The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010088	Bacillus thuringiensis strain 97-27 chromosome, complete genome	5235838	250674	257776	5235838		Bacillus_phage(71.43%)	7	NA	NA
WP_009879021.1|250674_251259_-	hypothetical protein	NA	A0A288WFQ7	Bacillus_phage	77.0	1.9e-81
WP_000571537.1|251236_252427_-	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	64.4	1.2e-148
WP_000156980.1|252545_252728_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	80.0	2.4e-19
WP_001267637.1|252724_253027_-	hypothetical protein	NA	A0A288WG38	Bacillus_phage	51.5	3.1e-24
WP_000649834.1|253192_253393_+	helix-turn-helix domain-containing protein	NA	A0A288WG80	Bacillus_phage	76.6	9.0e-20
WP_000637735.1|253429_253894_+	restriction endonuclease	NA	Q331T5	Clostridium_botulinum_C_phage	43.2	7.0e-15
WP_000249923.1|256570_257776_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	47.4	1.4e-51
>prophage 2
NZ_CP010088	Bacillus thuringiensis strain 97-27 chromosome, complete genome	5235838	549429	558164	5235838		Bacillus_phage(71.43%)	9	NA	NA
WP_001258548.1|549429_550302_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	46.6	7.9e-68
WP_002036196.1|550444_550558_-	hypothetical protein	NA	W8CYT3	Bacillus_phage	91.7	2.1e-05
WP_000818985.1|550674_551394_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000823556.1|551589_552177_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_001231492.1|552201_553275_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	88.2	2.7e-171
WP_128294964.1|553271_553958_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	93.4	8.5e-118
WP_000453764.1|554037_555798_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.5	8.2e-266
WP_001194301.1|556038_556803_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755548.1|556901_558164_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	2.6e-11
>prophage 3
NZ_CP010088	Bacillus thuringiensis strain 97-27 chromosome, complete genome	5235838	2113417	2121794	5235838		Synechococcus_phage(33.33%)	8	NA	NA
WP_000088592.1|2113417_2114005_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	1.2e-27
WP_001262435.1|2114001_2115042_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.4	1.2e-67
WP_000879029.1|2115148_2116564_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_000055546.1|2116548_2118768_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	40.8	1.1e-161
WP_000666779.1|2118751_2119435_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|2119431_2119686_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170550.1|2119678_2120398_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	2.0e-48
WP_000625683.1|2120486_2121794_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
>prophage 4
NZ_CP010088	Bacillus thuringiensis strain 97-27 chromosome, complete genome	5235838	2160734	2168683	5235838		Bacillus_phage(33.33%)	6	NA	NA
WP_000719242.1|2160734_2162240_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.9	2.3e-30
WP_000929888.1|2162223_2162925_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_000833093.1|2163069_2164395_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	5.4e-44
WP_000743901.1|2164779_2166318_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	2.6e-21
WP_001029999.1|2166725_2168360_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
WP_000917306.1|2168398_2168683_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.2e-20
>prophage 5
NZ_CP010088	Bacillus thuringiensis strain 97-27 chromosome, complete genome	5235838	2433775	2487523	5235838	transposase,protease,holin,tRNA,integrase	Streptococcus_phage(15.0%)	50	2416502:2416521	2464875:2464894
2416502:2416521	attL	AATACCACCGTCAGCGATAA	NA	NA	NA	NA
WP_000727748.1|2433775_2434543_+|integrase	YidC family membrane integrase SpoIIIJ	integrase	NA	NA	NA	NA
WP_000022803.1|2434539_2435157_+	protein jag	NA	NA	NA	NA	NA
WP_000393777.1|2435383_2436760_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_000541039.1|2436806_2438696_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_001019621.1|2438717_2439437_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_000799028.1|2439541_2440414_+	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	36.1	3.5e-15
WP_000516114.1|2440604_2441366_+	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	29.7	6.1e-24
WP_002157755.1|2441352_2442210_+	stage 0 sporulation protein Spo0J	NA	I3NLC2	Bifidobacterium_phage	32.8	4.3e-18
WP_001020723.1|2442230_2442827_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	41.2	1.3e-24
WP_000382909.1|2443086_2443968_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000436051.1|2443988_2444186_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000524669.1|2444301_2445402_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001233779.1|2445593_2445884_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000981967.1|2445910_2446432_+	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	62.4	1.8e-51
WP_000918874.1|2446477_2446711_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_000799149.1|2446791_2447727_+	YybS family protein	NA	NA	NA	NA	NA
WP_001113900.1|2447805_2449779_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_000864235.1|2449775_2450222_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001286244.1|2450249_2451611_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	6.6e-122
WP_000100223.1|2451826_2453116_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	35.9	1.9e-70
WP_000971872.1|2454032_2454740_+	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	42.7	9.9e-45
WP_000755373.1|2454743_2456585_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.0	8.9e-37
WP_000061593.1|2456581_2457898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000383727.1|2457878_2458721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000522833.1|2458704_2459499_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.3	1.0e-42
WP_000008056.1|2459562_2460738_+|protease	serine protease	protease	W5SAB9	Pithovirus	31.9	5.0e-09
WP_011181940.1|2460791_2460977_+	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_001027004.1|2461036_2461516_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_000713634.1|2461652_2462531_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000655834.1|2462568_2464386_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	39.4	2.3e-122
WP_000432434.1|2464520_2465504_-	GMP reductase	NA	G3MBI2	Bacillus_virus	84.7	7.6e-160
2464875:2464894	attR	AATACCACCGTCAGCGATAA	NA	NA	NA	NA
WP_000827020.1|2465744_2466776_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.2	2.2e-16
WP_000037430.1|2466964_2468410_+	ATP-dependent RNA helicase DbpA	NA	A0A1V0SBR7	Catovirus	32.5	1.0e-56
WP_042515422.1|2468667_2469906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427909.1|2470030_2470591_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_000995319.1|2470755_2471403_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000996163.1|2471627_2472644_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	50.4	4.4e-94
WP_001128266.1|2472787_2473189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000386790.1|2473615_2474206_+	acetamide transporter	NA	NA	NA	NA	NA
WP_000976957.1|2474311_2475193_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000094048.1|2475281_2475908_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	5.9e-57
WP_000047612.1|2476124_2477195_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_001242456.1|2477557_2479126_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.9	1.6e-18
WP_001103441.1|2479242_2480541_-	MFS transporter	NA	NA	NA	NA	NA
WP_000933594.1|2480869_2482639_+	two-component system sensor histidine kinase LytS	NA	Q9EYF3	Enterobacteria_phage	30.6	9.7e-65
WP_000921829.1|2482616_2483357_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000104901.1|2483489_2483921_+|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_000168869.1|2483955_2484648_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_001166018.1|2484974_2486009_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_076611647.1|2486148_2487523_+|transposase	IS1182-like element ISBth7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.2	1.7e-80
>prophage 6
NZ_CP010088	Bacillus thuringiensis strain 97-27 chromosome, complete genome	5235838	2910574	2955481	5235838	protease,transposase,coat	Planktothrix_phage(22.22%)	55	NA	NA
WP_000048030.1|2910574_2911288_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001180555.1|2911434_2911620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001002987.1|2911633_2911882_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011181911.1|2911871_2913077_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000666170.1|2913099_2914113_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000713757.1|2914170_2914818_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000826898.1|2914961_2915489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350644.1|2915914_2916304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920742.1|2916454_2916844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000494859.1|2917345_2917585_+	DUF3937 family protein	NA	NA	NA	NA	NA
WP_000218967.1|2918115_2918481_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	48.6	6.7e-21
WP_000026899.1|2918522_2918906_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000640869.1|2919334_2919679_+	DNA primase	NA	NA	NA	NA	NA
WP_000568169.1|2919691_2919991_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000781213.1|2920145_2920490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000601752.1|2920900_2921926_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	5.0e-29
WP_000359553.1|2921918_2922584_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000735115.1|2922607_2923420_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000722409.1|2923494_2924301_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000929158.1|2924540_2925326_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.8	9.7e-09
WP_000152183.1|2925341_2926634_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_001020769.1|2926633_2927854_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.6	5.2e-118
WP_000009523.1|2927843_2928275_+	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	37.6	1.5e-14
WP_001118827.1|2928323_2929721_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_080775881.1|2930566_2931958_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000248463.1|2932023_2932326_+	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_000021812.1|2932380_2933112_+	sporulation protein YunB	NA	NA	NA	NA	NA
WP_000944691.1|2933148_2934132_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_000166375.1|2934321_2935218_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_000272729.1|2935238_2935718_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_000721031.1|2935792_2936347_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_042515445.1|2936450_2936924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002003767.1|2936949_2937765_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001240990.1|2937850_2938582_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000744049.1|2938619_2939195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435943.1|2939313_2939616_+	YutD family protein	NA	NA	NA	NA	NA
WP_001174577.1|2939662_2940160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000084192.1|2940351_2941431_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJA0	Virus_Rctr71	25.2	4.5e-12
WP_000392606.1|2941672_2941939_-	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_000439090.1|2941956_2942928_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000274012.1|2943075_2943516_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000503330.1|2943587_2944220_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000276467.1|2944329_2945094_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_000289900.1|2945209_2945740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000683453.1|2945773_2946355_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001021173.1|2946556_2947345_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	6.7e-34
WP_001267745.1|2947328_2949902_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_000351160.1|2950404_2950884_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000665093.1|2950904_2951396_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	54.4	1.6e-41
WP_000581264.1|2951516_2952518_+|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_001125500.1|2952579_2952795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000431159.1|2953106_2953343_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_000248594.1|2953549_2953858_+	YuzD family protein	NA	NA	NA	NA	NA
WP_000494437.1|2953826_2954705_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000379273.1|2954803_2955481_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
