The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009367	Yersinia enterocolitica strain WA chromosome, complete genome	4548749	179079	188690	4548749	tRNA	uncultured_Caudovirales_phage(42.86%)	8	NA	NA
WP_011817019.1|179079_180177_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_032909124.1|180187_181705_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.6	2.3e-86
WP_005173446.1|182987_184130_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	21.4	6.4e-09
WP_005173445.1|184374_184725_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
WP_005173444.1|184959_186249_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.7	3.3e-171
WP_005173443.1|186262_186688_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.7	4.9e-47
WP_005173442.1|186967_187363_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_005173439.1|187445_188690_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	3.1e-17
>prophage 2
NZ_CP009367	Yersinia enterocolitica strain WA chromosome, complete genome	4548749	389720	399108	4548749	integrase	Enterobacteria_phage(66.67%)	11	389240:389254	399127:399141
389240:389254	attL	TAAACGTATACCAAT	NA	NA	NA	NA
WP_032912806.1|389720_392054_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	59.6	1.2e-259
WP_005172896.1|392067_392409_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_005172893.1|392405_392669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005172890.1|392665_393211_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	57.7	6.5e-28
WP_032902977.1|393215_393404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005172884.1|393451_393709_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	55.8	1.3e-15
WP_005172881.1|394310_395012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005172879.1|395014_395260_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	52.6	2.6e-13
WP_005172876.1|395588_396341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005172873.1|396358_397582_-	RNA-directed DNA polymerase	NA	A0A0F7LDS3	Escherichia_phage	43.4	1.2e-85
WP_005172869.1|397911_399108_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.1	9.4e-104
399127:399141	attR	ATTGGTATACGTTTA	NA	NA	NA	NA
>prophage 3
NZ_CP009367	Yersinia enterocolitica strain WA chromosome, complete genome	4548749	953511	1022485	4548749	tail,transposase,head,tRNA,capsid,holin,terminase,protease,portal,integrase	Cronobacter_phage(60.53%)	72	943590:943604	1030015:1030029
943590:943604	attL	GTCTCCTGCGCCAAC	NA	NA	NA	NA
WP_005171299.1|953511_954561_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	58.6	3.3e-113
WP_005171294.1|954651_955986_-	NTPase	NA	R9TRQ8	Vibrio_phage	33.0	4.8e-24
WP_005171292.1|956010_956493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005171287.1|956504_957068_-	hypothetical protein	NA	F1BUN8	Cronobacter_phage	40.0	1.9e-35
WP_005171278.1|957196_957418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005171274.1|957450_957960_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	48.8	6.5e-38
WP_005171271.1|957967_958171_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_005171268.1|958173_958548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005171265.1|958557_958965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005171263.1|959043_959283_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_005171260.1|959279_961367_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	61.5	1.3e-230
WP_005171254.1|961474_961663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004389556.1|961663_961936_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	67.4	7.0e-31
WP_005171247.1|961986_963018_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	1.3e-157
WP_005171245.1|963014_964793_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	75.8	5.8e-267
WP_032902883.1|964949_965792_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	41.4	4.6e-49
WP_005171239.1|965845_966871_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	68.2	3.3e-126
WP_005171236.1|966874_967573_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	57.4	4.8e-76
WP_005171232.1|967666_968119_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	69.3	1.3e-53
WP_005171230.1|968115_968607_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	44.5	3.2e-34
WP_005171228.1|968603_969305_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	71.6	4.1e-91
WP_005171226.1|969307_970447_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	66.5	3.2e-138
WP_005171223.1|970443_970899_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	60.9	9.8e-46
WP_005171220.1|970908_971199_+|holin	holin	holin	Q6K1I2	Salmonella_virus	55.1	4.7e-17
WP_005171218.1|971195_971537_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	81.2	6.9e-44
WP_005171215.1|971536_971878_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	42.7	3.3e-14
WP_005171208.1|972027_972294_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	53.7	2.3e-18
WP_005171206.1|972481_974458_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	48.4	9.5e-170
WP_005171205.1|974457_974790_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	65.7	3.3e-35
WP_005171204.1|974782_975967_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	67.0	3.1e-152
WP_005171203.1|975959_976595_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	53.8	8.3e-59
WP_005171202.1|976605_978150_+|tail	tail fiber protein	tail	F1BUK3	Cronobacter_phage	44.1	2.6e-61
WP_005171201.1|978149_978788_+	hypothetical protein	NA	Q9MCR5	Enterobacteria_phage	38.1	1.4e-26
WP_005171200.1|978777_979509_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	39.8	9.0e-41
WP_005171199.1|979474_980026_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	67.0	7.4e-56
WP_005171191.1|980022_981678_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	53.5	5.2e-169
WP_005171186.1|981853_982060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005171183.1|982296_982926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005171180.1|983235_984924_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_102990434.1|985268_986482_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	37.2	1.5e-19
WP_004873700.1|986639_986903_-	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.5	1.0e-26
WP_011816013.1|987217_987526_+	YbjC family protein	NA	NA	NA	NA	NA
WP_005162876.1|987644_988130_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_005171171.1|988575_989685_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_005162870.1|989851_990985_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	1.3e-30
WP_005171167.1|991021_991987_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_005171164.1|991983_992829_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_005171161.1|992978_993455_+	YbjO family protein	NA	NA	NA	NA	NA
WP_005171157.1|993543_994671_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.9	2.2e-30
WP_005171154.1|994796_995546_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005162844.1|996393_997062_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_005171147.1|997061_997778_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_005162826.1|997789_998521_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032899941.1|998541_999291_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.9	2.4e-28
WP_005171143.1|999988_1000564_-	lipoprotein	NA	NA	NA	NA	NA
WP_005171139.1|1000632_1001643_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005171136.1|1001971_1003429_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_005171133.1|1003425_1004445_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_005171118.1|1004583_1005471_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005171116.1|1005703_1007425_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_005171113.1|1007692_1008715_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_100219655.1|1008808_1010392_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_011816027.1|1010657_1011557_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_005171091.1|1011810_1013475_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_005171082.1|1013471_1014455_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_005171081.1|1014646_1015759_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_005171080.1|1015758_1017708_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.7	1.0e-35
WP_005171079.1|1017906_1018164_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.2e-16
WP_004389612.1|1018523_1018844_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_005162786.1|1018869_1021146_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.5e-166
WP_002211347.1|1021390_1021609_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005171078.1|1021774_1022485_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
1030015:1030029	attR	GTCTCCTGCGCCAAC	NA	NA	NA	NA
>prophage 4
NZ_CP009367	Yersinia enterocolitica strain WA chromosome, complete genome	4548749	1221038	1316263	4548749	tail,lysis,plate,transposase,head,capsid,holin,terminase,portal,integrase	Erwinia_phage(34.15%)	96	1268048:1268065	1278889:1278906
WP_005170564.1|1221038_1222232_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	65.2	2.1e-143
WP_005170563.1|1222288_1222600_-	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_005170561.1|1222870_1223131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005158129.1|1226375_1227224_-	serine protein kinase RIO	NA	NA	NA	NA	NA
WP_005170559.1|1227326_1229045_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	2.2e-53
WP_005170558.1|1229244_1229664_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032908459.1|1229931_1231434_+	amino acid permease	NA	NA	NA	NA	NA
WP_005170555.1|1231660_1231843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005158136.1|1232092_1232479_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005170549.1|1233144_1233384_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_005163677.1|1233476_1233710_-	membrane protein	NA	NA	NA	NA	NA
WP_005170546.1|1233955_1234099_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_005170543.1|1234398_1234674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005163675.1|1234875_1235175_+	DUF2591 family protein	NA	K9L3P6	Pectobacterium_phage	44.0	2.2e-09
WP_005170540.1|1235281_1235527_+	DUF4060 family protein	NA	NA	NA	NA	NA
WP_005170536.1|1235718_1237110_+	amino acid permease	NA	NA	NA	NA	NA
WP_005170533.1|1237351_1237966_-	phospholipid:lipid A palmitoyltransferase	NA	NA	NA	NA	NA
WP_002211058.1|1238955_1239072_+	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
WP_002221949.1|1239114_1239324_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	5.3e-23
WP_005170529.1|1239401_1240121_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_005170526.1|1240323_1242033_+	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_005170523.1|1242150_1243011_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_005163660.1|1243173_1243452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005170519.1|1243619_1245701_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	33.3	7.5e-16
WP_005170503.1|1246285_1248562_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005170500.1|1248696_1249266_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_005163652.1|1249706_1250168_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_011816164.1|1250231_1251095_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_004701713.1|1251128_1251926_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_005170493.1|1252143_1253109_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_005170491.1|1253878_1255423_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.2	6.8e-38
WP_005170489.1|1256005_1256221_+	heat-stable enterotoxin YstA	NA	NA	NA	NA	NA
WP_005170488.1|1256311_1257676_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_005170485.1|1258127_1258727_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_005170483.1|1258727_1260098_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	37.5	5.6e-36
WP_005163637.1|1260280_1260538_+	YoaH family protein	NA	NA	NA	NA	NA
WP_005170481.1|1260793_1261975_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_019079712.1|1262228_1263611_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.6	6.7e-53
WP_005170477.1|1263706_1264027_+	YebG family protein	NA	NA	NA	NA	NA
WP_005170475.1|1264065_1264374_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005170472.1|1264479_1264836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005170468.1|1265025_1267080_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_005170462.1|1267091_1267754_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	30.7	2.2e-17
1268048:1268065	attL	TAGATTTACTGTTGGCTC	NA	NA	NA	NA
WP_032908453.1|1268067_1269072_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005170448.1|1269608_1270565_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_004389928.1|1270614_1270848_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.7e-14
WP_005170444.1|1271231_1271741_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_005170441.1|1272143_1272530_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_005170439.1|1272531_1273416_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_005170437.1|1273512_1273854_+	YebY family protein	NA	NA	NA	NA	NA
WP_032908452.1|1274179_1275178_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	57.4	1.1e-110
WP_005170435.1|1275402_1275621_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	70.8	2.0e-25
WP_005170434.1|1275713_1276856_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	66.0	1.7e-142
WP_005170432.1|1276852_1277305_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	63.9	3.2e-49
WP_005170430.1|1279728_1279851_-|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	68.4	9.7e-09
1278889:1278906	attR	TAGATTTACTGTTGGCTC	NA	NA	NA	NA
WP_005170427.1|1279883_1280171_-|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	60.5	1.3e-22
WP_005170424.1|1280187_1280703_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	70.2	5.3e-64
WP_005170423.1|1280716_1281886_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	77.1	2.1e-177
WP_005170420.1|1282147_1282333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072075874.1|1282901_1283846_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.7	5.0e-76
WP_005170412.1|1284050_1284227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032908451.1|1284693_1285308_-|tail	tail protein	tail	Q9MCR5	Enterobacteria_phage	35.8	1.3e-29
WP_005170403.1|1286686_1287229_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	77.2	2.7e-82
WP_005170400.1|1287221_1288130_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	78.5	5.2e-123
WP_005170397.1|1288134_1288485_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	69.0	6.9e-39
WP_005170392.1|1288969_1289290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005170388.1|1289279_1289486_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_005170385.1|1289866_1290127_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_005170383.1|1290133_1290412_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_005170378.1|1290883_1291513_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	62.7	1.7e-67
WP_005170376.1|1291693_1292947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005170374.1|1292943_1293984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005170370.1|1294027_1294486_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	61.9	5.4e-44
WP_005170367.1|1294482_1294938_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	62.7	2.2e-45
WP_005170361.1|1295033_1295450_-|lysis	LysB family phage lysis regulatory protein	lysis	NA	NA	NA	NA
WP_032908448.1|1295451_1295958_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	61.9	9.2e-53
WP_071882656.1|1295941_1296163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005170353.1|1296153_1296357_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	64.2	1.2e-19
WP_005170349.1|1296356_1296830_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	44.6	5.1e-29
WP_005170347.1|1296930_1297590_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	68.0	1.7e-78
WP_005170338.1|1297593_1298724_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	71.6	5.7e-143
WP_005170329.1|1298752_1299595_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	60.0	8.6e-88
WP_005166743.1|1299986_1300295_+|transposase	transposase	transposase	Q716C1	Shigella_phage	45.0	2.6e-18
WP_005170313.1|1302756_1303758_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	77.3	6.5e-151
WP_005170310.1|1303814_1304336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005170307.1|1304367_1304688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005170304.1|1305038_1307519_-	N-6 DNA methylase	NA	A0A0P0ZG22	Escherichia_phage	58.1	4.8e-110
WP_005170303.1|1307793_1307949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102990426.1|1308256_1309295_+|transposase	IS3-like element ISYen3 family transposase	transposase	S5WIU1	Leptospira_phage	36.5	3.7e-40
WP_032908439.1|1310131_1310527_+	exported phage-related protein	NA	NA	NA	NA	NA
WP_005166766.1|1310526_1310823_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	37.7	1.9e-05
WP_005166765.1|1310809_1311352_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	79.3	1.6e-82
WP_032902418.1|1311397_1311847_+|lysis	lysis protein	lysis	B0FEE8	Escherichia_phage	48.4	7.0e-28
WP_005166760.1|1311960_1312152_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_005166773.1|1313200_1313737_+	attachment invasion locus protein Ail	NA	A0A1B0VBR9	Salmonella_phage	39.3	4.9e-28
WP_005166743.1|1315954_1316263_-|transposase	transposase	transposase	Q716C1	Shigella_phage	45.0	2.6e-18
>prophage 5
NZ_CP009367	Yersinia enterocolitica strain WA chromosome, complete genome	4548749	1339630	1406274	4548749	transposase,coat,tRNA,protease	Bacillus_phage(14.29%)	61	NA	NA
WP_005170237.1|1339630_1340641_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_005170235.1|1340671_1343113_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_005170230.1|1343199_1343949_-	molecular chaperone	NA	NA	NA	NA	NA
WP_005170228.1|1343995_1344553_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_005170225.1|1344563_1345121_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_005170224.1|1345126_1345663_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_005170223.1|1345990_1347415_-	MFS transporter	NA	NA	NA	NA	NA
WP_005170222.1|1347543_1348464_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005170221.1|1348476_1351107_-	PqiB family protein	NA	NA	NA	NA	NA
WP_005170219.1|1351075_1352323_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_005164942.1|1352582_1353080_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_005170218.1|1353175_1353904_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_005170217.1|1353923_1355999_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.4	3.3e-88
WP_005170215.1|1356293_1357175_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_080287090.1|1357580_1358600_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005170197.1|1358777_1359206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005170186.1|1359356_1359995_-	YadA C-terminal domain-containing protein	NA	A0A2C9CZB7	Yersinia_phage	33.3	5.7e-07
WP_005170184.1|1360304_1360706_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005170182.1|1360730_1362098_-	MFS transporter	NA	NA	NA	NA	NA
WP_005170180.1|1362422_1363589_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_005164952.1|1363775_1364567_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_005170179.1|1364842_1365694_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	29.0	9.6e-10
WP_005170175.1|1365918_1367310_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_005170172.1|1367528_1368077_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	34.1	2.9e-07
WP_005170169.1|1368434_1369133_-	porin	NA	NA	NA	NA	NA
WP_005170166.1|1369438_1370731_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005161697.1|1370746_1371874_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.0e-11
WP_005170162.1|1371887_1372805_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_005161668.1|1372797_1373688_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_005170160.1|1373728_1375396_-	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_005161658.1|1375723_1376485_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.3	2.0e-19
WP_005170151.1|1376596_1377433_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_005170147.1|1377670_1378003_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005170145.1|1378113_1378779_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_005170142.1|1379028_1379583_+	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_005161637.1|1379952_1380843_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032908427.1|1380839_1382321_-	succinate CoA transferase	NA	NA	NA	NA	NA
WP_005170131.1|1382346_1383132_-	methylmalonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_005170128.1|1383145_1384141_-	methylmalonyl Co-A mutase-associated GTPase MeaB	NA	NA	NA	NA	NA
WP_005170125.1|1384133_1386278_-	methylmalonyl-CoA mutase	NA	NA	NA	NA	NA
WP_005170122.1|1386564_1387434_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_005170116.1|1387849_1388737_-	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_005170114.1|1388733_1389618_-	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_005170112.1|1389617_1390508_-	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.9	2.2e-09
WP_005170110.1|1390504_1391473_-	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_005170108.1|1391684_1392347_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_005161586.1|1392558_1393242_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_005161584.1|1393682_1393934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005170103.1|1394021_1394360_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_005170100.1|1394404_1394641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005161579.1|1394706_1394886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005161573.1|1396249_1396462_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_005170086.1|1396785_1398714_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	7.4e-127
WP_011816226.1|1398717_1399269_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_004713020.1|1399365_1399563_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004393357.1|1399600_1399957_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152414234.1|1400025_1400073_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005161570.1|1400421_1401405_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_005170082.1|1401419_1403807_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	26.8	1.5e-07
WP_002211830.1|1403811_1404108_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_072075853.1|1405389_1406274_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	46.6	2.6e-74
>prophage 6
NZ_CP009367	Yersinia enterocolitica strain WA chromosome, complete genome	4548749	2030080	2042209	4548749		Paramecium_bursaria_Chlorella_virus(16.67%)	7	NA	NA
WP_005168752.1|2030080_2032783_-	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.7	2.5e-43
WP_005168749.1|2032999_2033698_-	MgtC family protein	NA	G3MA03	Bacillus_virus	40.3	1.8e-14
WP_005168746.1|2034834_2036574_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.8	3.9e-10
WP_071530598.1|2036706_2036943_-	protein DsrB	NA	NA	NA	NA	NA
WP_002210893.1|2037151_2037364_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_005168744.1|2037845_2038880_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	50.0	9.3e-84
WP_005168742.1|2039056_2042209_+	beta-galactosidase	NA	B9U1H7	Vaccinia_virus	62.8	0.0e+00
>prophage 7
NZ_CP009367	Yersinia enterocolitica strain WA chromosome, complete genome	4548749	2520586	2575889	4548749	transposase,tail,tRNA,integrase	Escherichia_phage(30.0%)	52	2561294:2561339	2575899:2575944
WP_032912647.1|2520586_2523169_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	2.1e-185
WP_011816836.1|2523183_2523807_+	LPS assembly lipoprotein LptE	NA	NA	NA	NA	NA
WP_005167898.1|2523803_2524838_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_005167896.1|2524827_2525490_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005167894.1|2525789_2526107_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_004390602.1|2526110_2526581_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005167891.1|2526655_2528551_+	peptidoglycan DD-transpeptidase MrdA	NA	NA	NA	NA	NA
WP_005167889.1|2528587_2529700_+	peptidoglycan glycosyltransferase MrdB	NA	NA	NA	NA	NA
WP_005167887.1|2529709_2530807_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	52.6	2.6e-15
WP_005167886.1|2531020_2532232_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	51.3	2.3e-105
WP_005158389.1|2532380_2532644_+	YbeD family protein	NA	NA	NA	NA	NA
WP_005167883.1|2532801_2533485_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004712243.1|2533700_2534666_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_005167881.1|2534808_2535024_-	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
WP_020283421.1|2535227_2536280_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.1e-15
WP_005167877.1|2536327_2536711_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.2	3.6e-25
WP_004716300.1|2537010_2537220_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	76.6	1.7e-21
WP_005158372.1|2537486_2537966_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_005167874.1|2538151_2538742_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011816843.1|2539115_2540081_+	membrane protein	NA	NA	NA	NA	NA
WP_005167870.1|2540231_2540876_-	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	56.5	2.2e-67
WP_005167868.1|2541126_2541321_-	glycogen synthase	NA	NA	NA	NA	NA
WP_005167867.1|2541667_2541955_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005167865.1|2541972_2543745_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.7	3.5e-46
WP_005167861.1|2544257_2545733_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_005167859.1|2545762_2547358_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	32.5	1.3e-55
WP_011816845.1|2547815_2548937_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005167856.1|2549325_2550375_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005167853.1|2550610_2551300_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	2.3e-30
WP_005167851.1|2551315_2552791_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_032909232.1|2553314_2554079_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_032902559.1|2554175_2555240_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005167842.1|2555370_2556222_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.4	3.6e-49
WP_005167839.1|2556381_2556708_-	EthD family reductase	NA	NA	NA	NA	NA
WP_032909387.1|2556942_2557854_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005167835.1|2557856_2558972_-	alkene reductase	NA	NA	NA	NA	NA
WP_005158316.1|2559607_2559946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005167828.1|2559930_2560578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005167826.1|2560801_2561020_+	hypothetical protein	NA	NA	NA	NA	NA
2561294:2561339	attL	ATGGTACGCCCTACAGGGCTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_005167824.1|2561635_2562595_+	DUF2219 family protein	NA	NA	NA	NA	NA
WP_005167816.1|2563719_2564289_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	57.8	6.7e-52
WP_005167814.1|2564296_2564950_-	hypothetical protein	NA	A0A076GCJ9	Escherichia_phage	73.6	5.6e-34
WP_005167812.1|2565057_2565951_-|tail	putative phage tail fiber protein	tail	A0A0U2SH60	Escherichia_phage	79.8	3.9e-46
WP_005167810.1|2566086_2567076_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_005167808.1|2567187_2567766_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	55.5	2.3e-55
WP_005167806.1|2567765_2569103_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	60.0	2.4e-71
WP_005167804.1|2569099_2569726_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	81.7	7.8e-102
WP_071530591.1|2569709_2570915_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	79.2	5.1e-182
WP_042593232.1|2571203_2572208_-|transposase	IS110-like element IS1328 family transposase	transposase	NA	NA	NA	NA
WP_005170564.1|2572380_2573574_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	65.2	2.1e-143
WP_005167799.1|2573632_2574055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005167794.1|2574722_2575889_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4R586	Salmonella_phage	74.2	1.3e-171
2575899:2575944	attR	ATGGTACGCCCTACAGGGCTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 8
NZ_CP009367	Yersinia enterocolitica strain WA chromosome, complete genome	4548749	4235943	4253169	4548749		Escherichia_phage(18.75%)	26	NA	NA
WP_005174545.1|4235943_4236195_-	hypothetical protein	NA	S5MQM5	Escherichia_phage	57.8	1.3e-20
WP_005174541.1|4237121_4237394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005174539.1|4237386_4237944_-	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	32.3	6.2e-10
WP_005174531.1|4238116_4238647_-	hypothetical protein	NA	K7PKJ9	Enterobacteria_phage	60.5	7.4e-53
WP_005174529.1|4238740_4239568_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	60.2	1.0e-85
WP_005174527.1|4239612_4239984_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	74.2	1.8e-45
WP_005174526.1|4240257_4240491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005174523.1|4240487_4240748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005174521.1|4241154_4241796_-	LexA family transcriptional regulator	NA	A0A1W6JP50	Morganella_phage	62.6	4.4e-60
WP_005174518.1|4241898_4242096_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	65.5	1.2e-16
WP_005174516.1|4242124_4242652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005174515.1|4242817_4243015_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_005174513.1|4243011_4244034_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	72.6	3.7e-32
WP_005174508.1|4244656_4245040_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	65.8	4.2e-42
WP_005174506.1|4245139_4245958_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	66.9	2.0e-97
WP_005174503.1|4245954_4246980_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.8e-91
WP_005174501.1|4246976_4247390_+	antitermination protein	NA	S5M7R9	Escherichia_phage	54.8	3.3e-32
WP_005174496.1|4247584_4248208_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005174495.1|4248388_4248841_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005174494.1|4249180_4249798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005174493.1|4249929_4250601_-	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	39.6	4.7e-36
WP_005174492.1|4250599_4250779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005174491.1|4250967_4251183_+	peptidoglycan-binding protein LysM	NA	H9C183	Pectobacterium_phage	54.0	2.0e-12
WP_005174486.1|4251182_4251713_+	lysozyme	NA	Q7Y3V3	Yersinia_phage	70.9	2.7e-71
WP_005174484.1|4251705_4252083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005174482.1|4252635_4253169_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	84.1	4.5e-82
>prophage 9
NZ_CP009367	Yersinia enterocolitica strain WA chromosome, complete genome	4548749	4256925	4315749	4548749	tail,plate,transposase,head,tRNA,capsid,terminase,portal,integrase	Salmonella_phage(10.34%)	57	4274965:4274979	4318825:4318839
WP_005174471.1|4256925_4259034_+|terminase	terminase	terminase	K4I3Y9	Acidithiobacillus_phage	39.3	3.6e-98
WP_005174469.1|4259042_4259306_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_005174467.1|4259374_4260958_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.2	7.8e-98
WP_005174465.1|4260954_4261812_+	S49 family peptidase	NA	K7P7A7	Enterobacteria_phage	40.2	6.0e-52
WP_005174463.1|4261811_4262402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005174461.1|4262401_4262803_+|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	36.3	8.2e-12
WP_005174459.1|4262912_4263959_+|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	31.8	3.7e-40
WP_005174457.1|4263960_4264455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005174454.1|4264454_4264799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005174451.1|4264795_4265341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005174449.1|4265346_4265538_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_005174446.1|4265537_4267028_+|tail	tail protein	tail	B5TK67	Pseudomonas_phage	46.4	1.7e-107
WP_005174443.1|4267040_4267415_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_005174440.1|4267416_4267719_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_005174437.1|4267836_4269636_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	32.2	1.0e-24
WP_005174430.1|4269675_4270074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005174428.1|4270143_4271550_+	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	28.1	5.6e-23
WP_005174426.1|4271546_4272617_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.6	2.0e-41
WP_005174424.1|4272616_4273210_+|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	42.4	9.9e-06
WP_005174422.1|4273206_4273644_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	46.2	2.3e-20
WP_005174420.1|4273647_4274784_+|plate	baseplate J/gp47 family protein	plate	B6SBU6	Clostridium_virus	26.8	3.4e-10
WP_005174418.1|4274780_4275377_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.8	4.3e-33
4274965:4274979	attL	CAGCAATGTTACCCG	NA	NA	NA	NA
WP_086017224.1|4275649_4276258_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.5	4.9e-32
WP_005174415.1|4276257_4276878_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	43.6	1.0e-32
WP_032912710.1|4276978_4278172_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	61.2	2.0e-138
WP_005174413.1|4278200_4279289_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	70.5	1.8e-149
WP_032903138.1|4279378_4280425_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005165239.1|4280631_4280850_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_005174410.1|4281190_4281517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005174407.1|4281729_4282713_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005165232.1|4282902_4284309_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.7	7.4e-193
WP_005174405.1|4284338_4285418_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.3	6.8e-29
WP_005174392.1|4285475_4286669_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_005174391.1|4287135_4287489_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_005174389.1|4287547_4290379_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.7e-308
WP_005174387.1|4290778_4291330_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	88.0	1.1e-56
WP_005174384.1|4291394_4292723_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_005174382.1|4292724_4293024_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005174380.1|4293292_4293964_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005174378.1|4294439_4295807_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	74.1	4.1e-164
WP_005174376.1|4296021_4297671_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_005174372.1|4297677_4298604_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005174370.1|4298732_4299158_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_005174368.1|4299150_4299840_+	LrgB family protein	NA	NA	NA	NA	NA
WP_005174366.1|4299910_4300672_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.3	2.0e-19
WP_032903139.1|4300680_4301784_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005174362.1|4301799_4302978_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005174361.1|4303184_4304210_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	37.2	3.3e-65
WP_005174360.1|4304632_4306171_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_005174358.1|4306430_4307351_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	8.0e-79
WP_005170564.1|4309677_4310871_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	65.2	2.1e-143
WP_005163087.1|4311031_4311244_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.4e-25
WP_005163090.1|4311511_4311724_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	1.7e-24
WP_005174352.1|4312123_4312594_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005174351.1|4312835_4314395_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.8	8.4e-20
WP_002210061.1|4314466_4314763_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005174350.1|4314783_4315749_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
4318825:4318839	attR	CAGCAATGTTACCCG	NA	NA	NA	NA
>prophage 10
NZ_CP009367	Yersinia enterocolitica strain WA chromosome, complete genome	4548749	4336506	4392029	4548749	transposase,protease	Paramecium_bursaria_Chlorella_virus(18.18%)	54	NA	NA
WP_005174328.1|4336506_4337952_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005174326.1|4338023_4338935_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_005174323.1|4339247_4339451_+	AaeX family protein	NA	NA	NA	NA	NA
WP_005174322.1|4339458_4340394_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_005174321.1|4340395_4342351_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_005174317.1|4342472_4343966_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005174314.1|4344063_4344537_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_005174312.1|4344541_4344808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005174310.1|4344959_4345505_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_005174309.1|4345673_4347014_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_005174308.1|4347203_4347590_+	cytochrome b562	NA	NA	NA	NA	NA
WP_005174306.1|4347638_4348049_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_005174305.1|4348580_4348925_+	glycine dehydrogenase	NA	NA	NA	NA	NA
WP_004392359.1|4348948_4349314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005174302.1|4349313_4349610_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_005174296.1|4349623_4350400_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_005174295.1|4350421_4351072_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_005174294.1|4351266_4352436_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_005174293.1|4352419_4353532_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_005174290.1|4353535_4354276_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_005174287.1|4354385_4355609_+	lactonase family protein	NA	NA	NA	NA	NA
WP_032903125.1|4355710_4357609_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_005174283.1|4357730_4360451_-	magnesium-translocating P-type ATPase	NA	M1HN09	Paramecium_bursaria_Chlorella_virus	26.5	1.0e-41
WP_005174281.1|4360957_4361905_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_011817268.1|4362121_4363537_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_005174276.1|4363604_4365266_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_005174271.1|4365652_4366387_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_005174269.1|4366410_4367232_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005174267.1|4367228_4368158_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_005162498.1|4369859_4370246_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_004392342.1|4370761_4371226_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_005174264.1|4371237_4372173_-	aspartate carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	39.5	2.3e-49
WP_144404894.1|4373987_4374929_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.7	2.6e-48
WP_071882663.1|4374849_4375137_-|transposase	transposase	transposase	Q716C1	Shigella_phage	47.3	7.1e-18
WP_005162489.1|4375974_4376247_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_005162486.1|4376247_4377099_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.9e-05
WP_005162484.1|4377177_4377660_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_005162480.1|4377830_4378118_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_005174257.1|4378141_4379575_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004392029.1|4379637_4380363_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.6e-21
WP_005162470.1|4380369_4380915_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_005174254.1|4380898_4381462_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_005174251.1|4381458_4382022_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	80.0	5.3e-57
WP_005174250.1|4382035_4383040_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	29.5	5.7e-38
WP_005174248.1|4383070_4384045_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_005162453.1|4384450_4385254_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	1.3e-19
WP_005174247.1|4385268_4386051_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_011817261.1|4386055_4386616_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_005174244.1|4386628_4387255_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_032903113.1|4387257_4387581_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_005162441.1|4387755_4388010_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_005162439.1|4388131_4389400_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005174240.1|4389478_4390567_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	33.8	1.4e-10
WP_005174239.1|4390655_4392029_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.3e-21
