787638_788088_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	63.8	5.7e-46
WP_011192211.1|788161_788803_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	61.0	2.4e-69
WP_011192210.1|788799_789150_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	69.0	2.4e-39
WP_011192209.1|789154_790063_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	79.5	1.9e-125
WP_011192208.1|790055_790664_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	78.6	3.9e-90
WP_011192207.1|790660_792100_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	79.4	1.2e-76
WP_011192206.1|792111_792594_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	41.3	1.5e-28
WP_011192205.1|792721_793891_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	80.2	2.1e-185
WP_011192204.1|793904_794420_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	73.1	2.3e-67
WP_011192203.1|794470_794782_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	60.9	2.9e-25
WP_011192202.1|794814_794937_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	68.4	7.4e-09
WP_011192201.1|794929_797356_+|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	44.5	8.4e-160
WP_011192200.1|797355_797841_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	60.4	1.5e-47
WP_011192199.1|797837_799004_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	66.5	7.4e-146
WP_011192198.1|799095_799311_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	62.5	9.7e-20
799495:799617	attR	ACAAAAAAACCGCCTCTCGGCGGTTAACGACATACTCGTACTACTTTGTTTTACTTAGAATATTTTCCATGGTGCCCGGGGCGGGACTTGAACCCGCACAGCCATAAGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 2
NZ_CP009712	Yersinia pseudotuberculosis IP 32953 strain IP32953 chromosome, complete genome	4743972	1359674	1368350	4743972	coat,tail,plate	Shigella_phage(33.33%)	10	NA	NA
WP_011192008.1|1359674_1360094_-|tail	tail assembly protein	tail	F1BUK2	Cronobacter_phage	32.3	8.3e-07
WP_011192007.1|1360095_1360812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192006.1|1360908_1361511_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.6	2.0e-33
WP_011192005.1|1361507_1362644_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	3.5e-31
WP_002208848.1|1362647_1363103_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002215460.1|1363099_1363696_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_011192004.1|1363711_1364767_-|tail	tail protein	tail	A0A2I7S9G1	Vibrio_phage	27.5	1.3e-37
WP_011192003.1|1364763_1366170_-	hypothetical protein	NA	U5P4I0	Shigella_phage	36.1	3.5e-17
WP_002208853.1|1366436_1367930_-|coat	coat protein	coat	NA	NA	NA	NA
WP_002208854.1|1368050_1368350_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 3
NZ_CP009712	Yersinia pseudotuberculosis IP 32953 strain IP32953 chromosome, complete genome	4743972	1960383	1968241	4743972	transposase	uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_011191781.1|1960383_1962939_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	3.4e-26
WP_002209743.1|1963264_1964473_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_011191780.1|1964698_1965697_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	3.6e-32
WP_012304557.1|1965751_1966735_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	2.3e-07
WP_002209395.1|1966856_1967483_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	9.1e-34
WP_011191778.1|1967476_1968241_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	4.2e-57
>prophage 4
NZ_CP009712	Yersinia pseudotuberculosis IP 32953 strain IP32953 chromosome, complete genome	4743972	2053034	2132974	4743972	transposase,plate	Yellowstone_lake_phycodnavirus(18.18%)	60	NA	NA
WP_002209743.1|2053034_2054243_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209320.1|2054436_2055480_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	6.3e-104
WP_002209319.1|2055775_2056396_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002209318.1|2056392_2057145_+	cell division protein ZapD	NA	NA	NA	NA	NA
WP_002209317.1|2057352_2057559_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_002213759.1|2057748_2058207_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002210424.1|2058421_2058808_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|2059102_2061817_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_011191738.1|2061894_2062428_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|2062456_2062981_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|2063147_2064068_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|2064167_2065319_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|2065391_2066648_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_011191736.1|2066674_2067502_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|2067503_2068424_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|2068416_2069892_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_011191735.1|2070029_2071100_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|2071096_2072299_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_011191734.1|2072298_2073615_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|2073617_2074700_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_011191733.1|2074693_2076070_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_012105673.1|2076066_2077554_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_011191731.1|2077540_2079304_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|2079369_2079687_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|2079683_2080646_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_011191730.1|2080648_2081107_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|2081661_2081751_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|2082208_2082649_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_011191729.1|2082779_2083790_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002424260.1|2084257_2084782_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002228103.1|2084754_2086482_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002216437.1|2086941_2088747_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|2089299_2090256_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_012413476.1|2090933_2091125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210453.1|2091471_2093034_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_011191728.1|2093036_2094128_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011191727.1|2094129_2095560_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|2095574_2096177_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011191726.1|2096454_2097636_-	MFS transporter	NA	NA	NA	NA	NA
WP_011191725.1|2098281_2099943_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_012413474.1|2100489_2100621_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011191723.1|2100865_2102368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214274.1|2103013_2104006_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_011191722.1|2103981_2105589_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_011191721.1|2105575_2106286_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.3e-20
WP_002210465.1|2106354_2107122_-	DedA family protein	NA	NA	NA	NA	NA
WP_011191720.1|2107317_2109687_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.1e-31
WP_011191719.1|2110147_2113054_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	6.8e-23
WP_002210468.1|2113309_2113663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011191718.1|2117187_2118798_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210470.1|2118794_2120150_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011191717.1|2120269_2120761_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|2120753_2121119_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|2121124_2121742_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|2121734_2122838_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_011191716.1|2122863_2125083_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_011191715.1|2125095_2127444_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|2127547_2130136_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|2130153_2131137_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011191714.1|2131129_2132974_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP009712	Yersinia pseudotuberculosis IP 32953 strain IP32953 chromosome, complete genome	4743972	3868653	3956571	4743972	capsid,holin,head,transposase,protease,integrase,tail,portal,tRNA,terminase	Cronobacter_phage(43.59%)	85	3932354:3932370	3959664:3959680
WP_011192970.1|3868653_3869166_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209971.1|3869358_3870513_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002209969.1|3871719_3873699_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002213775.1|3873899_3874358_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002209968.1|3874568_3874889_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_011192969.1|3875000_3875753_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011192968.1|3876243_3878238_+	transketolase	NA	NA	NA	NA	NA
WP_002209964.1|3878616_3879633_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002209963.1|3879735_3880899_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_002209962.1|3881018_3882098_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002209961.1|3882535_3883405_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_002209960.1|3883667_3884285_+	arginine exporter ArgO	NA	NA	NA	NA	NA
WP_011192966.1|3884474_3885254_+	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_002209958.1|3885264_3886173_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_002209957.1|3886514_3887171_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_002209956.1|3887477_3888719_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
WP_011192965.1|3888983_3889580_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002209954.1|3889943_3890273_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_002209953.1|3890609_3891188_+	YecA family protein	NA	NA	NA	NA	NA
WP_011192964.1|3891275_3892589_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_011192963.1|3892640_3893819_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_002209950.1|3893991_3895212_+	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
WP_011192962.1|3895932_3897030_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_002209948.1|3897098_3897485_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_002209947.1|3897696_3900576_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.3	1.7e-268
WP_011192961.1|3900953_3901391_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_148305774.1|3902450_3904601_+	autotransporter adhesin YapN	NA	NA	NA	NA	NA
WP_011192960.1|3904704_3905808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192959.1|3906008_3906710_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002209941.1|3906967_3907465_+	DUF2165 family protein	NA	NA	NA	NA	NA
WP_011192958.1|3907537_3908530_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_002209939.1|3908846_3909113_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_002215144.1|3909093_3909519_+	membrane protein	NA	NA	NA	NA	NA
WP_002209937.1|3909518_3910217_+	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_002209936.1|3910227_3911646_+	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_032466588.1|3911766_3913224_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_011192956.1|3913308_3913827_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_002209933.1|3913933_3914833_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	8.5e-33
WP_002209932.1|3914863_3915580_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_002209931.1|3915586_3917320_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.7	3.6e-64
WP_002228062.1|3917498_3918596_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_002209930.1|3918606_3920124_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.0	1.1e-85
WP_011192954.1|3920556_3921771_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	58.8	3.7e-132
WP_011192953.1|3922497_3924219_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	48.7	5.3e-124
WP_011192952.1|3924215_3924770_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	51.1	1.0e-36
WP_011192951.1|3924762_3925473_-	hypothetical protein	NA	Q94MX8	Haemophilus_virus	25.9	4.2e-11
WP_011192950.1|3925469_3925988_-|tail	tail assembly chaperone	tail	A9DEL3	Yersinia_phage	49.4	4.1e-40
WP_011192949.1|3925987_3927583_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	40.5	2.2e-55
WP_011192948.1|3927592_3928216_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	57.9	1.2e-57
WP_011192947.1|3928208_3929393_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	59.3	3.9e-134
WP_011192946.1|3929389_3929719_-	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	60.4	4.6e-29
WP_011192945.1|3929715_3931692_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	41.0	2.5e-130
WP_012413912.1|3931693_3931873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192944.1|3931917_3932193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192943.1|3932307_3932682_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	40.2	3.2e-10
3932354:3932370	attL	TTTGCTGATAAAGTACG	NA	NA	NA	NA
WP_011192942.1|3932681_3933023_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	77.2	1.1e-41
WP_011192941.1|3933019_3933322_-|holin	holin	holin	C7BGD7	Burkholderia_phage	39.3	2.2e-09
WP_011192940.1|3933331_3933787_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	58.3	7.0e-44
WP_011192939.1|3933789_3934956_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	51.0	2.7e-100
WP_011192938.1|3934979_3935639_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	49.8	4.1e-53
WP_011192937.1|3935635_3936130_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	40.5	2.6e-31
WP_011192936.1|3936126_3936600_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	61.2	6.2e-43
WP_011192935.1|3936708_3937413_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	58.8	8.6e-73
WP_011192934.1|3937415_3938444_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	57.0	2.4e-100
WP_011192933.1|3938478_3939567_-|capsid	phage capsid protein	capsid	A0A2I7RNH1	Vibrio_phage	40.6	6.7e-32
WP_011192932.1|3939739_3941545_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	56.3	8.6e-194
WP_011192931.1|3941541_3942609_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	61.9	3.2e-127
WP_086025326.1|3942665_3942932_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	55.2	4.4e-22
WP_011192928.1|3946095_3946797_-	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	52.7	8.6e-49
WP_011192927.1|3946806_3947472_-	DUF3850 domain-containing protein	NA	A0A1S6KVH3	Escherichia_phage	51.4	6.1e-12
WP_041175470.1|3947471_3947708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192926.1|3947778_3948129_-	DUF5347 family protein	NA	NA	NA	NA	NA
WP_041175469.1|3948140_3948362_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_011192925.1|3948358_3948628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041175468.1|3948774_3949008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012413891.1|3949467_3949680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192923.1|3949676_3949949_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	68.9	8.8e-34
WP_012413890.1|3950062_3950362_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	59.6	6.7e-27
WP_011192921.1|3950428_3951412_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	59.9	3.4e-112
WP_002209928.1|3951553_3951739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214785.1|3952336_3952597_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	36.0	7.4e-06
WP_011192920.1|3952659_3953022_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024063131.1|3953185_3953482_+	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_002209924.1|3953481_3953880_+	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_011192918.1|3954279_3956571_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.6	1.9e-153
3959664:3959680	attR	TTTGCTGATAAAGTACG	NA	NA	NA	NA
>prophage 1
NZ_CP009711	Yersinia pseudotuberculosis IP 32953 strain IP32953 plasmid pYAC_1, complete sequence	68525	6666	30093	68525	protease,transposase	Enterobacteria_phage(50.0%)	23	NA	NA
WP_011191374.1|6666_7635_-|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_011191373.1|8108_8657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071879999.1|9261_9879_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_002220902.1|11896_13063_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_011191369.1|13059_14025_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	4.0e-89
WP_157868821.1|14184_14466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012414146.1|15331_15574_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213360.1|15566_15866_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002229754.1|16005_16665_-	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213403.1|16858_17251_+	YopE transcriptional regulator YerA	NA	NA	NA	NA	NA
WP_011191364.1|18060_19233_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.6	1.8e-221
WP_002213267.1|20008_20434_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_086025330.1|20581_21681_-|transposase	IS3-like element ISYps8 family transposase	transposase	S5WIU1	Leptospira_phage	39.3	5.7e-47
WP_002229829.1|21780_22110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012414143.1|22248_22713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|22731_23283_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002213256.1|23446_25762_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
WP_011191362.1|26746_28045_+	trimeric autotransporter adhesin YadA	NA	Q9MCI8	Enterobacteria_phage	54.2	2.0e-11
WP_106461760.1|28047_28347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469136.1|28373_28643_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|28711_29170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213244.1|29341_29659_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012414142.1|29685_30093_+|transposase	transposase	transposase	S5FNT8	Shigella_phage	42.8	4.4e-21
