The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009968	Bacillus cereus E33L chromosome, complete genome	5305318	1118601	1184231	5305318	tRNA,coat,protease,integrase	Klosneuvirus(22.22%)	59	1118476:1118506	1128302:1128332
1118476:1118506	attL	TCGGGAGTTCGAATCTCTCCTGGGACGCTAA	NA	NA	NA	NA
WP_000044633.1|1118601_1119570_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_158319937.1|1120911_1121076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000410862.1|1121609_1122491_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000215609.1|1123182_1123746_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	51.6	1.3e-42
WP_001052983.1|1125417_1126122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001006390.1|1126376_1126583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788464.1|1127153_1127906_+	HNH endonuclease	NA	R9R1V0	Lactococcus_phage	31.2	3.9e-07
WP_000124459.1|1128739_1128940_+	hypothetical protein	NA	NA	NA	NA	NA
1128302:1128332	attR	TCGGGAGTTCGAATCTCTCCTGGGACGCTAA	NA	NA	NA	NA
WP_011198998.1|1129493_1130363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000475208.1|1130568_1131183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158319938.1|1131340_1131505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001983650.1|1131793_1132042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000358282.1|1132239_1133238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729253.1|1133547_1134825_+	trigger factor	NA	NA	NA	NA	NA
WP_000472282.1|1135089_1136349_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.1	1.3e-148
WP_009879805.1|1136455_1138126_+|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.0	9.6e-14
WP_000097297.1|1138309_1140640_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.8	1.7e-178
WP_000869113.1|1140636_1141233_+	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000359781.1|1141265_1141682_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000133920.1|1141684_1142137_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000547859.1|1142552_1143887_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000008996.1|1143904_1144738_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_001226417.1|1144753_1145683_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000992372.1|1145685_1146438_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001087058.1|1146458_1147448_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000712929.1|1147447_1148737_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_144405449.1|1148816_1149836_+	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000367000.1|1149898_1150924_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_000072217.1|1151317_1153963_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.7	4.7e-164
WP_000582074.1|1154056_1155358_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000360985.1|1155523_1156486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001226271.1|1156707_1157283_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_001013376.1|1157329_1158007_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000466737.1|1158164_1159184_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_001135500.1|1159225_1160077_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000975750.1|1160091_1160637_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000391517.1|1160672_1161359_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000503310.1|1161361_1162159_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000797458.1|1162292_1163039_+	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000599070.1|1163031_1163892_+	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000855453.1|1163959_1165351_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000270907.1|1165516_1165825_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_001973720.1|1165836_1166181_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000944957.1|1166184_1166475_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001037004.1|1166538_1167087_+	sporulation protein	NA	NA	NA	NA	NA
WP_000496111.1|1167086_1168373_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_000276717.1|1168512_1169220_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000865393.1|1169209_1170292_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000114531.1|1170385_1171162_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.2e-19
WP_001011370.1|1171136_1173059_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001026343.1|1173108_1175025_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000621722.1|1175121_1175973_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_000510702.1|1176054_1176702_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000812272.1|1176783_1177326_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000973792.1|1177325_1178468_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	28.9	4.5e-31
WP_001138514.1|1178619_1180149_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001092215.1|1180168_1181002_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_000025289.1|1181032_1182139_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_000690817.1|1182365_1184231_+|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
>prophage 2
NZ_CP009968	Bacillus cereus E33L chromosome, complete genome	5305318	1867548	1919272	5305318	portal,protease,tail,head,integrase,capsid	Bacillus_phage(43.9%)	57	1867076:1867091	1885594:1885609
1867076:1867091	attL	AAAATTAATTAGATTT	NA	NA	NA	NA
WP_000450308.1|1867548_1868514_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000438184.1|1868627_1869584_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	44.0	6.0e-53
WP_000312262.1|1869853_1870477_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000391387.1|1870569_1871844_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000460301.1|1871836_1873108_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_000656783.1|1873282_1873672_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_000135328.1|1873720_1875055_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_000135915.1|1875169_1876315_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.0	7.4e-66
WP_000673782.1|1876539_1876968_-	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	55.1	2.8e-34
WP_000579784.1|1876990_1877419_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	48.6	5.1e-28
WP_000791069.1|1877556_1877802_+	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	60.3	1.7e-12
WP_000517003.1|1877801_1878512_+	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	50.5	1.7e-52
WP_000483547.1|1878531_1878798_+	hypothetical protein	NA	S5MC08	Brevibacillus_phage	57.0	6.6e-26
WP_000510718.1|1878948_1879266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000780688.1|1879515_1879998_+	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	47.5	1.2e-33
WP_001002738.1|1879994_1880666_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	45.8	8.0e-28
WP_000849733.1|1880679_1880952_+	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	80.9	6.5e-37
WP_000067432.1|1880948_1881713_+	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	51.7	7.4e-62
WP_001229823.1|1881648_1882479_+	ATP-binding protein	NA	U5PWH5	Bacillus_phage	38.7	1.2e-36
WP_000573308.1|1882502_1882691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861090.1|1882854_1883484_+	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	41.4	4.4e-28
WP_000553935.1|1883486_1883609_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_000615367.1|1883703_1884276_+	dUTPase	NA	A0A0A7AQI4	Bacillus_phage	73.3	1.3e-79
WP_000382670.1|1884314_1885061_+	FAD-dependent thymidylate synthase	NA	A0A2P1JUN2	Bacillus_phage	62.2	2.5e-78
WP_001032094.1|1885164_1885377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424750.1|1885597_1886113_-	restriction endonuclease	NA	NA	NA	NA	NA
1885594:1885609	attR	AAAATTAATTAGATTT	NA	NA	NA	NA
WP_000520474.1|1886242_1886530_+	hypothetical protein	NA	A6M999	Geobacillus_virus	71.3	1.4e-34
WP_000884068.1|1886534_1886909_+	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	70.7	6.4e-43
WP_000269812.1|1887023_1887539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144405479.1|1887890_1889558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001153107.1|1890486_1890990_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	57.5	1.2e-47
WP_000022946.1|1891167_1892100_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000783765.1|1892413_1894162_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001066886.1|1894362_1895355_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_011198935.1|1895969_1896248_+	helix-turn-helix domain-containing protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	43.8	1.5e-09
WP_000109231.1|1896316_1896739_-	pilus biosynthesis protein HicB	NA	A0A1L2JY34	Aeribacillus_phage	58.3	2.6e-40
WP_001051279.1|1897503_1897800_+	hypothetical protein	NA	R9TNN2	Paenibacillus_phage	59.4	1.0e-27
WP_000985226.1|1897967_1898339_+	hypothetical protein	NA	R9TQ46	Paenibacillus_phage	55.0	1.3e-24
WP_000834963.1|1899075_1899816_+	GIY-YIG nuclease family protein	NA	G3MA96	Bacillus_virus	29.2	1.5e-14
WP_000522230.1|1901071_1902283_+|portal	phage portal protein	portal	J9QE83	Clostridium_phage	59.4	7.7e-138
WP_001043897.1|1902248_1902833_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	50.5	1.0e-39
WP_000854836.1|1902846_1904010_+|capsid	phage major capsid protein	capsid	H7BUQ0	unidentified_phage	54.7	4.1e-80
WP_000015464.1|1904046_1904337_+	hypothetical protein	NA	A6XMJ7	Bacillus_virus	37.8	4.8e-06
WP_000979030.1|1904339_1904612_+	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	58.4	6.5e-21
WP_000997895.1|1904608_1904908_+|head	phage head closure protein	head	R9TPZ2	Paenibacillus_phage	38.3	1.7e-09
WP_000065124.1|1904900_1905257_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	60.3	2.7e-30
WP_000172073.1|1905253_1905583_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	83.5	2.2e-47
WP_001004916.1|1905583_1906177_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	84.1	5.3e-92
WP_000415943.1|1906181_1906544_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	74.8	9.2e-47
WP_011198932.1|1908241_1908499_+	hypothetical protein	NA	A0A1B1P763	Bacillus_phage	84.7	6.4e-34
WP_000180084.1|1908763_1910944_+	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	78.8	1.9e-30
WP_000094111.1|1910985_1912467_+|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	79.7	4.5e-241
WP_001260141.1|1912463_1917341_+	hypothetical protein	NA	A0A2H4JF18	uncultured_Caudovirales_phage	46.1	0.0e+00
WP_000077309.1|1917358_1917634_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A1B1P7E8	Bacillus_phage	81.2	1.8e-34
WP_000398740.1|1917744_1917981_+	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	92.3	5.5e-16
WP_000461737.1|1917980_1918220_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	84.8	6.8e-30
WP_000731144.1|1918216_1919272_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	73.8	7.9e-155
>prophage 3
NZ_CP009968	Bacillus cereus E33L chromosome, complete genome	5305318	2803670	2811617	5305318		Geobacillus_phage(33.33%)	10	NA	NA
WP_000540634.1|2803670_2804477_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	69.7	6.5e-109
WP_000820170.1|2804542_2804755_-	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	54.4	5.6e-12
WP_000714657.1|2804757_2806143_-	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	60.3	7.8e-78
WP_000288933.1|2806390_2806795_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000994646.1|2806807_2807161_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000655493.1|2807182_2807890_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	26.6	6.1e-18
WP_001093443.1|2807955_2808342_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_000389482.1|2808368_2809292_+	phosphotransferase	NA	NA	NA	NA	NA
WP_000720573.1|2809294_2809813_+	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.9	4.3e-45
WP_000795729.1|2810249_2811617_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.6	4.3e-20
>prophage 4
NZ_CP009968	Bacillus cereus E33L chromosome, complete genome	5305318	3557652	3566919	5305318		Bacillus_phage(71.43%)	9	NA	NA
WP_001258485.1|3557652_3558525_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.1e-65
WP_000103836.1|3558658_3559330_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	86.1	3.6e-60
WP_000818985.1|3559479_3560199_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000273036.1|3560391_3560991_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_011198685.1|3560968_3562012_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	88.7	1.3e-165
WP_000254054.1|3562026_3562713_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	93.9	1.3e-118
WP_000453754.1|3562792_3564553_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.9	8.8e-268
WP_001194298.1|3564793_3565558_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755542.1|3565656_3566919_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
>prophage 5
NZ_CP009968	Bacillus cereus E33L chromosome, complete genome	5305318	5141596	5149972	5305318		Synechococcus_phage(33.33%)	8	NA	NA
WP_000088587.1|5141596_5142184_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	7.0e-28
WP_001262434.1|5142180_5143221_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.4	1.2e-67
WP_000879029.1|5143326_5144742_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_000055575.1|5144726_5146946_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.3e-162
WP_000666778.1|5146929_5147613_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|5147609_5147864_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170542.1|5147856_5148576_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000625691.1|5148664_5149972_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.5	8.3e-21
>prophage 6
NZ_CP009968	Bacillus cereus E33L chromosome, complete genome	5305318	5189175	5198870	5305318		Bacillus_phage(33.33%)	7	NA	NA
WP_000719203.1|5189175_5190681_-	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	29.1	7.8e-31
WP_000929883.1|5190664_5191366_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	5.6e-40
WP_000833092.1|5191510_5192836_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.2	7.1e-44
WP_000743900.1|5193220_5194759_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	2.6e-21
WP_000481696.1|5195427_5195883_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000483525.1|5195903_5196950_-	hypothetical protein	NA	A0A2H4J389	uncultured_Caudovirales_phage	49.7	1.4e-34
WP_001029999.1|5197235_5198870_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
>prophage 1
NZ_CP009967	Bacillus cereus E33L plasmid pBCO_1, complete sequence	465970	134757	201229	465970	transposase,integrase	Bacillus_phage(50.0%)	55	138008:138033	183192:183217
WP_000973290.1|134757_135879_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.2	2.3e-173
WP_041184979.1|135953_136304_+	ArpU family transcriptional regulator	NA	A0A1B1P853	Bacillus_phage	43.3	1.9e-17
WP_144405429.1|137325_137559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000906728.1|137998_139120_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.0	9.8e-172
138008:138033	attL	AATAAAGCATATAAATTTCGTATCTA	NA	NA	NA	NA
WP_011270243.1|139661_139880_+	hypothetical protein	NA	B5LPQ4	Bacillus_virus	54.9	1.5e-07
WP_000659530.1|140158_140479_+	hypothetical protein	NA	A0A088F787	Idiomarinaceae_phage	55.9	1.8e-25
WP_000437672.1|142145_142766_-	DedA family protein	NA	NA	NA	NA	NA
WP_000831396.1|143216_143561_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	48.7	4.2e-17
WP_000201188.1|144117_144831_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144405440.1|144948_145701_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001035140.1|145979_147152_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_000473860.1|148123_148981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000471745.1|151036_151279_+	DUF3937 family protein	NA	NA	NA	NA	NA
WP_001035967.1|151300_151873_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	42.4	3.3e-30
WP_000669845.1|152050_152467_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_001048525.1|152735_153164_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	43.9	1.3e-07
WP_000475235.1|153225_153516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912317.1|153872_154085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734519.1|155309_155831_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_000735902.1|155888_156590_+	class D sortase	NA	NA	NA	NA	NA
WP_001056373.1|157173_157800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144405441.1|158106_158715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000655362.1|158975_159293_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000258866.1|159586_160324_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	2.1e-29
WP_000889419.1|160316_161420_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.8	2.2e-59
WP_000511125.1|161645_161990_-	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
WP_000865152.1|162785_163061_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000762328.1|163396_164194_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HRV8	Bacillus_phage	42.2	2.2e-32
WP_001036359.1|164714_167597_+	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_000286647.1|168357_168795_+	DUF1259 domain-containing protein	NA	NA	NA	NA	NA
WP_000071774.1|170565_171462_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_000927573.1|172151_172418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000898925.1|175960_177532_+	spore germination protein	NA	NA	NA	NA	NA
WP_000176111.1|177565_178777_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_000871284.1|178773_178998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000572768.1|179029_180127_+	endospore germination permease	NA	NA	NA	NA	NA
WP_001156502.1|180167_181259_+	endospore germination permease	NA	NA	NA	NA	NA
WP_000270220.1|181423_182866_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_001180113.1|184604_184901_+	hypothetical protein	NA	NA	NA	NA	NA
183192:183217	attR	AATAAAGCATATAAATTTCGTATCTA	NA	NA	NA	NA
WP_041185005.1|185343_186699_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	31.8	9.5e-44
WP_000567185.1|187482_187746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564717.1|189287_190013_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000819587.1|190382_191159_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_001125179.1|191610_192408_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001023785.1|192774_193083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000620764.1|193315_193933_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_011270223.1|194847_195486_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_158319929.1|195705_195864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102204.1|196066_196375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000736075.1|196917_197100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000995741.1|197304_198135_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000788512.1|198514_198850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000482675.1|198876_199065_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_041184975.1|199109_199274_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_001056969.1|199846_201229_-|transposase	IS4-like element ISBce9 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP009967	Bacillus cereus E33L plasmid pBCO_1, complete sequence	465970	226144	286620	465970	transposase,integrase	Bacillus_phage(23.08%)	38	215719:215734	286657:286672
215719:215734	attL	AAAAGAAGTAATTTCT	NA	NA	NA	NA
WP_000586195.1|226144_227266_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	77.2	6.4e-163
WP_000661236.1|227509_228901_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.3	1.7e-24
WP_000151803.1|229010_229916_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000229719.1|232051_233443_+	chitosanase	NA	NA	NA	NA	NA
WP_000786877.1|233642_233840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000018396.1|234732_235185_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000790788.1|235223_235604_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_000479646.1|236037_237069_-	serine hydrolase	NA	NA	NA	NA	NA
WP_041184999.1|237282_237378_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000726230.1|238197_238425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000589779.1|238643_238958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845444.1|242742_243957_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000724493.1|244015_244606_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000904909.1|244961_245516_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.2	5.6e-43
WP_001178743.1|245535_246981_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JGQ6	uncultured_Caudovirales_phage	25.5	8.0e-17
WP_001032577.1|246973_247786_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	27.6	8.8e-05
WP_001214170.1|248997_251949_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	40.7	9.4e-214
WP_000576159.1|251980_252526_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	46.6	1.5e-37
WP_158319935.1|252696_252984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208356.1|253466_254105_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041184995.1|254121_255435_+	MFS transporter	NA	NA	NA	NA	NA
WP_000291799.1|255412_257731_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_000720173.1|257734_258493_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.7	8.5e-18
WP_001053939.1|259552_260983_-|transposase	IS4-like element ISBce4 family transposase	transposase	NA	NA	NA	NA
WP_000129108.1|261183_262188_-	serine hydrolase	NA	NA	NA	NA	NA
WP_000212603.1|265779_266193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189824.1|266347_267349_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000369814.1|267752_268925_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	25.0	1.4e-06
WP_001003824.1|269777_270770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391639.1|274324_274642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000855459.1|275026_275719_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_001013016.1|275860_276475_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001145709.1|276539_277022_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.5	1.6e-22
WP_000591603.1|277040_278639_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.8	1.1e-22
WP_000910070.1|280991_282080_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q332I1	Clostridium_botulinum_C_phage	60.2	5.3e-122
WP_000161501.1|283971_284889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144405432.1|284951_285140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747906.1|285777_286620_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	32.6	3.0e-32
286657:286672	attR	AGAAATTACTTCTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP009967	Bacillus cereus E33L plasmid pBCO_1, complete sequence	465970	323903	330772	465970		Bacillus_phage(71.43%)	9	NA	NA
WP_000108303.1|323903_325703_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	7.9e-30
WP_000503879.1|326800_327226_-	hypothetical protein	NA	H0USU9	Bacillus_phage	85.7	1.9e-46
WP_158319932.1|327554_327713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993188.1|327749_327968_-	DUF3797 domain-containing protein	NA	Q24LE0	Clostridium_phage	45.1	4.7e-06
WP_000446239.1|328006_328192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144405433.1|328193_328691_-	dUTPase	NA	A0A0S2MVD0	Bacillus_phage	87.2	7.9e-73
WP_041185034.1|328964_329243_-	hypothetical protein	NA	A0A0S2MVD9	Bacillus_phage	55.7	5.3e-18
WP_000706148.1|329449_329917_-	hypothetical protein	NA	A0A0A7AR00	Bacillus_phage	51.6	2.0e-38
WP_001101735.1|330271_330772_-	hypothetical protein	NA	A0A0A7AQW2	Bacillus_phage	69.9	6.1e-57
