The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	0	33558	5229095		Bacillus_phage(100.0%)	23	NA	NA
WP_006094823.1|3634_4555_-	isochorismatase	NA	NA	NA	NA	NA
WP_040119559.1|4601_6218_-	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_006094825.1|6236_7454_-	isochorismate synthase DhbC	NA	NA	NA	NA	NA
WP_006094826.1|7479_8265_-	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_040119558.1|9007_12097_-	SMC family ATPase	NA	NA	NA	NA	NA
WP_040119557.1|12093_13251_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_040119556.1|13272_13512_-	DUF2584 family protein	NA	NA	NA	NA	NA
WP_003197605.1|13987_14245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040119555.1|14703_15756_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003197601.1|15839_16385_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040119683.1|16516_17149_+	LysE family translocator	NA	NA	NA	NA	NA
WP_003197594.1|17229_18690_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003207149.1|18765_19656_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003197589.1|19672_21388_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_040119554.1|21528_23289_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_006094816.1|23401_24310_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_040119553.1|24327_25764_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_018767194.1|25862_26981_-	citrate synthase	NA	NA	NA	NA	NA
WP_026008695.1|27928_28366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006094811.1|28532_28823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018767193.1|28967_31493_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_018767192.1|32147_32354_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_006094807.1|32553_33558_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KCJ1	Bacillus_phage	57.5	1.6e-112
>prophage 2
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	36808	37525	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_040119551.1|36808_37525_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.1	9.4e-35
>prophage 3
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	48913	74810	5229095		Tupanvirus(100.0%)	3	NA	NA
WP_042511219.1|48913_63781_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	28.5	1.1e-172
WP_040119549.1|63777_70248_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.8	1.9e-190
WP_042511220.1|70250_74810_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.7	6.1e-95
>prophage 4
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	78308	81232	5229095	integrase	Anomala_cuprea_entomopoxvirus(50.0%)	4	54274:54288	82376:82390
54274:54288	attL	CAATCGTTTGGTGTT	NA	NA	NA	NA
WP_040119547.1|78308_79070_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.3	8.5e-26
WP_040119546.1|79240_79582_-	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_016131412.1|79653_79974_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003203185.1|80926_81232_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	88.0	2.1e-39
82376:82390	attR	AACACCAAACGATTG	NA	NA	NA	NA
>prophage 5
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	86169	87264	5229095		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003209465.1|86169_87264_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	43.9	3.4e-76
>prophage 6
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	93640	93982	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_080740281.1|93640_93982_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1B1P7U8	Bacillus_phage	79.6	1.6e-45
>prophage 7
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	101727	101958	5229095		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_040119537.1|101727_101958_-	hypothetical protein	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	91.4	2.2e-30
>prophage 8
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	106896	109190	5229095		Acanthamoeba_polyphaga_mimivirus(50.0%)	5	NA	NA
WP_040119534.1|106896_107718_-	serine/threonine protein kinase	NA	A0A0G2Y2G6	Acanthamoeba_polyphaga_mimivirus	29.1	1.0e-08
WP_017149660.1|107717_107909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003197525.1|108033_108213_-	YozD family protein	NA	NA	NA	NA	NA
WP_003197522.1|108371_108527_+	DUF3930 family protein	NA	NA	NA	NA	NA
WP_006094764.1|108527_109190_-	hypothetical protein	NA	A0A0E3X9J2	Bacillus_phage	58.1	7.2e-05
>prophage 9
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	120038	124229	5229095		Planktothrix_phage(50.0%)	4	NA	NA
WP_003197473.1|120038_121142_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.2	4.4e-23
WP_003207130.1|121741_121879_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_040119530.1|122306_123056_+	DUF4397 domain-containing protein	NA	NA	NA	NA	NA
WP_040119529.1|123095_124229_-	GHKL domain-containing protein	NA	A0A1V0SGX0	Hokovirus	24.2	2.2e-09
>prophage 10
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	137312	138266	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_033798851.1|137312_138266_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.3	3.7e-26
>prophage 11
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	144552	146920	5229095		Bacillus_virus(33.33%)	3	NA	NA
WP_018766414.1|144552_145101_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	44.9	1.8e-38
WP_006094743.1|145211_146081_-	helix-turn-helix domain-containing protein	NA	A0A1B0RXG1	Streptococcus_phage	36.4	1.1e-13
WP_040119521.1|146431_146920_-	hypothetical protein	NA	A0A1B2APY6	Phage_Wrath	49.4	4.4e-36
>prophage 12
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	150301	157958	5229095		Bacillus_phage(33.33%)	8	NA	NA
WP_003207118.1|150301_151297_-	sporulation protein	NA	J9PV86	Bacillus_phage	65.7	6.0e-56
WP_018766421.1|151397_151727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040119518.1|151783_152143_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003197399.1|152286_154188_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	32.2	1.9e-34
WP_003207117.1|154405_154873_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_018766424.1|154927_155512_-	SCO family protein	NA	NA	NA	NA	NA
WP_040119517.1|155856_156828_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003197390.1|157115_157958_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	43.8	5.2e-24
>prophage 13
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	164245	165711	5229095		Bacillus_virus(50.0%)	2	NA	NA
WP_003197378.1|164245_164734_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	45.7	1.5e-36
WP_040119512.1|164754_165711_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	65.6	1.5e-123
>prophage 14
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	170721	171447	5229095		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_040119508.1|170721_171447_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.2	5.4e-14
>prophage 15
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	182252	185109	5229095		Feldmannia_irregularis_virus(50.0%)	2	NA	NA
WP_040119501.1|182252_184031_-	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	32.7	1.1e-07
WP_040119500.1|184191_185109_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.0	4.2e-35
>prophage 16
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	188746	190045	5229095	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_006094713.1|188746_190045_-|tRNA	aspartate--tRNA(Asn) ligase	tRNA	A0A2I2L4Y8	Orpheovirus	39.3	9.6e-78
>prophage 17
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	198027	201129	5229095	tRNA	Catovirus(100.0%)	1	NA	NA
WP_040119496.1|198027_201129_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SBW6	Catovirus	31.1	1.7e-152
>prophage 18
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	211723	213202	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_040119491.1|211723_213202_-	Lsa family ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	25.4	9.1e-32
>prophage 19
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	226150	227839	5229095	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_040119482.1|226150_227839_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	33.8	3.7e-82
>prophage 20
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	233391	248192	5229095	transposase	Bacillus_phage(55.56%)	15	NA	NA
WP_016114658.1|233391_233730_-	single-stranded DNA-binding protein	NA	D7RWG9	Brochothrix_phage	62.0	2.1e-32
WP_003197270.1|233887_234619_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_018782998.1|234694_236587_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	3.0e-56
WP_040119477.1|236583_237231_-	HD domain-containing protein	NA	S4W232	Pandoravirus	31.2	1.3e-11
WP_040119476.1|237340_237985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003203825.1|238891_239194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042511236.1|239893_240775_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.1	5.9e-47
WP_033799504.1|240783_241080_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_018783002.1|241533_242727_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	72.4	1.7e-145
WP_018783005.1|243447_243753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040119475.1|244510_245125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040119672.1|245203_246220_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	83.0	1.5e-163
WP_003205225.1|246255_246462_-	hypothetical protein	NA	A0A1B2APX7	Phage_Wrath	85.1	8.4e-29
WP_033796922.1|246465_246699_-	hypothetical protein	NA	A0A1B1P887	Bacillus_phage	64.9	6.4e-17
WP_040119474.1|246830_248192_-	hypothetical protein	NA	A0A1Z1LZM3	Bacillus_phage	34.7	6.6e-53
>prophage 21
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	253884	254112	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_003204389.1|253884_254112_-	hypothetical protein	NA	A0A1B1P878	Bacillus_phage	71.7	2.1e-17
>prophage 22
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	258164	258641	5229095		Fowlpox_virus(100.0%)	1	NA	NA
WP_006094671.1|258164_258641_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	40.0	2.9e-24
>prophage 23
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	263087	264257	5229095		Catovirus(100.0%)	1	NA	NA
WP_040119462.1|263087_264257_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	29.8	1.1e-43
>prophage 24
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	275441	280750	5229095	transposase	Anomala_cuprea_entomopoxvirus(33.33%)	7	NA	NA
WP_040119457.1|275441_276203_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.8	1.7e-26
WP_003207016.1|276374_276716_-	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_018765521.1|276787_277108_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040119456.1|278165_278840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042511244.1|278976_279858_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.7	5.0e-46
WP_033799504.1|279866_280163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003197260.1|280471_280750_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	56.8	3.0e-13
>prophage 25
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	293033	297539	5229095		Mycobacterium_phage(100.0%)	1	NA	NA
WP_040119450.1|293033_297539_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.6	2.0e-34
>prophage 26
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	309309	310731	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_040119444.1|309309_310731_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.8	1.4e-26
>prophage 27
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	317623	322490	5229095		Micromonas_sp._RCC1109_virus(66.67%)	5	NA	NA
WP_033798835.1|317623_318649_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.0	1.6e-43
WP_018781313.1|318635_319535_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	35.3	3.4e-42
WP_003197188.1|319567_320347_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_006094632.1|320549_322019_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016114614.1|322031_322490_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	41.3	5.6e-25
>prophage 28
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	358825	359242	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_018765467.1|358825_359242_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	66.7	4.0e-38
>prophage 29
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	362259	362712	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_003197104.1|362259_362712_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.0	1.7e-26
>prophage 30
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	369084	372638	5229095		Indivirus(50.0%)	3	NA	NA
WP_003197089.1|369084_369987_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	26.3	2.2e-12
WP_006094597.1|370260_370845_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_018781331.1|371165_372638_-	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	21.2	7.9e-12
>prophage 31
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	375979	376423	5229095		Clostridium_phage(100.0%)	1	NA	NA
WP_003197069.1|375979_376423_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	3.6e-45
>prophage 32
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	383597	384548	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_018765452.1|383597_384548_-	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	55.8	2.0e-93
>prophage 33
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	389272	390091	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_003197043.1|389272_390091_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.0	1.2e-94
>prophage 34
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	394368	395298	5229095		Catovirus(100.0%)	1	NA	NA
WP_018781340.1|394368_395298_+	patatin-like phospholipase family protein	NA	A0A1V0SCG0	Catovirus	26.5	4.7e-10
>prophage 35
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	400992	401199	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_003197017.1|400992_401199_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	63.1	1.5e-14
>prophage 36
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	404484	405162	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_003197014.1|404484_405162_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	41.7	4.4e-18
>prophage 37
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	418548	424046	5229095		Streptococcus_phage(33.33%)	7	NA	NA
WP_018781350.1|418548_419421_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	47.4	3.5e-68
WP_016114534.1|419661_419943_-	HesB-like selenoprotein	NA	NA	NA	NA	NA
WP_040119428.1|419980_421741_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_018781352.1|421759_422119_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_018781353.1|422184_422589_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	64.3	6.9e-43
WP_018781354.1|422614_423670_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_016114529.1|423698_424046_-	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	43.1	4.6e-11
>prophage 38
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	428516	437089	5229095		Bacillus_phage(50.0%)	7	NA	NA
WP_018781359.1|428516_430961_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	50.3	2.1e-179
WP_018781360.1|431022_431607_+	SCO family protein	NA	NA	NA	NA	NA
WP_018781361.1|431639_432176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016114516.1|433189_433909_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	98.4	5.0e-60
WP_006094562.1|434096_434678_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	79.4	5.1e-55
WP_003196982.1|434953_435712_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_040119427.1|435787_437089_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.1	1.4e-12
>prophage 39
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	440578	441562	5229095		Stx2-converting_phage(100.0%)	1	NA	NA
WP_018781369.1|440578_441562_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.3	3.1e-20
>prophage 40
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	447162	448618	5229095		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_018781373.1|447162_447867_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.8	2.9e-12
WP_018781374.1|447844_448618_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.6	2.1e-11
>prophage 41
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	465956	467720	5229095		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_018781384.1|465956_467720_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.7	7.5e-41
>prophage 42
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	481684	483829	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_006094529.1|481684_483829_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	35.9	9.9e-72
>prophage 43
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	487111	487960	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_003196864.1|487111_487960_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	39.8	5.5e-50
>prophage 44
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	492695	497117	5229095		Acinetobacter_phage(50.0%)	3	NA	NA
WP_040119417.1|492695_495047_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	21.8	2.6e-25
WP_040119416.1|495381_495777_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_006094518.1|495815_497117_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	60.2	3.5e-136
>prophage 45
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	522170	524912	5229095		Clostridium_phage(50.0%)	3	NA	NA
WP_018781413.1|522170_523070_-	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	33.1	2.6e-05
WP_018781414.1|523153_524194_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_018781415.1|524213_524912_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	3.5e-34
>prophage 46
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	533729	534755	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_018765629.1|533729_534755_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A140HM31	Bacillus_phage	45.7	1.3e-24
>prophage 47
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	538662	540743	5229095		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_018781426.1|538662_539751_-	CDP-glucose 4,6-dehydratase	NA	M1HKK4	Acanthocystis_turfacea_Chlorella_virus	26.1	1.6e-14
WP_018781427.1|539777_540743_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2K9L4U8	Tupanvirus	29.7	3.5e-24
>prophage 48
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	555311	556244	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_018783453.1|555311_556244_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.7	5.0e-44
>prophage 49
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	564308	566033	5229095		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_040119402.1|564308_566033_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.0	4.4e-70
>prophage 50
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	577666	581746	5229095		Lactococcus_phage(50.0%)	3	NA	NA
WP_003203798.1|577666_578584_-	cysteine synthase A	NA	C3U2M1	Lactococcus_phage	55.4	2.7e-82
WP_006094448.1|578599_579808_-	MFS transporter	NA	NA	NA	NA	NA
WP_003203794.1|580183_581746_-	Vga family ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	39.0	8.6e-73
>prophage 51
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	602965	603685	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_018783266.1|602965_603685_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.7	3.7e-31
>prophage 52
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	608536	617516	5229095		Staphylococcus_phage(33.33%)	5	NA	NA
WP_018783261.1|608536_609427_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.5e-21
WP_018783260.1|609721_611737_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006094420.1|612113_613097_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.8	2.8e-61
WP_003196698.1|614031_614169_+	DUF3934 family protein	NA	NA	NA	NA	NA
WP_018782460.1|614300_617516_-	DEAD/DEAH box helicase family protein	NA	A0A160DHD3	Gordonia_phage	27.7	3.1e-37
>prophage 53
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	633878	636697	5229095		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_018782470.1|633878_634817_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.3	1.2e-16
WP_018782471.1|634950_636054_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_003196658.1|636058_636697_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.9	1.8e-05
>prophage 54
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	652891	653677	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_003206694.1|652891_653677_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	43.0	1.3e-29
>prophage 55
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	671875	672670	5229095		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_006094382.1|671875_672670_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	2.0e-17
>prophage 56
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	691663	691981	5229095		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_018764335.1|691663_691981_-	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	46.5	8.4e-12
>prophage 57
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	703839	704037	5229095		Lactococcus_phage(100.0%)	1	NA	NA
WP_003196492.1|703839_704037_+	cold shock-like protein CspB	NA	Q9AZD3	Lactococcus_phage	59.7	1.3e-15
>prophage 58
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	714216	721401	5229095		Bacillus_phage(33.33%)	9	NA	NA
WP_018782519.1|714216_715083_-	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	32.3	3.2e-21
WP_040119364.1|715217_715949_-	magnesium transporter	NA	NA	NA	NA	NA
WP_040119363.1|716574_716961_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_040119362.1|716957_718190_-	glutathionylspermidine synthase family protein	NA	E1A1N7	Aeromonas_phage	23.2	4.3e-11
WP_040119361.1|718193_718505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018764313.1|718587_719037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040119360.1|719780_720614_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003196439.1|720616_720889_-	DUF2533 family protein	NA	NA	NA	NA	NA
WP_018764311.1|720945_721401_-	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	47.3	1.6e-27
>prophage 59
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	740142	740697	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_040119349.1|740142_740697_-	DUF1273 domain-containing protein	NA	A0A1P8CWY2	Bacillus_phage	29.9	7.3e-11
>prophage 60
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	744470	745073	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_003196400.1|744470_745073_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.9	2.4e-23
>prophage 61
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	749026	759938	5229095	tRNA	Bacillus_phage(50.0%)	10	NA	NA
WP_016114116.1|749026_749734_-	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	48.8	1.1e-24
WP_003206480.1|749878_751066_-	aspartate transaminase AspB	NA	NA	NA	NA	NA
WP_040119343.1|751084_751561_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_000412180.1|751568_751739_-	YpmA family protein	NA	NA	NA	NA	NA
WP_040119342.1|752151_754944_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	29.9	2.7e-69
WP_040119341.1|755314_755698_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_040119340.1|755711_756560_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_006094312.1|756559_757396_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	38.7	1.6e-49
WP_033796006.1|757779_758760_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_018780976.1|758744_759938_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.4	5.6e-40
>prophage 62
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	763838	764720	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_018780978.1|763838_764720_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	43.9	3.5e-71
>prophage 63
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	771528	772065	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_003206504.1|771528_772065_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	52.0	1.2e-45
>prophage 64
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	775137	779843	5229095		Pacmanvirus(33.33%)	5	NA	NA
WP_018780985.1|775137_776250_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	23.6	2.3e-19
WP_040119335.1|776322_776616_-	chorismate mutase	NA	NA	NA	NA	NA
WP_003206512.1|776612_777704_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_018780987.1|777703_778876_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	37.1	1.0e-46
WP_003206516.1|779396_779843_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.7	8.5e-26
>prophage 65
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	782846	783811	5229095		Pneumococcus_phage(50.0%)	2	NA	NA
WP_003206523.1|782846_783416_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	53.8	9.1e-49
WP_001043860.1|783538_783811_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	77.8	1.0e-29
>prophage 66
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	798580	799111	5229095		uncultured_phage(100.0%)	1	NA	NA
WP_018764266.1|798580_799111_-	N-acetylmuramoyl-L-alanine amidase	NA	D6QWN1	uncultured_phage	62.0	7.7e-58
>prophage 67
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	804994	814315	5229095		Bacillus_phage(60.0%)	9	NA	NA
WP_018780992.1|804994_806542_-	RecQ family ATP-dependent DNA helicase	NA	K7YHB4	Megavirus	37.2	5.5e-56
WP_018764260.1|806531_807593_-	ATP-dependent DNA helicase RecQ	NA	NA	NA	NA	NA
WP_003206564.1|807912_808161_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	50.7	5.2e-17
WP_018764259.1|808278_808857_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_018780993.1|809424_810108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018764256.1|810137_810752_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A075BS18	Microcystis_phage	44.1	5.8e-17
WP_018780994.1|810835_811408_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_018780995.1|811823_813599_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.6	1.5e-33
WP_026008430.1|813598_814315_-	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	42.0	1.7e-44
>prophage 68
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	820458	822604	5229095		Erythrobacter_phage(50.0%)	2	NA	NA
WP_018780998.1|820458_821580_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	28.7	2.2e-06
WP_003206588.1|821689_822604_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	41.6	5.2e-38
>prophage 69
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	828773	835739	5229095	transposase,integrase	Bacillus_phage(50.0%)	6	822368:822383	832835:832850
822368:822383	attL	AAATACTTCTTGTAAA	NA	NA	NA	NA
WP_018780999.1|828773_830588_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	35.1	7.7e-33
WP_018764243.1|830695_831226_+|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	38.9	2.5e-24
WP_003206602.1|831357_831552_+	DUF3924 family protein	NA	NA	NA	NA	NA
WP_018781000.1|831943_833077_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A191SB13	Nostoc_phage	36.3	2.6e-47
832835:832850	attR	AAATACTTCTTGTAAA	NA	NA	NA	NA
WP_006094213.1|833505_834351_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_006094211.1|834485_835739_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	26.1	3.7e-18
>prophage 70
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	839631	841548	5229095		Bathycoccus_sp._RCC1105_virus(50.0%)	2	NA	NA
WP_006094199.1|839631_840630_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	28.4	2.2e-05
WP_018764237.1|840747_841548_+	sulfite exporter TauE/SafE family protein	NA	A0A2K9L458	Tupanvirus	29.7	8.7e-05
>prophage 71
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	858666	859908	5229095		Rhodococcus_phage(100.0%)	1	NA	NA
WP_018764227.1|858666_859908_+	M23 family metallopeptidase	NA	A0A2D0ZM66	Rhodococcus_phage	38.0	3.9e-12
>prophage 72
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	867091	868228	5229095		Moumouvirus(100.0%)	1	NA	NA
WP_018781014.1|867091_868228_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	31.1	6.1e-44
>prophage 73
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	872011	875987	5229095		Streptococcus_phage(50.0%)	3	NA	NA
WP_018781016.1|872011_873898_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	35.2	6.7e-88
WP_026008425.1|874277_874985_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_040119333.1|875015_875987_-	NAD(P)-binding domain-containing protein	NA	Q89388	Paramecium_bursaria_Chlorella_virus	29.6	1.1e-25
>prophage 74
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	887331	892101	5229095		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_018781021.1|887331_888852_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	27.0	1.6e-07
WP_006094145.1|888853_889864_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_016113993.1|889891_890404_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_040119332.1|890400_892101_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.9	3.3e-62
>prophage 75
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	903510	910638	5229095		Staphylococcus_phage(25.0%)	6	NA	NA
WP_018781027.1|903510_904419_+	aminoglycoside phosphotransferase family protein	NA	A0A0N9SKF6	Staphylococcus_phage	25.7	5.2e-14
WP_016113977.1|905470_905917_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	33.8	2.8e-13
WP_029426979.1|906308_907478_-	amidohydrolase	NA	NA	NA	NA	NA
WP_006094128.1|907801_907948_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_018781030.1|907960_909475_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	29.0	9.9e-50
WP_018781031.1|909471_910638_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.1	1.7e-17
>prophage 76
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	920546	922950	5229095		Staphylococcus_phage(100.0%)	3	NA	NA
WP_018781039.1|920546_921449_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.7	4.8e-36
WP_018781040.1|921463_922255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003206361.1|922251_922950_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	1.2e-18
>prophage 77
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	925972	927355	5229095		Klosneuvirus(100.0%)	1	NA	NA
WP_003196107.1|925972_927355_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.8	1.2e-33
>prophage 78
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	935191	936160	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_003196100.1|935191_936160_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	G3MBF3	Bacillus_virus	73.5	8.9e-137
>prophage 79
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	939464	939824	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_006094109.1|939464_939824_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.7	9.5e-36
>prophage 80
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	943055	945447	5229095		Pneumococcus_phage(25.0%)	4	NA	NA
WP_003196088.1|943055_943553_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	70.1	1.8e-53
WP_018764168.1|943581_944298_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	44.1	1.7e-55
WP_003196086.1|944290_944785_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	73.2	1.4e-61
WP_018764167.1|944784_945447_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.1	4.3e-66
>prophage 81
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	951378	952875	5229095		Hokovirus(100.0%)	1	NA	NA
WP_018781052.1|951378_952875_+	DUF3149 domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.2	1.2e-18
>prophage 82
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	962593	968647	5229095		Bacillus_phage(66.67%)	8	NA	NA
WP_003196065.1|962593_963337_-	acetoacetyl-CoA reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	9.8e-19
WP_006094092.1|963497_963980_-	polyhydroxyalkanoic acid synthase subunit PhaR	NA	NA	NA	NA	NA
WP_003196063.1|964178_964631_+	poly-beta-hydroxybutyrate-responsive repressor	NA	NA	NA	NA	NA
WP_003196062.1|964673_965198_+	polyhydroxyalkanoic acid inclusion protein PhaP	NA	NA	NA	NA	NA
WP_018764158.1|965299_965743_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_000241213.1|965932_966118_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	70.7	2.4e-14
WP_006094090.1|966233_967553_+	potassium transporter TrkH	NA	NA	NA	NA	NA
WP_006094089.1|967849_968647_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	40.5	7.8e-30
>prophage 83
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	975096	977173	5229095		Bacillus_phage(100.0%)	2	NA	NA
WP_003206404.1|975096_976497_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	36.5	3.4e-44
WP_018781063.1|976498_977173_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	45.0	4.7e-52
>prophage 84
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	982845	983676	5229095	protease	Bacillus_phage(100.0%)	1	NA	NA
WP_018781068.1|982845_983676_+|protease	serine protease	protease	U5Q0C0	Bacillus_phage	69.3	4.4e-44
>prophage 85
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	991748	993574	5229095		Mycoplasma_phage(50.0%)	2	NA	NA
WP_018764143.1|991748_992594_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	22.9	3.3e-10
WP_006094076.1|992590_993574_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	30.7	6.0e-24
>prophage 86
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1006108	1013520	5229095	integrase	Bacillus_phage(66.67%)	8	1002244:1002258	1015241:1015255
1002244:1002258	attL	ATATATATAAATAGA	NA	NA	NA	NA
WP_006094066.1|1006108_1007029_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	27.3	8.7e-25
WP_006094065.1|1007186_1007969_+	transcriptional regulator	NA	J9PRI8	Bacillus_phage	26.5	1.0e-10
WP_158319619.1|1008530_1008779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018781080.1|1008890_1009985_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.9	2.7e-89
WP_006094060.1|1010568_1011231_-	hypothetical protein	NA	A0A1S5QTJ5	Bacillus_phage	32.2	2.7e-20
WP_018781084.1|1011244_1011931_-	hypothetical protein	NA	A0A2P1JUI8	Bacillus_phage	52.7	1.2e-39
WP_018781085.1|1012006_1012684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006094051.1|1012779_1013520_-	phage repressor protein/antirepressor Ant	NA	A0A2K9V3K3	Faecalibacterium_phage	37.3	6.5e-31
1015241:1015255	attR	ATATATATAAATAGA	NA	NA	NA	NA
>prophage 87
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1017141	1022131	5229095		Bacillus_phage(33.33%)	5	NA	NA
WP_018781091.1|1017141_1017330_-	hypothetical protein	NA	M1IE11	Bacillus_phage	64.4	7.7e-13
WP_018781092.1|1017423_1017759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033794426.1|1018202_1019342_-	GRRM system radical SAM/SPASM domain protein	NA	A0A1B2IA90	Erwinia_phage	31.1	1.6e-07
WP_018781094.1|1019323_1019527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006094033.1|1021558_1022131_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	41.8	5.4e-33
>prophage 88
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1031419	1033879	5229095		Bacillus_phage(50.0%)	4	NA	NA
WP_080740233.1|1031419_1032823_-	hypothetical protein	NA	A0A143FNS3	Bacillus_phage	65.0	1.3e-27
WP_006094007.1|1033043_1033229_-	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
WP_006094006.1|1033275_1033590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018764075.1|1033672_1033879_-	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	42.9	4.5e-06
>prophage 89
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1061606	1063978	5229095		Acinetobacter_phage(100.0%)	3	NA	NA
WP_040119318.1|1061606_1062368_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	40.6	1.4e-36
WP_040119317.1|1062368_1063394_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	35.5	1.6e-51
WP_018764056.1|1063390_1063978_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	47.4	2.3e-47
>prophage 90
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1068356	1069475	5229095		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_040119316.1|1068356_1069475_-	glycosyltransferase family 1 protein	NA	F2Y0P4	Organic_Lake_phycodnavirus	32.3	5.1e-11
>prophage 91
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1073106	1075170	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_006093973.1|1073106_1075170_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	32.3	6.8e-78
>prophage 92
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1081565	1090991	5229095		Escherichia_phage(16.67%)	8	NA	NA
WP_018764038.1|1081565_1082537_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.4	1.1e-78
WP_018764037.1|1082533_1083100_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	42.9	1.0e-31
WP_040119309.1|1083096_1083846_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	44.5	1.5e-51
WP_040119308.1|1084114_1084783_-	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
WP_080740220.1|1085366_1086698_-	hypothetical protein	NA	A0A0E3HGK7	Synechococcus_phage	34.1	1.0e-10
WP_050774423.1|1087094_1087718_-	cephalosporin hydroxylase	NA	NA	NA	NA	NA
WP_040119307.1|1088328_1089237_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	40.5	3.5e-50
WP_050774449.1|1089785_1090991_+	glycosyltransferase	NA	A0A0P0YMN8	Yellowstone_lake_mimivirus	37.7	3.2e-51
>prophage 93
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1099946	1104606	5229095		Megavirus(33.33%)	5	NA	NA
WP_033798730.1|1099946_1100912_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	35.6	4.7e-45
WP_040119306.1|1100964_1102161_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L0G1	Tupanvirus	34.2	2.9e-44
WP_003195950.1|1102181_1102919_+	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_040119305.1|1102924_1104010_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_003195948.1|1104027_1104606_+	formyl transferase	NA	E3SNR5	Prochlorococcus_phage	43.2	5.5e-09
>prophage 94
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1110065	1110806	5229095		Salmonella_phage(100.0%)	1	NA	NA
WP_018764017.1|1110065_1110806_+	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	S4TT53	Salmonella_phage	22.9	2.0e-08
>prophage 95
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1116386	1118213	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_040119303.1|1116386_1118213_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	26.5	4.2e-63
>prophage 96
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1122267	1122939	5229095		Pseudomonas_phage(100.0%)	1	NA	NA
WP_018764011.1|1122267_1122939_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	41.6	5.7e-26
>prophage 97
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1128542	1130514	5229095		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_018781158.1|1128542_1129478_-	ATP-binding cassette domain-containing protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	25.6	2.9e-07
WP_018764007.1|1129470_1130514_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.1e-18
>prophage 98
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1137374	1138121	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_003206164.1|1137374_1138121_-	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	41.2	2.0e-43
>prophage 99
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1144664	1147265	5229095		Cronobacter_phage(100.0%)	1	NA	NA
WP_018783039.1|1144664_1147265_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	33.4	3.1e-120
>prophage 100
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1159197	1169288	5229095		Tupanvirus(25.0%)	8	NA	NA
WP_006093931.1|1159197_1160664_-	catalase	NA	A0A2K9L572	Tupanvirus	51.6	1.1e-125
WP_018783044.1|1160721_1161681_-	ferrochelatase	NA	NA	NA	NA	NA
WP_018783045.1|1162160_1162958_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HRV8	Bacillus_phage	40.7	2.4e-31
WP_040119301.1|1163203_1164451_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	NA	NA	NA	NA
WP_040119300.1|1164754_1166608_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	24.9	4.3e-23
WP_003195877.1|1166880_1167435_+	DUF2777 domain-containing protein	NA	NA	NA	NA	NA
WP_033794635.1|1167576_1167936_-	YisL family protein	NA	NA	NA	NA	NA
WP_003195875.1|1168097_1169288_+	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.1	3.7e-28
>prophage 101
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1173026	1177424	5229095		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_003195867.1|1173026_1173242_+	spore germination protein GerPF	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	82.4	1.2e-25
WP_006093912.1|1173327_1173621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040119299.1|1173698_1177424_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	24.8	1.5e-19
>prophage 102
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1182673	1184461	5229095		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_040119297.1|1182673_1184461_-	PAS domain S-box protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.3	2.2e-08
>prophage 103
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1192233	1192437	5229095		Morganella_phage(100.0%)	1	NA	NA
WP_003195857.1|1192233_1192437_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.7	4.7e-16
>prophage 104
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1203447	1205922	5229095		Bacillus_phage(50.0%)	2	NA	NA
WP_006093894.1|1203447_1204152_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.1	1.0e-33
WP_040119294.1|1204161_1205922_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.6	1.0e-13
>prophage 105
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1209574	1211107	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_018782654.1|1209574_1211107_-	fatty acid--CoA ligase family protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.7	8.7e-46
>prophage 106
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1224943	1225684	5229095		Mollivirus(100.0%)	1	NA	NA
WP_040119289.1|1224943_1225684_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.3	1.4e-12
>prophage 107
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1228791	1230213	5229095		Tupanvirus(100.0%)	1	NA	NA
WP_018782662.1|1228791_1230213_-	protoporphyrinogen oxidase	NA	A0A2K9L5D8	Tupanvirus	24.0	4.2e-10
>prophage 108
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1243073	1244099	5229095		Paenibacillus_phage(100.0%)	1	NA	NA
WP_018782672.1|1243073_1244099_-	SH3 domain-containing protein	NA	D0R7H8	Paenibacillus_phage	45.0	1.5e-33
>prophage 109
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1253818	1260487	5229095		Bacillus_phage(25.0%)	7	NA	NA
WP_040119286.1|1253818_1254490_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.2	3.6e-20
WP_040119285.1|1254524_1255511_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_006093851.1|1256029_1256509_+	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	59.2	5.7e-44
WP_003195743.1|1256784_1257504_-	EcsC family protein	NA	NA	NA	NA	NA
WP_018782681.1|1257517_1258729_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003195739.1|1258721_1259465_-	ABC transporter ATP-binding protein EcsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	3.2e-25
WP_003195737.1|1260052_1260487_+	HIT family protein	NA	X4YGS3	Lactococcus_phage	29.9	1.2e-05
>prophage 110
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1267599	1268421	5229095		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003195722.1|1267599_1268421_-	glycerol uptake facilitator protein GlpF	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	35.9	1.5e-28
>prophage 111
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1274173	1275268	5229095		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_040119280.1|1274173_1275268_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.9	3.3e-95
>prophage 112
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1283608	1283749	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_018766939.1|1283608_1283749_+	YflJ family protein	NA	G3MBD1	Bacillus_virus	58.1	8.0e-07
>prophage 113
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1289778	1290885	5229095		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_018782905.1|1289778_1290885_-	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	31.0	1.2e-28
>prophage 114
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1302825	1309768	5229095	transposase	Bacillus_phage(60.0%)	7	NA	NA
WP_018766951.1|1302825_1303488_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	1.6e-36
WP_029427677.1|1303480_1304932_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	6.6e-19
WP_080740205.1|1305542_1305770_-|transposase	transposase	transposase	A0A7E5	Microcystis_virus	66.7	3.2e-13
WP_018782898.1|1305830_1306691_-	VanY-A/VanY-F/VanY-M family D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_018782897.1|1306773_1307892_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_018782896.1|1307884_1308583_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.2	3.1e-38
WP_018766956.1|1309081_1309768_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	1.1e-24
>prophage 115
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1342382	1352066	5229095		Bacillus_phage(60.0%)	8	NA	NA
WP_042511308.1|1342382_1343480_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.3	6.5e-19
WP_040119255.1|1343622_1345482_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	29.8	9.3e-26
WP_040119254.1|1345735_1346395_-	lipoprotein	NA	NA	NA	NA	NA
WP_040119253.1|1346411_1347209_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_006097056.1|1347338_1347893_-	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	34.4	3.8e-15
WP_018783159.1|1349018_1349741_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.8	6.8e-41
WP_003202774.1|1349981_1350128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033799372.1|1350986_1352066_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.8	4.9e-27
>prophage 116
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1385811	1386726	5229095		Pandoravirus(100.0%)	1	NA	NA
WP_006097187.1|1385811_1386726_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	26.5	3.6e-15
>prophage 117
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1405139	1405847	5229095	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_040119232.1|1405139_1405847_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.5	5.1e-49
>prophage 118
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1410808	1414923	5229095		Klosneuvirus(50.0%)	2	NA	NA
WP_040119228.1|1410808_1413049_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.9	5.4e-12
WP_040119227.1|1413045_1414923_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	1.1e-53
>prophage 119
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1424184	1424505	5229095		Phage_Wrath(100.0%)	1	NA	NA
WP_018782971.1|1424184_1424505_-	hypothetical protein	NA	A0A1B2AQ49	Phage_Wrath	52.8	1.9e-19
>prophage 120
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1437666	1439103	5229095		Tupanvirus(100.0%)	1	NA	NA
WP_040119213.1|1437666_1439103_+	FAD-binding oxidoreductase	NA	A0A2K9KZR0	Tupanvirus	31.6	2.3e-56
>prophage 121
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1446076	1448218	5229095		Streptococcus_phage(50.0%)	4	NA	NA
WP_003210286.1|1446076_1446829_+	capsule biosynthesis protein CapK	NA	A0A1X9I5E1	Streptococcus_phage	28.4	3.3e-14
WP_018782952.1|1446812_1447433_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_080740183.1|1447446_1448085_+	sugar transferase	NA	NA	NA	NA	NA
WP_116269061.1|1448107_1448218_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	61.1	2.6e-05
>prophage 122
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1453188	1463203	5229095		Bacillus_phage(42.86%)	8	NA	NA
WP_040119209.1|1453188_1454730_+	hypothetical protein	NA	J9Q9X0	Bacillus_phage	32.3	9.5e-24
WP_040119208.1|1454961_1455900_-	hypothetical protein	NA	A0A0K2D0C0	Bacillus_phage	53.8	6.3e-79
WP_040119207.1|1456595_1457882_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	59.6	4.9e-143
WP_040119206.1|1457878_1458739_-	DnaD domain protein	NA	A6M985	Geobacillus_virus	38.6	1.7e-46
WP_040119205.1|1459186_1459837_+	2OG-Fe(II) oxygenase	NA	M1GXR2	Acanthocystis_turfacea_Chlorella_virus	30.5	9.8e-15
WP_040119646.1|1459991_1460258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040119204.1|1460445_1462884_-	DEAD/DEAH box helicase family protein	NA	A0A0K2CZF8	Paenibacillus_phage	28.5	4.3e-39
WP_040119203.1|1462876_1463203_-	nucleoside triphosphate pyrophosphohydrolase	NA	A0A2I7SAA6	Vibrio_phage	39.8	1.7e-07
>prophage 123
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1467803	1469453	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_040119198.1|1467803_1469453_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	26.3	1.5e-30
>prophage 124
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1486082	1487429	5229095		Burkholderia_virus(100.0%)	1	NA	NA
WP_040119193.1|1486082_1487429_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.0	5.3e-47
>prophage 125
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1507759	1511088	5229095		Klosneuvirus(50.0%)	3	NA	NA
WP_040119184.1|1507759_1509088_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.0	2.4e-31
WP_003195547.1|1509104_1510529_-	amino acid permease	NA	NA	NA	NA	NA
WP_006093693.1|1510941_1511088_+	YflJ family protein	NA	G3MBD1	Bacillus_virus	66.0	5.8e-08
>prophage 126
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1521784	1525668	5229095		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_040119181.1|1521784_1523260_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.9	7.9e-36
WP_040119180.1|1523605_1524076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040119179.1|1524111_1525668_-	fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	30.5	3.3e-40
>prophage 127
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1537196	1544061	5229095		Bacillus_phage(75.0%)	6	NA	NA
WP_003195499.1|1537196_1537394_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	68.9	1.2e-16
WP_018782316.1|1537442_1538177_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.8	3.4e-40
WP_018782317.1|1538208_1538907_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003195492.1|1538893_1539694_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_018782319.1|1540309_1542310_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.0e-38
WP_006093662.1|1542306_1544061_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.5	4.1e-47
>prophage 128
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1566393	1566879	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_018782335.1|1566393_1566879_-	PRK06770 family protein	NA	G3MB13	Bacillus_virus	31.7	4.2e-10
>prophage 129
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1582387	1583167	5229095		Orpheovirus(100.0%)	1	NA	NA
WP_040119160.1|1582387_1583167_-	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	36.0	1.1e-39
>prophage 130
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1590440	1591115	5229095		Planktothrix_phage(100.0%)	1	NA	NA
WP_018766880.1|1590440_1591115_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	5.6e-37
>prophage 131
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1620123	1622523	5229095		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_006093603.1|1620123_1620990_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.4	7.3e-58
WP_006093602.1|1621221_1622523_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.8	1.2e-51
>prophage 132
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1627447	1629547	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_040119149.1|1627447_1629547_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	27.3	6.2e-42
>prophage 133
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1639604	1640354	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_040119144.1|1639604_1640354_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	3.0e-31
>prophage 134
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1644461	1644881	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_006093581.1|1644461_1644881_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	30.8	3.0e-09
>prophage 135
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1652238	1655283	5229095		Leptospira_phage(100.0%)	1	NA	NA
WP_040119140.1|1652238_1655283_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.2	2.9e-64
>prophage 136
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1677290	1678959	5229095		Clostridioides_phage(50.0%)	2	NA	NA
WP_016113146.1|1677290_1677491_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	49.1	3.9e-07
WP_018781971.1|1677666_1678959_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.3	1.5e-43
>prophage 137
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1686800	1688186	5229095		Acinetobacter_phage(100.0%)	1	NA	NA
WP_040119134.1|1686800_1688186_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.2	4.2e-63
>prophage 138
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1691303	1702515	5229095		Bacillus_phage(25.0%)	10	NA	NA
WP_006093553.1|1691303_1692548_-	cell wall-binding protein	NA	A0A0S2SXZ8	Bacillus_phage	72.5	5.1e-36
WP_003195160.1|1693386_1693689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040119131.1|1693832_1694984_+	VanZ family protein	NA	NA	NA	NA	NA
WP_040119130.1|1694988_1696302_-	FAD-binding protein	NA	A0A2K9KZR0	Tupanvirus	28.7	1.7e-13
WP_040119129.1|1696289_1697462_-	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
WP_040119128.1|1697652_1698492_-	phospholipase C	NA	NA	NA	NA	NA
WP_003195171.1|1698744_1699089_-	two pore domain potassium channel family protein	NA	A0A2L1IVV9	Streptomyces_phage	46.4	2.2e-05
WP_033798622.1|1699208_1700261_-	(R,R)-butanediol dehydrogenase	NA	NA	NA	NA	NA
WP_006093547.1|1700488_1701643_+	MFS transporter	NA	NA	NA	NA	NA
WP_051977358.1|1701672_1702515_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	56.4	7.4e-47
>prophage 139
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1705929	1711281	5229095		Synechococcus_phage(33.33%)	6	NA	NA
WP_003195186.1|1705929_1706577_-	fructose-6-phosphate aldolase	NA	G8EY84	Synechococcus_phage	48.4	3.0e-48
WP_018765552.1|1706612_1707536_-	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_018781954.1|1707550_1708486_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_018781953.1|1708489_1709974_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.7e-17
WP_018781952.1|1709992_1710388_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_018781951.1|1710384_1711281_-	ribokinase	NA	A0A0K0KW05	Prochlorococcus_phage	30.2	5.7e-05
>prophage 140
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1717027	1721038	5229095		Bacillus_phage(66.67%)	5	NA	NA
WP_018781949.1|1717027_1717204_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	47.1	1.0e-06
WP_123772624.1|1717258_1717459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018781948.1|1717547_1718798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018781947.1|1718975_1719668_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	4.5e-34
WP_018781946.1|1719664_1721038_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.6	2.4e-42
>prophage 141
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1724478	1726050	5229095		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_003195227.1|1724478_1725309_-	glutamate ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	29.0	5.8e-12
WP_003195229.1|1725321_1726050_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.5	2.1e-37
>prophage 142
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1738090	1745392	5229095		Halovirus(25.0%)	7	NA	NA
WP_040119121.1|1738090_1738984_+	MoxR family ATPase	NA	R4TG24	Halovirus	28.1	9.7e-13
WP_040119120.1|1738987_1740871_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_003195088.1|1741025_1741304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003205847.1|1741390_1742365_-	L-threonine 3-dehydrogenase	NA	D6PH86	uncultured_phage	28.2	2.1e-05
WP_016113089.1|1742400_1743591_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	31.1	1.6e-42
WP_033795873.1|1743805_1744537_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006093513.1|1744564_1745392_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.1	9.0e-13
>prophage 143
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1749046	1750438	5229095		Acinetobacter_phage(100.0%)	1	NA	NA
WP_006093509.1|1749046_1750438_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.3	4.9e-64
>prophage 144
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1762122	1764813	5229095		uncultured_virus(100.0%)	2	NA	NA
WP_040119118.1|1762122_1762326_-	copper chaperone CopZ	NA	A0A218MNH0	uncultured_virus	40.6	1.2e-06
WP_040119117.1|1762422_1764813_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	32.8	7.4e-100
>prophage 145
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1767886	1773836	5229095		Streptococcus_phage(50.0%)	4	NA	NA
WP_006093497.1|1767886_1769164_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWN8	Bacillus_phage	19.3	1.0e-07
WP_040119116.1|1769429_1770893_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.5	1.1e-111
WP_040119115.1|1771064_1773431_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.1	3.4e-121
WP_003195140.1|1773458_1773836_-	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	36.7	2.0e-12
>prophage 146
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1786271	1788461	5229095		Bacillus_phage(100.0%)	2	NA	NA
WP_018781911.1|1786271_1786943_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	1.0e-35
WP_003194963.1|1787084_1788461_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.6	3.2e-39
>prophage 147
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1793907	1795254	5229095		Dickeya_phage(100.0%)	1	NA	NA
WP_018781906.1|1793907_1795254_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	42.6	3.1e-15
>prophage 148
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1801276	1801948	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_003194987.1|1801276_1801948_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	2.7e-31
>prophage 149
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1805630	1810493	5229095		Bacillus_virus(50.0%)	4	NA	NA
WP_006093468.1|1805630_1806728_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	35.3	2.5e-26
WP_006093467.1|1807367_1808357_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_018781898.1|1808346_1809510_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_018765606.1|1809506_1810493_+	NAD(P)-dependent oxidoreductase	NA	M4QPK0	Synechococcus_phage	25.4	2.4e-12
>prophage 150
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1815776	1816472	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_040119107.1|1815776_1816472_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	4.0e-22
>prophage 151
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1829241	1831010	5229095		Bacillus_phage(100.0%)	2	NA	NA
WP_018765619.1|1829241_1830300_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	34.6	1.4e-29
WP_006093449.1|1830296_1831010_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.4	2.7e-42
>prophage 152
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1834882	1838633	5229095		Bacillus_phage(50.0%)	2	NA	NA
WP_006093445.1|1834882_1836058_-	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	43.9	1.1e-24
WP_018781885.1|1836737_1838633_-	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	36.2	5.8e-100
>prophage 153
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1846231	1847038	5229095		Tupanvirus(100.0%)	1	NA	NA
WP_029427298.1|1846231_1847038_-	C1 family peptidase	NA	A0A2K9L9R4	Tupanvirus	40.9	1.7e-40
>prophage 154
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1857960	1858974	5229095		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003194928.1|1857960_1858974_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.9	1.5e-22
>prophage 155
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1866784	1868545	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_006093309.1|1866784_1868545_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	4.3e-57
>prophage 156
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1882697	1883255	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_018782720.1|1882697_1883255_+	GNAT family N-acetyltransferase	NA	G3MB37	Bacillus_virus	31.8	6.4e-15
>prophage 157
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1886517	1891762	5229095		Tetraselmis_virus(50.0%)	3	NA	NA
WP_018782719.1|1886517_1888767_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.0	4.4e-187
WP_018782717.1|1889595_1890246_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006093330.1|1890550_1891762_-	serine hydrolase	NA	A0A076YK70	Mycobacterium_phage	28.3	1.9e-19
>prophage 158
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1902540	1903326	5229095		Geobacillus_virus(100.0%)	1	NA	NA
WP_080740147.1|1902540_1903326_-	DnaD domain protein	NA	A6M985	Geobacillus_virus	39.1	4.6e-51
>prophage 159
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1907338	1908724	5229095		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_018782712.1|1907338_1908724_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.9	1.2e-86
>prophage 160
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1924997	1938058	5229095		Caulobacter_phage(50.0%)	12	NA	NA
WP_018782709.1|1924997_1926923_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	40.4	1.0e-123
WP_006093367.1|1927104_1927974_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_006093368.1|1927980_1928496_-	DUF4075 domain-containing protein	NA	NA	NA	NA	NA
WP_040119098.1|1928549_1929014_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003194805.1|1929185_1929410_+	DUF1128 domain-containing protein	NA	NA	NA	NA	NA
WP_040119097.1|1929604_1932271_+	cation-translocating P-type ATPase	NA	M1HGW4	Paramecium_bursaria_Chlorella_virus	28.7	1.1e-83
WP_003194801.1|1932306_1933389_-	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_018782706.1|1933407_1935039_-	tellurium resistance protein	NA	NA	NA	NA	NA
WP_006093374.1|1935156_1935945_-	TerC family protein	NA	S5MAL1	Bacillus_phage	62.9	1.3e-77
WP_006093376.1|1936017_1936596_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.7	8.1e-29
WP_003194793.1|1936853_1937438_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.8	1.1e-28
WP_006093378.1|1937461_1938058_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	34.8	1.5e-25
>prophage 161
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1941730	1945710	5229095	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_006093398.1|1941730_1943161_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L0T2	Tupanvirus	42.1	5.2e-101
WP_018766549.1|1943519_1943804_-	membrane integrity integral inner membrane protein	NA	NA	NA	NA	NA
WP_018782577.1|1943969_1944248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006093402.1|1944396_1945710_+	alkaline phosphatase family protein	NA	A0A0M3PB47	Turkeypox_virus	22.2	1.5e-06
>prophage 162
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1951346	1956853	5229095		Planktothrix_phage(33.33%)	5	NA	NA
WP_006093415.1|1951346_1952387_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.7e-29
WP_018782582.1|1952399_1953212_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_040119093.1|1953647_1953965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018782584.1|1954063_1955605_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	28.2	2.2e-52
WP_018782586.1|1956103_1956853_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.6	8.1e-13
>prophage 163
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1965554	1968221	5229095		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_018782594.1|1965554_1966313_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.5	2.9e-18
WP_018782595.1|1966306_1967278_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_040119632.1|1967267_1968221_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	57.1	5.2e-97
>prophage 164
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1988186	1988909	5229095		Planktothrix_phage(100.0%)	1	NA	NA
WP_003194731.1|1988186_1988909_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.6	1.1e-35
>prophage 165
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	1994072	1994846	5229095		Pseudomonas_phage(100.0%)	1	NA	NA
WP_006093288.1|1994072_1994846_-	nucleotidyltransferase domain-containing protein	NA	Q8SCS5	Pseudomonas_phage	41.7	1.7e-42
>prophage 166
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2002806	2003856	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_006093273.1|2002806_2003856_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.8	1.3e-19
>prophage 167
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2007933	2008719	5229095		Escherichia_phage(100.0%)	1	NA	NA
WP_018782614.1|2007933_2008719_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	33.9	7.7e-22
>prophage 168
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2013673	2020150	5229095	tRNA	Oenococcus_phage(33.33%)	6	NA	NA
WP_018782619.1|2013673_2014783_+	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.3	7.3e-18
WP_018782620.1|2014797_2015493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006093254.1|2015563_2016271_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003205667.1|2016392_2016926_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	38.2	6.8e-22
WP_018782621.1|2017522_2018512_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_018782622.1|2018773_2020150_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	44.6	3.8e-109
>prophage 169
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2025344	2026916	5229095		Indivirus(100.0%)	1	NA	NA
WP_018782625.1|2025344_2026916_-	vanadium-dependent haloperoxidase	NA	A0A1V0SD32	Indivirus	41.8	2.4e-91
>prophage 170
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2034450	2035356	5229095		Catovirus(100.0%)	1	NA	NA
WP_029427566.1|2034450_2035356_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	31.1	1.8e-27
>prophage 171
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2048560	2052828	5229095		Ralstonia_phage(50.0%)	2	NA	NA
WP_006093215.1|2048560_2050570_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.3	3.9e-126
WP_003194627.1|2050584_2052828_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.8	9.2e-137
>prophage 172
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2059266	2063063	5229095		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_018783515.1|2059266_2060838_-	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	28.5	2.5e-48
WP_003194607.1|2060867_2062256_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	NA	NA	NA	NA
WP_003194606.1|2062286_2063063_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.6	4.6e-19
>prophage 173
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2066311	2077883	5229095		Synechococcus_phage(28.57%)	11	NA	NA
WP_003194601.1|2066311_2067847_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	55.1	9.3e-80
WP_040119088.1|2067871_2068459_-	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_003205715.1|2068455_2069496_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	44.0	2.3e-66
WP_018766468.1|2069612_2071028_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.2	9.5e-55
WP_018783511.1|2071012_2073232_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.1	6.9e-161
WP_018766466.1|2073215_2073899_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_040119087.1|2073895_2074150_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_018783510.1|2074142_2074862_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.5	1.7e-47
WP_018783509.1|2074951_2076253_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	24.7	1.4e-20
WP_018783508.1|2076249_2077401_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_006093209.1|2077397_2077883_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.9	8.6e-24
>prophage 174
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2090547	2093265	5229095		Bacillus_phage(66.67%)	3	NA	NA
WP_006093176.1|2090547_2091261_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	1.0e-33
WP_018783682.1|2091250_2092282_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.6	2.7e-30
WP_095995456.1|2092335_2093265_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.8	1.9e-40
>prophage 175
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2109784	2123223	5229095	protease,tRNA	Bacillus_phage(25.0%)	11	NA	NA
WP_040119628.1|2109784_2111302_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.6	1.5e-34
WP_016117050.1|2111297_2111999_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	6.2e-39
WP_003194563.1|2112141_2113467_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.4	4.4e-46
WP_050774399.1|2113860_2115459_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	2.3e-20
WP_006093172.1|2115828_2117463_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	3.8e-156
WP_000917305.1|2117500_2117785_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	8.9e-21
WP_016117047.1|2118221_2118965_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_016117046.1|2118967_2119162_+	YdiK family protein	NA	NA	NA	NA	NA
WP_003205609.1|2119187_2119817_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_029427937.1|2119946_2121926_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.8	3.6e-60
WP_003194551.1|2122206_2123223_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.2	4.6e-67
>prophage 176
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2141068	2141419	5229095		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003194532.1|2141068_2141419_-	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	2.2e-13
>prophage 177
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2146567	2148142	5229095		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_018782018.1|2146567_2148142_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.5	7.6e-69
>prophage 178
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2151417	2152692	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_018782016.1|2151417_2152692_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	25.3	3.3e-14
>prophage 179
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2160411	2162354	5229095		Planktothrix_phage(100.0%)	2	NA	NA
WP_018782011.1|2160411_2161377_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.4	9.8e-19
WP_006093147.1|2161373_2162354_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	1.6e-16
>prophage 180
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2169111	2174084	5229095		Staphylococcus_phage(50.0%)	4	NA	NA
WP_003194457.1|2169111_2170044_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.4	1.5e-32
WP_018767144.1|2170182_2170845_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_018782006.1|2170841_2172035_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_018782005.1|2172209_2174084_-	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	29.4	1.0e-48
>prophage 181
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2191369	2192173	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_018781994.1|2191369_2192173_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	29.9	4.8e-19
>prophage 182
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2199016	2205405	5229095		Bacillus_phage(66.67%)	6	NA	NA
WP_042511369.1|2199016_2200591_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A142F1E8	Bacillus_phage	29.5	1.4e-11
WP_018767167.1|2200850_2201306_-	transcriptional regulator	NA	A0A1P8CX48	Bacillus_phage	45.0	9.9e-30
WP_029427353.1|2201322_2201616_-	TnsA endonuclease	NA	NA	NA	NA	NA
WP_018781988.1|2202147_2202993_-	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_029427324.1|2202989_2203184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006097148.1|2203602_2205405_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	40.1	6.3e-104
>prophage 183
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2209749	2212009	5229095		Klosneuvirus(50.0%)	2	NA	NA
WP_003194411.1|2209749_2210643_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	31.9	4.2e-24
WP_018781984.1|2210863_2212009_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.6	1.4e-51
>prophage 184
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2222307	2223021	5229095		Vibrio_phage(100.0%)	1	NA	NA
WP_018783613.1|2222307_2223021_-	N-acetylmuramoyl-L-alanine amidase CwlD	NA	A0A067ZJB6	Vibrio_phage	33.7	1.7e-15
>prophage 185
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2226473	2228173	5229095		Planktothrix_phage(100.0%)	2	NA	NA
WP_018767976.1|2226473_2227355_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	1.2e-20
WP_003194387.1|2227330_2228173_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.0e-19
>prophage 186
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2243378	2255551	5229095		Catovirus(25.0%)	7	NA	NA
WP_003205504.1|2243378_2244569_-	elongation factor Tu	NA	A0A1V0SC62	Catovirus	25.7	1.0e-09
WP_018767347.1|2244686_2246765_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.8	2.8e-63
WP_003194344.1|2246971_2247442_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142341.1|2247471_2247894_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_018783075.1|2248009_2248258_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_003194339.1|2248371_2251983_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.1	4.0e-65
WP_018767348.1|2252020_2255551_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.7	7.4e-48
>prophage 187
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2259142	2259676	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_000415795.1|2259142_2259676_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	31.0	7.5e-13
>prophage 188
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2262688	2264086	5229095	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_018767351.1|2262688_2264086_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	29.3	4.8e-51
>prophage 189
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2271980	2274416	5229095	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_006093090.1|2271980_2274416_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	41.6	6.7e-133
>prophage 190
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2287760	2300842	5229095	protease,tRNA	Tupanvirus(28.57%)	14	NA	NA
WP_003194294.1|2287760_2289254_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.8	5.8e-95
WP_003194292.1|2289417_2290416_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000387032.1|2290439_2290643_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_018767315.1|2290594_2291110_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003194288.1|2291106_2291469_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_026008711.1|2291469_2292330_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	32.2	2.0e-23
WP_018783073.1|2292304_2293177_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_029427745.1|2293170_2293758_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	60.3	3.7e-69
WP_006093083.1|2293763_2295161_-	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	40.6	4.0e-37
WP_018767319.1|2295372_2296296_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	64.4	2.2e-108
WP_018783072.1|2296415_2297291_-	redox-regulated molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003194273.1|2297297_2298086_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_018767320.1|2298311_2300213_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	43.0	3.4e-116
WP_000981837.1|2300299_2300842_-	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L2A2	Tupanvirus	22.8	2.6e-05
>prophage 191
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2311057	2311594	5229095		Paenibacillus_phage(100.0%)	1	NA	NA
WP_006093076.1|2311057_2311594_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 192
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2316294	2321030	5229095		Tupanvirus(66.67%)	5	NA	NA
WP_000107420.1|2316294_2317248_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.2	6.0e-45
WP_018767328.1|2317266_2318646_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	35.3	3.3e-28
WP_002174553.1|2319156_2319450_-	septation protein SpoVG	NA	NA	NA	NA	NA
WP_018783065.1|2319602_2319977_-	RidA family protein	NA	NA	NA	NA	NA
WP_018783064.1|2320181_2321030_-	pur operon repressor	NA	A0A1V0SKE5	Klosneuvirus	25.2	6.4e-06
>prophage 193
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2326728	2334205	5229095	tRNA	Streptococcus_phage(60.0%)	9	NA	NA
WP_018783061.1|2326728_2328711_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.2	7.7e-95
WP_003194210.1|2329074_2329359_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	72.1	3.9e-16
WP_018783060.1|2329379_2330255_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.4	3.0e-67
WP_018783059.1|2330223_2330514_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_006093070.1|2330500_2331241_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_016116893.1|2331361_2331712_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_003194202.1|2331726_2332554_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_018783058.1|2332559_2333543_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.6	1.1e-30
WP_003194196.1|2333578_2334205_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	49.5	2.7e-54
>prophage 194
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2343106	2350159	5229095	tRNA	Bacteriophage(33.33%)	7	NA	NA
WP_018783549.1|2343106_2344795_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	32.9	5.3e-52
WP_003194173.1|2345271_2345769_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_018783550.1|2346101_2346641_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_006093065.1|2346762_2347398_+	deoxynucleoside kinase	NA	NA	NA	NA	NA
WP_003194179.1|2347400_2348069_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	35.4	2.2e-25
WP_003205423.1|2348104_2348488_-	DUF3797 domain-containing protein	NA	NA	NA	NA	NA
WP_003194183.1|2348884_2350159_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.0	1.5e-96
>prophage 195
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2353564	2355028	5229095		Klosneuvirus(100.0%)	1	NA	NA
WP_018783552.1|2353564_2355028_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.7	2.6e-95
>prophage 196
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2361429	2433872	5229095	protease,transposase,holin,integrase,tRNA	Bacillus_virus(19.05%)	66	2368651:2368669	2398509:2398527
WP_018782458.1|2361429_2363901_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.8	3.2e-114
WP_006096802.1|2363989_2365912_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.3	4.5e-140
WP_003194147.1|2365950_2367078_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003194149.1|2367090_2367303_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_003194151.1|2367430_2368576_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	36.3	5.8e-18
2368651:2368669	attL	CTTGTGGATATGTGGATAA	NA	NA	NA	NA
WP_003194153.1|2368754_2370095_-	chromosomal replication initiator protein DnaA	NA	A0A0K2CNV5	Brevibacillus_phage	36.5	2.9e-05
WP_000831901.1|2370658_2370793_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_016112830.1|2370869_2371217_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_018782457.1|2371275_2372043_+|integrase	YidC family membrane integrase SpoIIIJ	integrase	NA	NA	NA	NA
WP_018764823.1|2372039_2372657_+	protein jag	NA	NA	NA	NA	NA
WP_003202594.1|2372893_2374270_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_018782456.1|2374315_2376205_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_006096787.1|2376226_2376946_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_003209340.1|2377051_2377924_+	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	45.0	2.4e-16
WP_003202576.1|2378113_2378875_+	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	30.1	4.7e-24
WP_018782455.1|2378867_2379719_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	34.6	2.8e-17
WP_018782454.1|2379739_2380336_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	38.2	5.8e-22
WP_003202583.1|2380608_2381490_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_018782453.1|2381510_2381708_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_006096782.1|2381823_2382924_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_003209337.1|2383116_2383407_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_016112819.1|2383434_2383947_+	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	64.1	2.7e-52
WP_000918874.1|2383992_2384226_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003202592.1|2384306_2385245_+	YybS family protein	NA	NA	NA	NA	NA
WP_018764826.1|2385397_2387371_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_018764827.1|2387367_2387814_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_006096771.1|2387841_2389203_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	1.3e-122
WP_003202567.1|2389419_2390709_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	36.8	5.1e-71
WP_000971870.1|2391521_2392229_+	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	43.1	3.4e-45
WP_003202552.1|2392232_2394068_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.0	1.0e-37
WP_018782452.1|2394064_2395408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018782451.1|2395388_2396216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003202558.1|2396222_2397017_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	36.9	2.1e-43
WP_018782450.1|2397080_2398265_+|protease	serine protease	protease	W5SAB9	Pithovirus	30.8	3.9e-09
WP_026008486.1|2398320_2398506_+	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_003209320.1|2398565_2399045_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
2398509:2398527	attR	CTTGTGGATATGTGGATAA	NA	NA	NA	NA
WP_018782449.1|2399397_2400276_+	radical SAM protein	NA	NA	NA	NA	NA
WP_018782448.1|2400372_2401356_-	GMP reductase	NA	G3MBI2	Bacillus_virus	85.0	2.4e-158
WP_006096762.1|2401654_2402728_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_018782447.1|2402815_2404417_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_018782446.1|2404406_2405105_+	response regulator	NA	NA	NA	NA	NA
WP_029427504.1|2405225_2406515_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_018782443.1|2406952_2408215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018782442.1|2408651_2410097_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	33.6	1.0e-56
WP_018764839.1|2410205_2410757_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_018782441.1|2410746_2411361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144569328.1|2412006_2412153_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_018782439.1|2412229_2412790_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_018782438.1|2412944_2413592_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_018782437.1|2413766_2414180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006096751.1|2414658_2415249_+	transporter	NA	NA	NA	NA	NA
WP_018782436.1|2415381_2416251_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_018782435.1|2416602_2417673_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_003202478.1|2417719_2417875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018782433.1|2417949_2419722_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.6	7.2e-68
WP_018782432.1|2419699_2420440_+	response regulator	NA	NA	NA	NA	NA
WP_018782431.1|2420572_2421004_+|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_003202485.1|2421039_2421732_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_003202488.1|2422067_2423102_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_018782430.1|2423198_2424164_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_018782429.1|2424189_2427312_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	25.2	4.8e-75
WP_018782428.1|2427612_2428488_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_018782427.1|2428655_2429633_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	43.3	3.6e-61
WP_018782426.1|2429676_2430057_-	GtrA family protein	NA	NA	NA	NA	NA
WP_018782424.1|2430634_2432110_+	membrane protein	NA	NA	NA	NA	NA
WP_080740116.1|2432279_2433872_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.5	1.5e-48
>prophage 197
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2458981	2460280	5229095		Orpheovirus(100.0%)	1	NA	NA
WP_018782407.1|2458981_2460280_+	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A2I2L687	Orpheovirus	25.2	2.8e-08
>prophage 198
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2464437	2468905	5229095		Enterobacteria_phage(33.33%)	5	NA	NA
WP_018782404.1|2464437_2465415_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.2	3.5e-16
WP_018782403.1|2465496_2466309_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_018782402.1|2466305_2467223_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.1	6.8e-38
WP_018782401.1|2467215_2468208_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_018782400.1|2468227_2468905_+	uracil-DNA glycosylase	NA	S4VZ65	Pandoravirus	44.7	2.4e-48
>prophage 199
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2475092	2476370	5229095		Stx2-converting_phage(100.0%)	1	NA	NA
WP_040119077.1|2475092_2476370_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.8	9.6e-22
>prophage 200
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2483731	2487116	5229095		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_003202423.1|2483731_2484544_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.1	1.9e-15
WP_018782394.1|2484744_2485686_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016112734.1|2485811_2487116_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	26.8	4.4e-22
>prophage 201
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2490944	2491670	5229095		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_018782391.1|2490944_2491670_-	glycerophosphodiester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	33.0	6.2e-18
>prophage 202
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2509153	2510056	5229095		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_006096684.1|2509153_2510056_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.2	1.2e-23
>prophage 203
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2514699	2515653	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_018781171.1|2514699_2515653_-	UV DNA damage repair endonuclease UvsE	NA	G3MAQ2	Bacillus_virus	33.9	2.9e-39
>prophage 204
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2525539	2528284	5229095		Only_Syngen_Nebraska_virus(50.0%)	3	NA	NA
WP_003202338.1|2525539_2527147_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.3	3.0e-145
WP_018764917.1|2527182_2527710_-	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_000398590.1|2527915_2528284_+	sporulation initiation phosphotransferase Spo0F	NA	W8CYM9	Bacillus_phage	38.3	2.9e-11
>prophage 205
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2534406	2534991	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_003202246.1|2534406_2534991_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	1.4e-33
>prophage 206
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2539057	2540101	5229095		Pandoravirus(100.0%)	1	NA	NA
WP_018781177.1|2539057_2540101_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	43.8	7.5e-65
>prophage 207
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2546183	2547425	5229095		Aeromonas_phage(100.0%)	1	NA	NA
WP_018764927.1|2546183_2547425_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.4	2.5e-99
>prophage 208
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2571808	2581514	5229095		Pseudomonas_phage(20.0%)	10	NA	NA
WP_006096642.1|2571808_2572822_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	45.0	2.8e-48
WP_018781189.1|2573063_2574680_+	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_018781190.1|2574805_2575813_+	ATP-binding cassette domain-containing protein	NA	A0A2R2ZGH8	Clostridioides_phage	25.3	5.8e-06
WP_003209202.1|2576001_2576844_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	8.8e-32
WP_018781191.1|2576843_2577551_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_018781192.1|2577713_2578727_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_042511388.1|2578868_2579003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018781193.1|2579332_2579605_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	43.7	1.0e-13
WP_003202097.1|2579767_2580769_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_006096636.1|2581118_2581514_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	43.7	2.6e-18
>prophage 209
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2590273	2597993	5229095		Bacillus_phage(33.33%)	6	NA	NA
WP_018781199.1|2590273_2591155_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.0	1.1e-80
WP_018781200.1|2592138_2592837_+	LPS biosynthesis protein	NA	NA	NA	NA	NA
WP_018781201.1|2592826_2593486_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_003202117.1|2593870_2595685_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	28.9	1.7e-24
WP_018781202.1|2595796_2596963_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_018781203.1|2596925_2597993_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.8	1.8e-10
>prophage 210
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2601319	2602096	5229095		Catovirus(100.0%)	1	NA	NA
WP_018781205.1|2601319_2602096_+	glycosyl transferase	NA	A0A1V0SBR5	Catovirus	29.4	2.0e-06
>prophage 211
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2610772	2611861	5229095		Enterobacter_phage(100.0%)	1	NA	NA
WP_018781212.1|2610772_2611861_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	26.0	4.1e-05
>prophage 212
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2616305	2617475	5229095		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_018781216.1|2616305_2617475_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	24.7	5.9e-18
>prophage 213
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2623644	2646539	5229095		Catovirus(28.57%)	18	NA	NA
WP_018781218.1|2623644_2625447_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	1.8e-29
WP_003202177.1|2626570_2627005_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_018764974.1|2627558_2628296_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_018764975.1|2628285_2628975_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.9	1.6e-26
WP_018781219.1|2629068_2629836_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_018781222.1|2631034_2632873_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	30.1	1.6e-25
WP_040119069.1|2632865_2634158_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_123767157.1|2634188_2635412_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_018781225.1|2635507_2636860_+	nucleotide sugar dehydrogenase	NA	M1IC36	Acanthocystis_turfacea_Chlorella_virus	32.6	7.5e-41
WP_018781226.1|2636955_2638083_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_018781227.1|2638082_2639249_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_018781228.1|2639249_2639768_+	sugar transferase	NA	NA	NA	NA	NA
WP_018781229.1|2639764_2640388_+	acetyltransferase	NA	A0A2P1ELV4	Moumouvirus	33.7	9.4e-07
WP_003202204.1|2640419_2641580_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_018781231.1|2642463_2643093_+	class D sortase	NA	NA	NA	NA	NA
WP_006096592.1|2643256_2644285_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.7	4.7e-96
WP_003202214.1|2644550_2645459_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033794464.1|2645774_2646539_-	LicD family protein	NA	A0A1V0SAS8	Catovirus	26.4	1.1e-09
>prophage 214
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2650608	2652384	5229095		Tupanvirus(50.0%)	2	NA	NA
WP_018781235.1|2650608_2651601_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	39.0	2.1e-53
WP_003202224.1|2651712_2652384_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.4	1.1e-37
>prophage 215
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2660173	2660854	5229095		Planktothrix_phage(100.0%)	1	NA	NA
WP_018781240.1|2660173_2660854_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	5.2e-35
>prophage 216
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2666159	2668916	5229095		Pneumococcus_phage(100.0%)	1	NA	NA
WP_018781245.1|2666159_2668916_-	DEAD/DEAH box helicase	NA	E7DNC5	Pneumococcus_phage	26.3	3.6e-34
>prophage 217
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2674697	2686925	5229095		Vibrio_phage(33.33%)	8	NA	NA
WP_018781251.1|2674697_2675582_-	SH3 domain-containing protein	NA	A7KV71	Bacillus_phage	73.5	1.2e-36
WP_006097495.1|2676250_2677765_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.6	2.4e-32
WP_006097494.1|2678508_2679720_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	22.6	6.5e-20
WP_018781252.1|2680058_2680223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018781254.1|2680589_2682302_-	SH3 domain-containing protein	NA	D2KRB9	Lactobacillus_phage	33.0	6.2e-08
WP_033794465.1|2682512_2683397_-	D-amino-acid transaminase	NA	NA	NA	NA	NA
WP_018781256.1|2683827_2685756_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	38.7	2.1e-105
WP_018781258.1|2686559_2686925_+	DUF1232 domain-containing protein	NA	A0A2I7S9Z5	Vibrio_phage	41.5	2.6e-12
>prophage 218
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2692532	2693891	5229095		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_018781262.1|2692532_2693891_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	30.0	2.0e-49
>prophage 219
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2717191	2727993	5229095		Bacillus_phage(28.57%)	10	NA	NA
WP_040119066.1|2717191_2718517_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.1	2.6e-86
WP_018781279.1|2718975_2720094_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.9	6.0e-20
WP_006096566.1|2720163_2721264_-	LCP family protein	NA	NA	NA	NA	NA
WP_003202049.1|2721291_2721933_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	51.7	2.0e-36
WP_006096565.1|2722173_2723016_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	39.2	2.1e-17
WP_016112543.1|2723396_2723711_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040119065.1|2723987_2725286_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	38.2	1.4e-12
WP_040119064.1|2725618_2726965_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	38.0	2.1e-64
WP_042511394.1|2726964_2727669_+	ComF family protein	NA	NA	NA	NA	NA
WP_001162040.1|2727795_2727993_+	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	69.4	2.6e-19
>prophage 220
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2735176	2738301	5229095		Planktothrix_phage(50.0%)	3	NA	NA
WP_003209063.1|2735176_2735863_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.4	2.2e-25
WP_018765117.1|2735852_2736746_+	cell division ABC transporter permease FtsX	NA	NA	NA	NA	NA
WP_029427067.1|2736816_2738301_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	30.0	1.7e-22
>prophage 221
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2742017	2742911	5229095		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003201848.1|2742017_2742911_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	1.9e-08
>prophage 222
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2750060	2752931	5229095		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_006096545.1|2750060_2752931_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.6	0.0e+00
>prophage 223
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2758520	2759477	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_018781296.1|2758520_2759477_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	54.2	6.2e-90
>prophage 224
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2764254	2767131	5229095		Streptococcus_phage(66.67%)	3	NA	NA
WP_003201889.1|2764254_2765136_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.6	4.2e-08
WP_003201891.1|2765139_2766093_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.1	3.4e-64
WP_003201892.1|2766180_2767131_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.1	3.9e-52
>prophage 225
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2777043	2777625	5229095		Agrobacterium_phage(100.0%)	1	NA	NA
WP_001049163.1|2777043_2777625_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.8e-55
>prophage 226
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2789810	2791103	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_003201939.1|2789810_2791103_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	76.3	1.3e-183
>prophage 227
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2794799	2799919	5229095	integrase	Lactococcus_phage(33.33%)	3	2798426:2798442	2809596:2809612
WP_018783334.1|2794799_2797214_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.0	1.7e-91
WP_001123909.1|2797435_2797903_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	61.3	8.3e-48
2798426:2798442	attL	GAACCATAAGTTTGCCG	NA	NA	NA	NA
WP_002203150.1|2798701_2799919_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	24.4	3.2e-06
WP_002203150.1|2798701_2799919_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	24.4	3.2e-06
2809596:2809612	attR	CGGCAAACTTATGGTTC	NA	NA	NA	NA
>prophage 228
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2809838	2811326	5229095		Acinetobacter_phage(100.0%)	1	NA	NA
WP_033794579.1|2809838_2811326_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	38.9	4.5e-79
>prophage 229
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2824100	2825363	5229095	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_018782740.1|2824100_2825363_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.6	5.3e-89
>prophage 230
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2829892	2830735	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_018782742.1|2829892_2830735_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	53.3	3.9e-80
>prophage 231
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2840269	2841831	5229095		Catovirus(50.0%)	3	NA	NA
WP_018782746.1|2840269_2840848_+	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	26.0	3.0e-15
WP_080740095.1|2840875_2841091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018765061.1|2841390_2841831_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	63.7	1.3e-47
>prophage 232
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2849245	2850874	5229095	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_018782753.1|2849245_2850874_+|tRNA	methionine--tRNA ligase	tRNA	A0A2P1EMD9	Moumouvirus	30.7	2.6e-72
>prophage 233
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2856104	2856998	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_018765048.1|2856104_2856998_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	32.2	2.6e-26
>prophage 234
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2866429	2867347	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003201679.1|2866429_2867347_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	43.6	1.9e-64
>prophage 235
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2875046	2876350	5229095		Clostridioides_phage(50.0%)	3	NA	NA
WP_018782766.1|2875046_2875274_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	47.1	1.5e-07
WP_018782767.1|2875270_2875558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018782768.1|2875633_2876350_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	28.7	5.8e-08
>prophage 236
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2880903	2890339	5229095		Streptococcus_phage(20.0%)	12	NA	NA
WP_003201715.1|2880903_2881269_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	47.7	1.5e-20
WP_006096504.1|2881310_2881694_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000263236.1|2882143_2882488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018765004.1|2882500_2882800_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_018782774.1|2882952_2883297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003201726.1|2883797_2884823_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	2.5e-28
WP_018765001.1|2884815_2885481_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_018765000.1|2885559_2886369_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000929159.1|2886604_2887390_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.8	1.3e-08
WP_003201733.1|2887405_2888698_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_006096509.1|2888697_2889918_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.8	5.0e-121
WP_018782777.1|2889907_2890339_+	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	36.8	3.2e-14
>prophage 237
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2912792	2913581	5229095		Planktothrix_phage(100.0%)	1	NA	NA
WP_003201505.1|2912792_2913581_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	2.6e-33
>prophage 238
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2920008	2921127	5229095	protease	Acinetobacter_phage(100.0%)	1	NA	NA
WP_040119047.1|2920008_2921127_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	32.4	3.1e-40
>prophage 239
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2925727	2931675	5229095	coat	Bacillus_virus(50.0%)	9	NA	NA
WP_003201532.1|2925727_2926003_-	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	46.2	1.2e-09
WP_018767382.1|2926299_2926791_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	54.5	4.6e-41
WP_018767383.1|2926910_2927912_+|coat	spore coat protein YutH	coat	NA	NA	NA	NA
WP_000431179.1|2928125_2928362_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_003201537.1|2928570_2928879_+	YuzD family protein	NA	NA	NA	NA	NA
WP_040119043.1|2928972_2929773_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_016112359.1|2929866_2930025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018782857.1|2930243_2931032_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_040119042.1|2931015_2931675_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.1e-20
>prophage 240
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2935307	2937051	5229095		Lake_Baikal_phage(50.0%)	3	NA	NA
WP_003201551.1|2935307_2935661_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	42.3	1.7e-16
WP_006096389.1|2936350_2936506_+	FbpB family small basic protein	NA	NA	NA	NA	NA
WP_018782854.1|2936697_2937051_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	38.0	1.1e-12
>prophage 241
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2943660	2944650	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_018767483.1|2943660_2944650_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	53.2	7.9e-32
>prophage 242
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2948005	2957537	5229095	tRNA	Bacillus_phage(40.0%)	10	NA	NA
WP_018767486.1|2948005_2948632_+	3D domain-containing protein	NA	A0A127AW72	Bacillus_phage	35.0	4.7e-14
WP_018782848.1|2948701_2949076_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_040119038.1|2949151_2950636_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.9	9.6e-58
WP_018782846.1|2950674_2951280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040119037.1|2951423_2953148_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.9	1.3e-178
WP_003201589.1|2953340_2954228_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	4.5e-79
WP_006096375.1|2954267_2954858_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_033799196.1|2954908_2955652_-	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_006096373.1|2955745_2956129_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_003208934.1|2956160_2957537_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.7	5.3e-50
>prophage 243
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2962898	2963438	5229095		Lymantria_dispar_multicapsid_nuclear_polyhedrosis_virus(100.0%)	1	NA	NA
WP_040119036.1|2962898_2963438_+	superoxide dismutase family protein	NA	A0A0D3QVZ9	Lymantria_dispar_multicapsid_nuclear_polyhedrosis_virus	35.1	3.0e-09
>prophage 244
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2973433	2974114	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_003201638.1|2973433_2974114_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.1	2.7e-15
>prophage 245
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2992186	2994595	5229095		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_040119034.1|2992186_2994595_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.1	1.2e-09
>prophage 246
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	2998124	2998325	5229095		Lactococcus_phage(100.0%)	1	NA	NA
WP_001193049.1|2998124_2998325_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	3.8e-18
>prophage 247
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3003610	3007084	5229095		Mycobacterium_phage(50.0%)	3	NA	NA
WP_033796493.1|3003610_3004423_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	W0LNB3	Mycobacterium_phage	32.1	4.2e-07
WP_003201443.1|3004502_3005321_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_040119031.1|3005638_3007084_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	31.7	7.2e-66
>prophage 248
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3011112	3011865	5229095		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_006096319.1|3011112_3011865_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.1	5.5e-17
>prophage 249
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3015880	3021234	5229095		uncultured_virus(25.0%)	6	NA	NA
WP_018782040.1|3015880_3016153_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	37.2	3.5e-06
WP_040119029.1|3016149_3016782_+	SdpI family protein	NA	NA	NA	NA	NA
WP_018782042.1|3016923_3017640_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.0	5.9e-13
WP_040119028.1|3017629_3019204_+	permease	NA	NA	NA	NA	NA
WP_033799178.1|3019294_3020167_-	AraC family transcriptional regulator	NA	D0R0F8	Streptococcus_phage	34.0	6.7e-35
WP_003201420.1|3020463_3021234_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	4.3e-33
>prophage 250
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3025196	3025727	5229095		Hokovirus(100.0%)	1	NA	NA
WP_003201413.1|3025196_3025727_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	32.4	7.5e-13
>prophage 251
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3031026	3033512	5229095		Bacillus_phage(100.0%)	2	NA	NA
WP_006096337.1|3031026_3031716_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	6.5e-33
WP_033799181.1|3031712_3033512_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	1.9e-28
>prophage 252
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3044903	3045119	5229095		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_018764613.1|3044903_3045119_+	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	56.9	2.1e-14
>prophage 253
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3048314	3048545	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_018764610.1|3048314_3048545_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	71.6	1.4e-27
>prophage 254
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3053850	3063124	5229095		Enterobacteria_phage(25.0%)	13	NA	NA
WP_040119022.1|3053850_3054840_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.2	4.7e-16
WP_003208871.1|3054974_3055397_+	DUF5412 domain-containing protein	NA	NA	NA	NA	NA
WP_040119021.1|3055491_3055716_-	DUF3953 domain-containing protein	NA	NA	NA	NA	NA
WP_018782063.1|3055742_3055973_-	DUF3953 domain-containing protein	NA	NA	NA	NA	NA
WP_040119020.1|3056000_3056231_-	DUF3953 domain-containing protein	NA	NA	NA	NA	NA
WP_018782064.1|3056232_3056382_-	YtzI protein	NA	NA	NA	NA	NA
WP_018764600.1|3056490_3056808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003202680.1|3056893_3057373_+	antimutator 8-oxo-(dGTP/GTP)ase	NA	A0A2H4PQM4	Staphylococcus_phage	34.0	2.8e-19
WP_040119019.1|3058120_3060226_+	hypothetical protein	NA	M4ZRP4	Bacillus_phage	39.8	1.3e-20
WP_018764598.1|3060397_3061057_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_018782066.1|3061264_3061492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018782067.1|3061560_3062367_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_006096294.1|3062359_3063124_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.2	1.8e-36
>prophage 255
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3066446	3068264	5229095		Pseudomonas_phage(100.0%)	1	NA	NA
WP_029427345.1|3066446_3068264_+	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	36.5	8.8e-45
>prophage 256
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3075625	3078928	5229095		Staphylococcus_phage(100.0%)	2	NA	NA
WP_018782077.1|3075625_3077212_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	65.3	6.0e-199
WP_003201301.1|3077728_3078928_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.9	2.7e-159
>prophage 257
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3089664	3101596	5229095	tRNA	Staphylococcus_phage(66.67%)	11	NA	NA
WP_018782087.1|3089664_3090237_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	53.4	7.8e-48
WP_006096271.1|3090233_3091193_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	72.5	4.5e-56
WP_003208776.1|3091303_3091567_+	YtzC family protein	NA	NA	NA	NA	NA
WP_003208774.1|3091582_3091732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018782088.1|3092019_3092382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018782089.1|3092831_3093593_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	31.9	5.0e-10
WP_006096268.1|3093609_3095463_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006096267.1|3095627_3096821_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	50.5	1.5e-101
WP_018782090.1|3097227_3099636_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.3	0.0e+00
WP_040119018.1|3099781_3100684_+	protein VrrB	NA	NA	NA	NA	NA
WP_018782832.1|3101167_3101596_-	haloacid dehalogenase	NA	A0A0K2CNN3	Brevibacillus_phage	52.7	2.9e-31
>prophage 258
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3108155	3108461	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003201171.1|3108155_3108461_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	42.2	2.8e-12
>prophage 259
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3111505	3112981	5229095		Escherichia_phage(100.0%)	1	NA	NA
WP_018782825.1|3111505_3112981_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	47.3	1.2e-20
>prophage 260
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3120130	3121144	5229095		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_018782821.1|3120130_3121144_+	molybdopterin-synthase adenylyltransferase MoeB	NA	E3T5K6	Cafeteria_roenbergensis_virus	25.0	9.6e-09
>prophage 261
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3128439	3131252	5229095		Mycobacterium_phage(50.0%)	2	NA	NA
WP_018782815.1|3128439_3129873_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.0	1.5e-28
WP_006096244.1|3129980_3131252_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	62.7	1.1e-28
>prophage 262
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3142932	3144495	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_018782808.1|3142932_3144495_+	fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.2	4.9e-36
>prophage 263
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3151997	3152810	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_018782801.1|3151997_3152810_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	64.1	2.6e-41
>prophage 264
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3155847	3159408	5229095		Mycobacterium_phage(100.0%)	1	NA	NA
WP_040119011.1|3155847_3159408_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.8	9.0e-86
>prophage 265
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3166988	3168059	5229095		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_006096104.1|3166988_3168059_+	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	31.5	9.5e-15
>prophage 266
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3175608	3177327	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003201133.1|3175608_3177327_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	71.9	1.2e-205
>prophage 267
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3181249	3182506	5229095	tRNA	Pectobacterium_phage(100.0%)	1	NA	NA
WP_003201146.1|3181249_3182506_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.5	7.6e-80
>prophage 268
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3190490	3194864	5229095	tRNA	Faustovirus(33.33%)	4	NA	NA
WP_018781593.1|3190490_3191633_+	cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	27.0	2.4e-32
WP_006096130.1|3191639_3192851_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_000168892.1|3192930_3193125_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	67.7	2.5e-14
WP_018781594.1|3193277_3194864_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.3	4.0e-78
>prophage 269
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3207458	3209006	5229095		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_003201050.1|3207458_3209006_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	28.7	2.0e-13
>prophage 270
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3232141	3235471	5229095		Streptomyces_phage(100.0%)	1	NA	NA
WP_018781621.1|3232141_3235471_+	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	35.1	6.3e-182
>prophage 271
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3240699	3242457	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_006096173.1|3240699_3242457_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	41.1	6.8e-10
>prophage 272
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3250416	3271178	5229095	tRNA	Bacillus_phage(27.27%)	19	NA	NA
WP_006096178.1|3250416_3250740_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	38.4	6.2e-10
WP_003200984.1|3250911_3251628_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.7	2.5e-43
WP_018781625.1|3251620_3253384_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	40.6	6.5e-45
WP_018781626.1|3254335_3256969_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	29.1	6.7e-46
WP_018781627.1|3256981_3257812_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	29.3	5.1e-24
WP_003200991.1|3257895_3258528_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_018781628.1|3258580_3259183_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_018764454.1|3259292_3260321_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000380453.1|3260700_3261093_+	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.8	3.0e-19
WP_016116577.1|3261357_3261819_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_006096186.1|3261930_3263337_+	Replication initiation and membrane attachment protein	NA	NA	NA	NA	NA
WP_003201005.1|3263370_3264309_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	35.3	9.4e-43
WP_006096188.1|3264541_3265423_+	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_018781629.1|3265730_3267662_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.5	5.2e-112
WP_000606672.1|3268054_3268555_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.8	4.7e-17
WP_001125945.1|3268576_3268777_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003201011.1|3268814_3269171_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003201014.1|3269369_3270386_+	alcohol dehydrogenase AdhP	NA	A0A2P1EIJ9	Megavirus	30.8	5.8e-38
WP_003200923.1|3270686_3271178_+	hypothetical protein	NA	R9TQ23	Paenibacillus_phage	39.9	3.0e-24
>prophage 273
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3280625	3281660	5229095	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_003200942.1|3280625_3281660_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.1	2.4e-31
>prophage 274
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3285218	3286610	5229095	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_006096202.1|3285218_3286610_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	37.1	1.4e-82
>prophage 275
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3289986	3294087	5229095		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_006096206.1|3289986_3291705_+	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	23.3	4.9e-13
WP_018781639.1|3291726_3294087_+	endonuclease MutS2	NA	F2QAF7	Pyramimonas_orientalis_virus	29.6	1.5e-15
>prophage 276
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3297097	3302752	5229095		Cafeteria_roenbergensis_virus(20.0%)	6	NA	NA
WP_018781642.1|3297097_3297685_+	2OG-Fe(II) oxygenase	NA	E3T5C0	Cafeteria_roenbergensis_virus	34.5	2.2e-29
WP_018781643.1|3298113_3299313_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.5	1.2e-74
WP_006096211.1|3299406_3299601_-	YwbE family protein	NA	NA	NA	NA	NA
WP_003200910.1|3299944_3300637_+	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	29.8	6.2e-07
WP_006096213.1|3300638_3301574_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	1.5e-24
WP_026008453.1|3301828_3302752_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	4.5e-45
>prophage 277
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3306991	3308677	5229095		Hepacivirus(100.0%)	1	NA	NA
WP_018781651.1|3306991_3308677_+	long-chain-fatty-acid--CoA ligase	NA	Q75ZG1	Hepacivirus	30.5	2.7e-56
>prophage 278
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3312245	3314937	5229095		Orpheovirus(50.0%)	3	NA	NA
WP_003200692.1|3312245_3312560_+	thioredoxin	NA	A0A2I2L415	Orpheovirus	40.0	1.9e-08
WP_018781653.1|3312729_3313902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018781654.1|3313989_3314937_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2K9L4U8	Tupanvirus	34.8	2.0e-40
>prophage 279
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3330236	3331121	5229095		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_018781663.1|3330236_3331121_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	3.0e-22
>prophage 280
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3335567	3337277	5229095		Enterobacteria_phage(100.0%)	1	NA	NA
WP_051091455.1|3335567_3337277_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	6.2e-16
>prophage 281
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3341745	3344832	5229095		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_018781671.1|3341745_3344832_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	35.6	1.8e-175
>prophage 282
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3349203	3349428	5229095		Caldibacillus_phage(100.0%)	1	NA	NA
WP_000659494.1|3349203_3349428_+	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	78.7	1.5e-15
>prophage 283
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3352517	3353129	5229095		Ugandan_cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_018781674.1|3352517_3353129_+	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	32.0	8.7e-13
>prophage 284
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3358418	3364148	5229095	protease	Bacillus_virus(33.33%)	3	NA	NA
WP_018764399.1|3358418_3359678_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.8	6.5e-148
WP_003200791.1|3359784_3361455_+|protease	ATP-dependent protease LonB	protease	A0A2K9L620	Tupanvirus	33.5	4.5e-11
WP_003200793.1|3361817_3364148_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.3	1.3e-178
>prophage 285
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3375556	3378202	5229095	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_003208630.1|3375556_3378202_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.7	5.5e-165
>prophage 286
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3395214	3395991	5229095		Pithovirus(100.0%)	1	NA	NA
WP_006096061.1|3395214_3395991_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.6	1.3e-18
>prophage 287
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3413390	3417102	5229095	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_003200439.1|3413390_3414392_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	5.2e-07
WP_026008581.1|3414388_3414589_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003208591.1|3414607_3415660_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_018782984.1|3415674_3416814_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	41.5	7.3e-82
WP_018782985.1|3416841_3417102_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.4	2.2e-05
>prophage 288
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3420784	3429632	5229095		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_003200458.1|3420784_3423046_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.7	1.7e-29
WP_018765899.1|3423318_3424212_+	cation transporter	NA	NA	NA	NA	NA
WP_018782986.1|3424331_3426671_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.1	8.3e-88
WP_003200465.1|3426718_3427231_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	4.2e-29
WP_003200467.1|3427445_3429632_+	GTP diphosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	35.8	4.1e-12
>prophage 289
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3433281	3438624	5229095	tRNA	Klosneuvirus(50.0%)	4	NA	NA
WP_003208580.1|3433281_3435057_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	33.1	2.4e-15
WP_000903177.1|3435564_3436332_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_018765894.1|3436649_3437300_-	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_018782987.1|3437337_3438624_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	53.0	1.5e-120
>prophage 290
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3442529	3449805	5229095	tRNA	Virus_Rctr197k(50.0%)	6	NA	NA
WP_006096043.1|3442529_3444866_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	28.0	2.3e-53
WP_000490499.1|3445007_3445196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102898.1|3445215_3445344_+	YrzQ family protein	NA	NA	NA	NA	NA
WP_018782989.1|3445390_3445603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018765888.1|3445787_3446846_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003200499.1|3447162_3449805_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	35.3	3.7e-68
>prophage 291
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3453021	3455906	5229095		Phage_TP(66.67%)	3	NA	NA
WP_003200512.1|3453021_3453951_+	U32 family peptidase	NA	Q6DW11	Phage_TP	30.9	2.2e-20
WP_003200513.1|3453969_3455250_+	U32 family peptidase	NA	Q6DW11	Phage_TP	30.7	9.6e-38
WP_003200515.1|3455267_3455906_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.0	8.4e-35
>prophage 292
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3462053	3465057	5229095	transposase	Streptococcus_phage(33.33%)	3	NA	NA
WP_018782994.1|3462053_3462977_+	O-acetylserine dependent cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	42.7	1.1e-64
WP_040119000.1|3462980_3464114_+	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	28.1	1.4e-21
WP_006097496.1|3464175_3465057_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.7	5.0e-46
>prophage 293
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3487330	3488044	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_018765865.1|3487330_3488044_+	RNA polymerase sporulation sigma factor SigK	NA	S6ANS0	Bacillus_phage	28.5	1.1e-14
>prophage 294
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3496584	3499641	5229095		Bacillus_phage(50.0%)	2	NA	NA
WP_003200607.1|3496584_3497142_+	ComE operon protein 2	NA	F8WPT6	Bacillus_phage	51.5	6.4e-31
WP_018782545.1|3497316_3499641_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	33.5	2.7e-38
>prophage 295
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3503649	3505473	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_003200617.1|3503649_3505473_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.2	2.0e-25
>prophage 296
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3509047	3512220	5229095		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_003200627.1|3509047_3510883_+	chaperone protein DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.5	1.4e-138
WP_003200629.1|3511107_3512220_+	chaperone protein DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.1	8.9e-24
>prophage 297
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3516760	3519904	5229095		Bacillus_virus(50.0%)	4	NA	NA
WP_003200639.1|3516760_3517204_+	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	43.2	2.2e-18
WP_003200641.1|3517311_3517608_+	sporulation protein YqfC	NA	NA	NA	NA	NA
WP_018782549.1|3517741_3518941_+	sporulation protein YqfD	NA	NA	NA	NA	NA
WP_003208528.1|3518944_3519904_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.4	6.9e-49
>prophage 298
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3528011	3540702	5229095	tRNA	Helicobacter_phage(16.67%)	12	NA	NA
WP_006095997.1|3528011_3529808_+	DNA primase	NA	A0A1S5RFR1	Helicobacter_phage	30.3	3.1e-42
WP_003200669.1|3529867_3530989_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.5	3.8e-38
WP_003200671.1|3531374_3531731_+	cytochrome c	NA	NA	NA	NA	NA
WP_006095998.1|3531943_3532651_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_040118997.1|3532647_3533769_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A2P1EK93	Megavirus	46.9	3.9e-19
WP_003200678.1|3534000_3534951_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_040118996.1|3535041_3535698_-	VrrA protein product	NA	NA	NA	NA	NA
WP_040118995.1|3535879_3537190_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	31.7	1.6e-48
WP_040118994.1|3537469_3538366_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	31.3	3.9e-22
WP_003200331.1|3538386_3538641_-	DUF2624 domain-containing protein	NA	NA	NA	NA	NA
WP_040118993.1|3538792_3539671_+	YitT family protein	NA	NA	NA	NA	NA
WP_018782557.1|3539931_3540702_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	27.4	2.0e-14
>prophage 299
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3545443	3546055	5229095		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003200350.1|3545443_3546055_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	61.2	4.2e-68
>prophage 300
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3552784	3557296	5229095		Indivirus(50.0%)	3	NA	NA
WP_016116339.1|3552784_3553600_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.6	8.5e-16
WP_016116338.1|3553941_3554598_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_040118992.1|3554941_3557296_+	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	32.0	3.9e-21
>prophage 301
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3564453	3571364	5229095		Pandoravirus(50.0%)	3	NA	NA
WP_006096010.1|3564453_3565566_-	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	26.6	4.4e-15
WP_040118990.1|3566133_3567966_+	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_040118989.1|3567965_3571364_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	50.0	4.8e-12
>prophage 302
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3587090	3595037	5229095		Prochlorococcus_phage(50.0%)	7	NA	NA
WP_003200263.1|3587090_3587543_+	TlpA family protein disulfide reductase	NA	A0A127AW88	Bacillus_phage	47.9	1.3e-34
WP_003200265.1|3587788_3588016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018780764.1|3588287_3589082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003200271.1|3589068_3590751_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	30.5	3.5e-56
WP_003200273.1|3591100_3592201_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_040118984.1|3592221_3593565_+	aminomethyl-transferring glycine dehydrogenase subunit 1	NA	E3SN07	Prochlorococcus_phage	41.8	6.7e-66
WP_040118983.1|3593561_3595037_+	aminomethyl-transferring glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	41.3	2.2e-86
>prophage 303
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3621992	3624238	5229095		Enterococcus_phage(50.0%)	2	NA	NA
WP_003200229.1|3621992_3622853_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	41.2	6.6e-43
WP_006095945.1|3622879_3624238_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	35.0	8.3e-40
>prophage 304
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3634367	3636759	5229095		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_018780788.1|3634367_3635465_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.0	1.2e-105
WP_003200201.1|3635833_3635980_-	YycC family protein	NA	NA	NA	NA	NA
WP_006095952.1|3636030_3636759_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	25.2	4.8e-18
>prophage 305
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3642665	3644087	5229095		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003200196.1|3642665_3644087_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.8	2.0e-44
>prophage 306
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3649871	3654037	5229095		Paenibacillus_phage(50.0%)	6	NA	NA
WP_018766140.1|3649871_3650345_+	NUDIX domain-containing protein	NA	D0R7J3	Paenibacillus_phage	40.0	7.6e-25
WP_018780793.1|3650465_3650873_+	YjdF family protein	NA	NA	NA	NA	NA
WP_003208428.1|3651027_3651441_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_003200151.1|3651839_3652625_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003200153.1|3652662_3653322_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_018780794.1|3653314_3654037_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	7.5e-32
>prophage 307
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3658945	3660184	5229095		Caldibacillus_phage(100.0%)	1	NA	NA
WP_018780800.1|3658945_3660184_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	30.2	3.7e-18
>prophage 308
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3664945	3665785	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_006095917.1|3664945_3665785_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.0	7.7e-28
>prophage 309
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3671198	3673322	5229095		Klosneuvirus(50.0%)	2	NA	NA
WP_018766124.1|3671198_3672359_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.4	1.1e-29
WP_006095911.1|3672371_3673322_+	ornithine carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	28.5	2.4e-22
>prophage 310
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3680917	3684187	5229095		Klosneuvirus(50.0%)	3	NA	NA
WP_040118978.1|3680917_3682306_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	1.7e-19
WP_018780812.1|3682305_3683034_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_018780813.1|3682999_3684187_+	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	30.3	4.9e-44
>prophage 311
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3687971	3691410	5229095		Staphylococcus_phage(100.0%)	4	NA	NA
WP_016131961.1|3687971_3688433_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	64.0	3.4e-46
WP_018780816.1|3688465_3689659_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	52.8	1.8e-115
WP_018780817.1|3689671_3690316_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.1	3.7e-38
WP_018780818.1|3690297_3691410_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.4	5.3e-61
>prophage 312
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3702789	3705224	5229095		Leuconostoc_phage(33.33%)	3	NA	NA
WP_018780826.1|3702789_3703293_+	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.9	4.1e-45
WP_003208340.1|3703452_3704280_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	46.9	4.4e-68
WP_018780827.1|3704309_3705224_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	34.1	4.0e-06
>prophage 313
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3708271	3713828	5229095		Brevibacillus_phage(33.33%)	5	NA	NA
WP_003208345.1|3708271_3709162_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	34.0	3.4e-42
WP_040118977.1|3709390_3710131_+	FixH family protein	NA	NA	NA	NA	NA
WP_018766097.1|3710496_3711681_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_003208346.1|3711694_3712516_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	47.7	5.5e-71
WP_018766096.1|3712523_3713828_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	59.1	3.5e-136
>prophage 314
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3720387	3724749	5229095		Staphylococcus_phage(50.0%)	6	NA	NA
WP_018766092.1|3720387_3721269_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.3	1.1e-19
WP_018766091.1|3721234_3721654_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_018766090.1|3721819_3723013_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_016116162.1|3723186_3723537_+	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_003200026.1|3723537_3723978_+	anti-sigma F factor	NA	NA	NA	NA	NA
WP_003200028.1|3723990_3724749_+	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	58.5	8.9e-68
>prophage 315
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3732246	3737189	5229095		uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_003208377.1|3732246_3732684_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.8	1.2e-16
WP_006095861.1|3733269_3733635_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003199975.1|3733655_3734174_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_018766085.1|3734420_3734516_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003199977.1|3734685_3735423_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	26.5	4.9e-10
WP_040118974.1|3735636_3736212_+	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.4	9.3e-17
WP_018766083.1|3736286_3737189_+	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	36.3	9.4e-40
>prophage 316
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3750123	3751254	5229095		Mycobacterium_phage(100.0%)	1	NA	NA
WP_040118973.1|3750123_3751254_+	serine hydrolase	NA	G1DB24	Mycobacterium_phage	26.6	3.1e-16
>prophage 317
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3764639	3765089	5229095		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003208272.1|3764639_3765089_+	NUDIX hydrolase	NA	D0R7J3	Paenibacillus_phage	48.6	4.7e-32
>prophage 318
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3771451	3772552	5229095		Planktothrix_phage(100.0%)	1	NA	NA
WP_018780863.1|3771451_3772552_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.3	6.3e-22
>prophage 319
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3780901	3781336	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_029426887.1|3780901_3781336_+	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	63.6	5.2e-36
>prophage 320
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3797184	3800369	5229095		Chrysochromulina_ericina_virus(50.0%)	4	NA	NA
WP_003199919.1|3797184_3797949_+	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	39.4	5.2e-39
WP_003199920.1|3798213_3799431_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003199921.1|3799613_3800114_+	DUF3993 domain-containing protein	NA	NA	NA	NA	NA
WP_018780875.1|3800126_3800369_-	glutaredoxin family protein	NA	A0A1D6X8E8	Bacillus_phage	39.3	9.0e-06
>prophage 321
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3806746	3807205	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_003208302.1|3806746_3807205_+	TlpA family protein disulfide reductase	NA	A0A127AW88	Bacillus_phage	48.3	2.3e-34
>prophage 322
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3811709	3813105	5229095		Lactococcus_phage(50.0%)	2	NA	NA
WP_018780878.1|3811709_3812483_+	Cof-type HAD-IIB family hydrolase	NA	Q0GXW5	Lactococcus_phage	22.8	8.4e-05
WP_003199945.1|3812550_3813105_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.4	9.0e-17
>prophage 323
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3817440	3821826	5229095		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_003208305.1|3817440_3818853_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	9.5e-47
WP_018780879.1|3819200_3820418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118965.1|3820431_3821826_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	39.2	4.6e-70
>prophage 324
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3832644	3834706	5229095		Bacillus_phage(100.0%)	2	NA	NA
WP_003199697.1|3832644_3833100_+	hypothetical protein	NA	A0A127AW69	Bacillus_phage	32.2	1.4e-20
WP_018780887.1|3833377_3834706_+	PhoH family protein	NA	A0A141HS37	Bacillus_phage	41.0	7.5e-78
>prophage 325
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3844480	3849941	5229095		Flavobacterium_phage(50.0%)	6	NA	NA
WP_003199714.1|3844480_3846343_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	33.0	3.9e-08
WP_003199716.1|3846342_3846966_+	cytochrome c oxidase subunit III	NA	NA	NA	NA	NA
WP_003199718.1|3846969_3847308_+	cytochrome c oxidase subunit IVB	NA	NA	NA	NA	NA
WP_006095795.1|3847394_3848300_+	cytochrome c oxidase assembly factor CtaG	NA	NA	NA	NA	NA
WP_003199722.1|3848332_3848698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016116055.1|3848903_3849941_+	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	36.4	4.1e-15
>prophage 326
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3854767	3857389	5229095		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_018764765.1|3854767_3855259_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.9	8.5e-27
WP_018780892.1|3855250_3856483_-	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
WP_018780893.1|3856597_3857389_+	esterase	NA	A0A1V0SCG0	Catovirus	31.4	3.6e-11
>prophage 327
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3860692	3861214	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_006095784.1|3860692_3861214_+	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	49.3	1.1e-11
>prophage 328
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3883135	3884829	5229095		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_003199790.1|3883135_3883855_+	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	4.3e-19
WP_003199794.1|3884049_3884829_+	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	44.3	8.9e-47
>prophage 329
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3889354	3899776	5229095	tRNA	Tupanvirus(25.0%)	9	NA	NA
WP_040118959.1|3889354_3892120_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	27.5	2.6e-88
WP_018764751.1|3892346_3892676_+	molecular chaperone DnaK	NA	NA	NA	NA	NA
WP_018764750.1|3892799_3893258_+	lipoprotein signal peptidase LspA	NA	NA	NA	NA	NA
WP_003199814.1|3893262_3894171_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_001156487.1|3894375_3894918_+	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003199817.1|3895065_3896349_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	39.2	8.3e-66
WP_018764748.1|3896497_3897412_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	33.2	3.4e-29
WP_018764747.1|3897395_3898682_+	dihydroorotase	NA	NA	NA	NA	NA
WP_018780905.1|3898678_3899776_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.3	6.4e-59
>prophage 330
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3905378	3906011	5229095		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_016116008.1|3905378_3906011_+	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	33.1	2.3e-08
>prophage 331
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3910063	3911479	5229095		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_018780910.1|3910063_3911479_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	34.1	4.1e-05
>prophage 332
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3917950	3928077	5229095	tRNA	Paramecium_bursaria_Chlorella_virus(20.0%)	9	NA	NA
WP_018780917.1|3917950_3920671_+	calcium-translocating P-type ATPase, SERCA-type	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	31.3	6.2e-87
WP_003208193.1|3920770_3921646_+	YicC family protein	NA	NA	NA	NA	NA
WP_001251459.1|3921713_3921977_+	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_003199649.1|3921990_3922608_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.7	1.9e-23
WP_018780918.1|3922609_3922822_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003199652.1|3923020_3924226_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	9.9e-45
WP_040118958.1|3924222_3926628_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_003199655.1|3926639_3927116_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	45.3	2.6e-17
WP_040118957.1|3927132_3928077_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.0	4.0e-09
>prophage 333
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3931266	3933237	5229095		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_018780921.1|3931266_3933237_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	31.0	3.0e-22
>prophage 334
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3943750	3945593	5229095		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_016115974.1|3943750_3944491_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.7	1.1e-22
WP_000786062.1|3944562_3944796_+	acyl carrier protein	NA	M4M9G2	Vibrio_phage	43.7	7.1e-08
WP_018780924.1|3944855_3945593_+	ribonuclease III	NA	J2YAN1	Acanthamoeba_polyphaga_lentillevirus	33.9	2.0e-27
>prophage 335
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3956368	3957142	5229095		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_018780927.1|3956368_3957142_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.9	5.8e-30
>prophage 336
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	3960522	4022386	5229095	tail,protease,plate,terminase,bacteriocin,integrase,tRNA	Bacillus_phage(60.61%)	65	4007232:4007248	4009150:4009166
WP_018780929.1|3960522_3962601_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	38.0	4.6e-106
WP_006095738.1|3962652_3963957_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_016133222.1|3964022_3964922_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	30.8	4.5e-34
WP_003199482.1|3964964_3965507_+|protease	ATP-dependent protease proteolytic subunit HslV	protease	NA	NA	NA	NA
WP_003199484.1|3965529_3966921_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.9	2.7e-46
WP_000421292.1|3966998_3967778_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_018764712.1|3968138_3968840_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_018764711.1|3968942_3969830_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003199491.1|3969896_3970619_+	UMP kinase	NA	NA	NA	NA	NA
WP_018780930.1|3970621_3971179_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_006095735.1|3971264_3972041_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.8	6.9e-23
WP_018764710.1|3972058_3972850_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003199500.1|3972870_3974013_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_018764708.1|3974030_3975287_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003208159.1|3975439_3977140_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_018780931.1|3977265_3981567_+	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	39.0	3.5e-23
WP_018764706.1|3981901_3982372_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003199512.1|3982389_3983490_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_017151265.1|3983501_3983774_+	YlxR family protein	NA	NA	NA	NA	NA
WP_006095729.1|3983774_3984086_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_018780932.1|3984090_3986157_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.1	2.2e-20
WP_018764704.1|3986153_3986435_+	DUF503 family protein	NA	NA	NA	NA	NA
WP_018764703.1|3986450_3986807_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_018764702.1|3987027_3987951_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_018764701.1|3987994_3988966_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	33.0	4.7e-05
WP_001229392.1|3989066_3989336_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_040118953.1|3989496_3991680_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_018764700.1|3991842_3992742_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_018780934.1|3992828_3994067_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.0	3.4e-56
WP_029426914.1|3994264_3994516_+	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_018780935.1|3994926_3995829_+	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_040118952.1|3996283_3997831_-	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	53.8	9.2e-144
WP_040118951.1|3998187_3998910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118950.1|3998933_3999374_-	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	78.2	8.9e-60
WP_040118949.1|3999390_3999825_-	helix-turn-helix domain-containing protein	NA	A0A2P1JU09	Anoxybacillus_phage	53.1	7.0e-33
WP_040118948.1|3999980_4000169_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	54.2	1.9e-11
WP_040118947.1|4000221_4000470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118946.1|4000558_4001146_+	helix-turn-helix transcriptional regulator	NA	D2XR41	Bacillus_phage	71.5	2.0e-75
WP_040118945.1|4001159_4001381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118944.1|4001567_4001852_+	hypothetical protein	NA	D2XR42	Bacillus_phage	55.3	1.6e-22
WP_018780947.1|4002132_4003059_+	DnaD domain protein	NA	D2XR43	Bacillus_phage	85.5	1.4e-139
WP_018780948.1|4003055_4004378_+	replicative DNA helicase	NA	D2XR44	Bacillus_phage	84.3	1.4e-209
WP_003199559.1|4004377_4004566_+	hypothetical protein	NA	D2XR45	Bacillus_phage	81.1	1.7e-12
WP_018780949.1|4004540_4004903_+	hypothetical protein	NA	D2XR47	Bacillus_phage	77.5	3.7e-48
WP_003199563.1|4004979_4005171_+	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	92.1	1.1e-25
WP_003208136.1|4005223_4005697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003208133.1|4005854_4006049_-	hypothetical protein	NA	NA	NA	NA	NA
4007232:4007248	attL	TAATAATAGAAATTAAA	NA	NA	NA	NA
WP_003199569.1|4007373_4007844_+	ArpU family transcriptional regulator	NA	D2XR57	Bacillus_phage	85.3	7.7e-70
WP_018780951.1|4007840_4008383_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	92.2	2.0e-90
WP_018780952.1|4008745_4009048_-	WGxxGxxG-CTERM domain-containing protein	NA	NA	NA	NA	NA
WP_018780953.1|4009393_4009909_+	DUF3231 family protein	NA	NA	NA	NA	NA
4009150:4009166	attR	TTTAATTTCTATTATTA	NA	NA	NA	NA
WP_003199580.1|4010543_4010735_+	hypothetical protein	NA	A0A0Y0AUI4	Bacillus_phage	58.1	5.2e-17
WP_018780954.1|4010943_4011186_+	hypothetical protein	NA	A0A1B1P743	Bacillus_phage	65.0	3.4e-21
WP_003199584.1|4011299_4011494_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	90.6	7.9e-29
WP_018780956.1|4011496_4011811_+	hypothetical protein	NA	A0A1B1P767	Bacillus_phage	88.5	9.8e-45
WP_018782703.1|4012000_4012522_+	DNA-directed RNA polymerase sigma-70 factor	NA	E2ELI1	Clostridium_phage	48.8	3.5e-31
WP_123767182.1|4012553_4014158_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	73.3	1.4e-232
WP_018782701.1|4014386_4014842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080740052.1|4016401_4017367_+|tail	tail fiber domain-containing protein	tail	A0A1B1P770	Bacillus_phage	56.7	1.1e-94
WP_018782698.1|4017363_4018758_+|plate	BppU family phage baseplate upper protein	plate	A0A1C8E978	Bacillus_phage	51.0	9.1e-58
WP_003210100.1|4018901_4019126_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	91.9	2.9e-27
WP_018782294.1|4019279_4019768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018782293.1|4019812_4020073_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	46.0	5.9e-11
WP_006095702.1|4020074_4021133_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	83.1	1.3e-168
WP_003203698.1|4021291_4022386_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	53.8	1.0e-101
>prophage 337
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4030888	4042130	5229095		Mycobacterium_phage(25.0%)	8	NA	NA
WP_029427439.1|4030888_4033288_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.6e-89
WP_000114183.1|4033826_4034552_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003199386.1|4034640_4035717_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003199388.1|4035822_4037355_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	8.3e-12
WP_018764690.1|4037347_4038406_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003199393.1|4038406_4039366_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_018782286.1|4039568_4040843_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.3	5.9e-56
WP_003209671.1|4040843_4042130_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	27.7	9.1e-12
>prophage 338
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4047261	4048287	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_006095669.1|4047261_4048287_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	73.6	7.2e-137
>prophage 339
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4051413	4051674	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_000404341.1|4051413_4051674_+	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
>prophage 340
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4058793	4066807	5229095		Hokovirus(66.67%)	3	NA	NA
WP_018782279.1|4058793_4061466_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.2	2.1e-34
WP_018782278.1|4061474_4063406_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.7	6.2e-65
WP_040118943.1|4064191_4066807_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	33.8	1.1e-37
>prophage 341
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4072558	4077727	5229095	transposase	Streptococcus_phage(33.33%)	6	NA	NA
WP_003203100.1|4072558_4073953_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.0	7.7e-25
WP_018764670.1|4074259_4074361_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_018782272.1|4074645_4074909_-	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	44.3	2.4e-12
WP_018782271.1|4075103_4075829_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_033794526.1|4077033_4077558_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080548478.1|4077523_4077727_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.6	6.4e-13
>prophage 342
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4088172	4093222	5229095		Mycobacterium_phage(50.0%)	3	NA	NA
WP_040118940.1|4088172_4089336_+	serine hydrolase	NA	A0A2P0ZZM8	Mycobacterium_phage	27.7	2.4e-19
WP_042511472.1|4090499_4091534_+	bis-aminopropyl spermidine synthase family protein	NA	NA	NA	NA	NA
WP_018782257.1|4091554_4093222_+	carbamoyltransferase	NA	A0A1B1IVF2	uncultured_Mediterranean_phage	30.9	4.4e-51
>prophage 343
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4096364	4103484	5229095		Bacillus_phage(33.33%)	8	NA	NA
WP_018767830.1|4096364_4097363_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	7.3e-17
WP_018782253.1|4097359_4098151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006097707.1|4098153_4098942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003203747.1|4098954_4099620_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	56.0	2.8e-65
WP_006097709.1|4099619_4100111_+	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	71.1	4.0e-61
WP_018767833.1|4100103_4100820_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.3	2.0e-53
WP_006097712.1|4100863_4101451_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	48.4	1.1e-44
WP_006097713.1|4103184_4103484_+	hypothetical protein	NA	A0A1B1P853	Bacillus_phage	74.5	9.4e-13
>prophage 344
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4111224	4111842	5229095	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_018782246.1|4111224_4111842_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	66.7	1.5e-65
>prophage 345
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4116449	4117646	5229095		Lambdina_fiscellaria_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_033799547.1|4116449_4117646_+	glycosyl transferase	NA	A0A0E3URP0	Lambdina_fiscellaria_nucleopolyhedrovirus	33.0	1.1e-14
>prophage 346
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4125247	4126009	5229095		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_006097328.1|4125247_4126009_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.0	1.2e-16
>prophage 347
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4129831	4132946	5229095		Bacillus_phage(66.67%)	3	NA	NA
WP_040118938.1|4129831_4130554_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	3.2e-38
WP_040118937.1|4130550_4131945_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.2	9.5e-23
WP_006097324.1|4132031_4132946_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	1.1e-43
>prophage 348
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4141505	4144936	5229095		Planktothrix_phage(50.0%)	3	NA	NA
WP_040118935.1|4141505_4142219_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	6.9e-38
WP_018782222.1|4142218_4143283_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_018782221.1|4143523_4144936_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	44.7	4.9e-59
>prophage 349
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4166299	4169080	5229095		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_040118930.1|4166299_4167118_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.5	1.8e-13
WP_018765219.1|4167143_4167965_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003199315.1|4168172_4168478_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_003199316.1|4168807_4169080_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	75.6	1.6e-27
>prophage 350
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4179446	4180349	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_018783596.1|4179446_4180349_+	SH3 domain-containing protein	NA	A7KV71	Bacillus_phage	73.5	1.7e-36
>prophage 351
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4185888	4186845	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_018765230.1|4185888_4186845_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	42.5	1.2e-53
>prophage 352
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4192504	4202281	5229095		uncultured_Caudovirales_phage(66.67%)	15	NA	NA
WP_080740332.1|4192504_4192906_+	N-acetylmuramoyl-L-alanine amidase	NA	D3WK93	Bacillus_phage	76.9	5.1e-54
WP_040118926.1|4192952_4193159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003205215.1|4193179_4193683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033799034.1|4193721_4194333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003205210.1|4194370_4195246_-	DUF3994 domain-containing protein	NA	NA	NA	NA	NA
WP_003205208.1|4195467_4196298_-	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	85.0	1.8e-122
WP_080740329.1|4196712_4197114_+	N-acetylmuramoyl-L-alanine amidase	NA	D3WK93	Bacillus_phage	74.6	3.1e-51
WP_003199277.1|4197167_4197413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155895706.1|4197452_4197746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003199272.1|4198169_4199258_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.6	1.6e-86
WP_029427132.1|4199257_4199518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003199269.1|4199577_4199880_-	hypothetical protein	NA	A0A2H4J846	uncultured_Caudovirales_phage	72.7	3.8e-30
WP_006095590.1|4199939_4200875_-	DUF3994 domain-containing protein	NA	NA	NA	NA	NA
WP_003199265.1|4200931_4201486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080740042.1|4201717_4202281_-	hypothetical protein	NA	A0A2H4J9W9	uncultured_Caudovirales_phage	70.1	7.9e-53
>prophage 353
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4208380	4209229	5229095		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003199253.1|4208380_4209229_+	DUF2935 domain-containing protein	NA	A0A167RKB4	Powai_lake_megavirus	26.8	2.3e-08
>prophage 354
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4213885	4214506	5229095		Phage_Wrath(100.0%)	1	NA	NA
WP_003199232.1|4213885_4214506_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	69.6	1.8e-18
>prophage 355
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4221576	4228672	5229095		Bacillus_phage(33.33%)	4	NA	NA
WP_018781454.1|4221576_4223328_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.8	9.7e-49
WP_003207987.1|4223327_4225091_+	ABC transporter ATP-binding protein	NA	A0A1V0SD74	Indivirus	22.7	3.7e-16
WP_018781456.1|4225556_4227164_+	lipase	NA	NA	NA	NA	NA
WP_040118923.1|4227628_4228672_+	chromosome segregation protein	NA	A0A1L2JY40	Aeribacillus_phage	26.0	1.2e-27
>prophage 356
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4237897	4238809	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003199178.1|4237897_4238809_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.7	9.5e-40
>prophage 357
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4248377	4249895	5229095		Catovirus(100.0%)	1	NA	NA
WP_018781471.1|4248377_4249895_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.6	2.9e-102
>prophage 358
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4262665	4263124	5229095		Clostridium_phage(100.0%)	1	NA	NA
WP_006095633.1|4262665_4263124_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7RTQ5	Clostridium_phage	37.7	2.2e-21
>prophage 359
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4275816	4277456	5229095		Streptomyces_phage(50.0%)	2	NA	NA
WP_018781485.1|4275816_4276392_+	redoxin domain-containing protein	NA	A0A1J0GW78	Streptomyces_phage	50.0	8.2e-05
WP_018781486.1|4276508_4277456_+	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	38.4	3.6e-50
>prophage 360
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4281466	4292829	5229095		Bacillus_virus(33.33%)	8	NA	NA
WP_018781487.1|4281466_4283323_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	45.3	5.3e-162
WP_018765335.1|4283319_4283772_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2R2ZH61	Clostridioides_phage	49.0	1.2e-35
WP_003199064.1|4283790_4284468_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	1.4e-40
WP_018781488.1|4284834_4286064_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_003199060.1|4286136_4286550_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_040118913.1|4286924_4288889_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.8	4.0e-128
WP_006095655.1|4288890_4291311_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	30.3	1.6e-97
WP_003199052.1|4291671_4292829_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	37.7	3.1e-27
>prophage 361
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4299982	4300876	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_018781495.1|4299982_4300876_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	1.3e-20
>prophage 362
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4341666	4341867	5229095		Lactococcus_phage(100.0%)	1	NA	NA
WP_003198964.1|4341666_4341867_+	cold shock-like protein CspB	NA	Q9AZD3	Lactococcus_phage	64.6	2.9e-18
>prophage 363
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4348703	4349360	5229095		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_006095543.1|4348703_4349360_+	PIG-L family deacetylase	NA	A0A2D2W2P2	Stenotrophomonas_phage	25.5	4.6e-12
>prophage 364
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4359563	4359779	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_018767404.1|4359563_4359779_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	63.9	3.8e-16
>prophage 365
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4384806	4385487	5229095		Planktothrix_phage(100.0%)	1	NA	NA
WP_040118904.1|4384806_4385487_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	1.1e-35
>prophage 366
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4389951	4393813	5229095		Microcystis_phage(50.0%)	3	NA	NA
WP_080740029.1|4389951_4391469_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.1	1.2e-47
WP_040118902.1|4391748_4391997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118901.1|4392685_4393813_+	serine hydrolase	NA	G1DB24	Mycobacterium_phage	29.6	3.1e-16
>prophage 367
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4410064	4412500	5229095		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_018781572.1|4410064_4411966_+	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	26.9	8.1e-17
WP_018781573.1|4411972_4412500_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	72.9	1.5e-66
>prophage 368
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4439008	4443403	5229095		Catovirus(50.0%)	4	NA	NA
WP_018781861.1|4439008_4439779_+	ABC transporter ATP-binding protein	NA	A0A1V0SBM3	Catovirus	22.5	3.8e-05
WP_040118888.1|4439753_4441691_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_018781859.1|4441751_4442099_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_018781858.1|4442293_4443403_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.6	9.2e-05
>prophage 369
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4457189	4459570	5229095		Salmonella_phage(50.0%)	3	NA	NA
WP_018781849.1|4457189_4458122_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	43.3	1.9e-56
WP_080740323.1|4458285_4458363_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_018781848.1|4458799_4459570_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	3.3e-33
>prophage 370
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4464836	4465604	5229095		Planktothrix_phage(100.0%)	1	NA	NA
WP_018781843.1|4464836_4465604_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.8	2.9e-34
>prophage 371
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4492717	4492996	5229095		Paenibacillus_phage(100.0%)	1	NA	NA
WP_006095231.1|4492717_4492996_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	63.3	8.7e-13
>prophage 372
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4497603	4499358	5229095		Klosneuvirus(50.0%)	2	NA	NA
WP_040118878.1|4497603_4498818_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.1e-30
WP_040118877.1|4498950_4499358_+	NUDIX hydrolase	NA	A0A1L6UW58	Biomphalaria_virus	39.0	4.4e-05
>prophage 373
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4504305	4506136	5229095		Bacillus_phage(50.0%)	3	NA	NA
WP_003198762.1|4504305_4504554_+	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	59.8	3.3e-19
WP_042511573.1|4504612_4504936_+	DUF4180 domain-containing protein	NA	NA	NA	NA	NA
WP_040118875.1|4505098_4506136_-	serine hydrolase	NA	A0A2P0ZZM8	Mycobacterium_phage	24.3	6.0e-06
>prophage 374
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4539146	4540019	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_026008611.1|4539146_4540019_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.8	1.4e-32
>prophage 375
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4552334	4553060	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_017151715.1|4552334_4553060_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.7	1.5e-11
>prophage 376
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4558436	4559753	5229095	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_040118870.1|4558436_4559753_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	30.6	3.3e-41
>prophage 377
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4566075	4567731	5229095		Bacillus_virus(100.0%)	1	NA	NA
WP_018781756.1|4566075_4567731_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.8	2.6e-19
>prophage 378
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4583585	4585931	5229095	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_157753619.1|4583585_4583765_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	55.9	3.8e-09
WP_095995509.1|4584269_4584896_+	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_033797470.1|4584905_4585931_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	33.0	4.1e-39
>prophage 379
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4600796	4601822	5229095		Serratia_phage(100.0%)	1	NA	NA
WP_018781701.1|4600796_4601822_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	32.6	4.5e-38
>prophage 380
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4621265	4629662	5229095		Bacillus_phage(40.0%)	9	NA	NA
WP_040118862.1|4621265_4622372_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	45.5	3.4e-68
WP_018783375.1|4622347_4623982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018766753.1|4623956_4624235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783376.1|4625022_4626492_+	TROVE domain-containing protein	NA	K4JRQ9	Caulobacter_phage	30.6	9.6e-42
WP_018783377.1|4626805_4627150_+	DUF2185 domain-containing protein	NA	NA	NA	NA	NA
WP_018783378.1|4627428_4628301_+	DnaD domain protein	NA	A6M985	Geobacillus_virus	38.5	1.0e-46
WP_018783379.1|4628297_4628486_+	hypothetical protein	NA	D2XR44	Bacillus_phage	37.3	1.6e-05
WP_018783380.1|4628556_4629024_+	DUF2004 domain-containing protein	NA	NA	NA	NA	NA
WP_080739998.1|4629143_4629662_+	hypothetical protein	NA	A0A1P8CWU7	Bacillus_phage	49.6	7.3e-29
>prophage 381
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4635835	4636192	5229095		Leptospira_phage(100.0%)	1	NA	NA
WP_018783391.1|4635835_4636192_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.4	2.3e-18
>prophage 382
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4640174	4640719	5229095	transposase	Paenibacillus_phage(100.0%)	2	NA	NA
WP_148311842.1|4640174_4640387_-|transposase	transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	54.0	9.3e-07
WP_018783314.1|4640428_4640719_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	65.9	5.2e-24
>prophage 383
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4645919	4649542	5229095		Bacillus_phage(50.0%)	6	NA	NA
WP_018783309.1|4645919_4646408_+	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	65.8	2.1e-62
WP_018783308.1|4646645_4647002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118860.1|4647110_4647467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783306.1|4647501_4648053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018766792.1|4648084_4648462_+	immunity 22 family protein	NA	NA	NA	NA	NA
WP_006095418.1|4648699_4649542_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	47.5	1.4e-58
>prophage 384
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4662841	4673966	5229095		Streptococcus_phage(28.57%)	10	NA	NA
WP_040118847.1|4662841_4663558_+	endonuclease V	NA	A0A2K9V7A2	Bandra_megavirus	28.3	1.0e-17
WP_040118846.1|4663791_4664736_+	ATP-binding protein	NA	R4TQL5	Phaeocystis_globosa_virus	35.4	6.6e-36
WP_040118845.1|4664761_4666501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016115354.1|4666708_4666900_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_033796254.1|4667107_4668190_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	52.2	1.0e-104
WP_006095438.1|4668202_4669375_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	51.2	7.8e-111
WP_006095439.1|4669388_4670636_+	DUF1015 domain-containing protein	NA	NA	NA	NA	NA
WP_018783281.1|4671001_4671682_+	formylglycine-generating enzyme family protein	NA	A0A075BUR2	Microcystis_phage	40.2	3.2e-32
WP_003198595.1|4671916_4672588_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	53.0	4.1e-64
WP_006095441.1|4672589_4673966_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	43.4	5.2e-58
>prophage 385
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4677598	4678354	5229095		Planktothrix_phage(100.0%)	1	NA	NA
WP_040118842.1|4677598_4678354_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	1.2e-27
>prophage 386
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4683800	4684472	5229095		Planktothrix_phage(100.0%)	1	NA	NA
WP_003198455.1|4683800_4684472_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	2.5e-37
>prophage 387
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4698613	4702188	5229095		Planktothrix_phage(50.0%)	4	NA	NA
WP_006095463.1|4698613_4699381_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.0	6.8e-31
WP_018783129.1|4699370_4700033_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_018783128.1|4700234_4700456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118836.1|4701039_4702188_-	SH3 domain-containing protein	NA	A0A075BS18	Microcystis_phage	43.0	3.7e-17
>prophage 388
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4719611	4722291	5229095		Mycobacterium_phage(100.0%)	2	NA	NA
WP_040118830.1|4719611_4720769_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.8	2.2e-25
WP_080739979.1|4721097_4722291_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	27.1	2.6e-21
>prophage 389
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4731269	4732007	5229095		Halovirus(100.0%)	1	NA	NA
WP_003198232.1|4731269_4732007_+	metallophosphoesterase family protein	NA	R4T9B5	Halovirus	26.4	2.8e-10
>prophage 390
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4749239	4750709	5229095		Mycobacterium_phage(100.0%)	1	NA	NA
WP_040118810.1|4749239_4750709_+	serine hydrolase	NA	G1DB24	Mycobacterium_phage	31.3	1.4e-11
>prophage 391
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4755016	4756990	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_040118804.1|4755016_4756990_-	tetracycline resistance ribosomal protection protein	NA	A0A1B0RXH7	Streptococcus_phage	36.1	5.9e-111
>prophage 392
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4784488	4785982	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_018780719.1|4784488_4785982_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	7.3e-21
>prophage 393
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4792970	4793174	5229095		Brevibacillus_phage(100.0%)	1	NA	NA
WP_026008563.1|4792970_4793174_+	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	44.4	8.3e-05
>prophage 394
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4797139	4799492	5229095		Streptococcus_phage(50.0%)	4	NA	NA
WP_006095156.1|4797139_4797718_+	GNAT family N-acetyltransferase	NA	E4ZFP7	Streptococcus_phage	48.7	4.9e-26
WP_003198414.1|4797798_4798266_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_018780708.1|4798306_4798726_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_018780707.1|4798955_4799492_+	GNAT family N-acetyltransferase	NA	A0A0N9SKF6	Staphylococcus_phage	42.5	1.3e-36
>prophage 395
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4806029	4809694	5229095		Cafeteria_roenbergensis_virus(33.33%)	3	NA	NA
WP_003198427.1|4806029_4807106_+	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	28.7	3.1e-13
WP_003198429.1|4807404_4808577_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.2	6.9e-43
WP_018780703.1|4808593_4809694_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	27.3	3.6e-25
>prophage 396
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4813641	4818053	5229095		Tupanvirus(50.0%)	2	NA	NA
WP_006095166.1|4813641_4815267_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.8	1.3e-52
WP_033798945.1|4816088_4818053_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	46.6	9.6e-138
>prophage 397
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4829119	4829926	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_018780688.1|4829119_4829926_+	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	54.8	2.0e-81
>prophage 398
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4838100	4838976	5229095		Staphylococcus_phage(100.0%)	1	NA	NA
WP_018780683.1|4838100_4838976_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	8.6e-14
>prophage 399
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4851552	4852281	5229095		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_006095099.1|4851552_4852281_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.6	2.0e-24
>prophage 400
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4867404	4868253	5229095		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003198008.1|4867404_4868253_+	ribonuclease	NA	A0A2P0VMP9	Tetraselmis_virus	36.5	9.5e-26
>prophage 401
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4877927	4879965	5229095		Bacillus_phage(100.0%)	2	NA	NA
WP_006095078.1|4877927_4878575_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.4	3.5e-36
WP_018780653.1|4878567_4879965_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.0	8.3e-19
>prophage 402
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4888550	4891888	5229095		Clostridium_phage(50.0%)	3	NA	NA
WP_006095070.1|4888550_4889552_+	C40 family peptidase	NA	X5JAJ3	Clostridium_phage	45.2	1.3e-18
WP_018780647.1|4889591_4891214_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_040119603.1|4891363_4891888_+	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	26.4	6.5e-09
>prophage 403
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4909867	4910674	5229095		Mycobacterium_phage(100.0%)	1	NA	NA
WP_040119602.1|4909867_4910674_-	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	23.1	1.9e-12
>prophage 404
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4916576	4923364	5229095		Acanthamoeba_polyphaga_mimivirus(50.0%)	5	NA	NA
WP_040119597.1|4916576_4918694_+	DNA helicase RecQ	NA	A0A0G2Y2Q7	Acanthamoeba_polyphaga_mimivirus	37.4	8.9e-81
WP_018780628.1|4918717_4919095_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_003197969.1|4919562_4919850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018780627.1|4919942_4920929_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_018780626.1|4921267_4923364_+	AAA family ATPase	NA	A0A2H4UW05	Bodo_saltans_virus	24.6	2.1e-10
>prophage 405
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4937791	4939795	5229095		Mycobacterium_phage(100.0%)	1	NA	NA
WP_018780617.1|4937791_4939795_+	serine hydrolase	NA	S5Z991	Mycobacterium_phage	24.1	1.5e-05
>prophage 406
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4953764	4958887	5229095		Bacillus_phage(33.33%)	7	NA	NA
WP_006095034.1|4953764_4954028_+	hypothetical protein	NA	A0A1B1P7N4	Bacillus_phage	81.7	5.9e-35
WP_040119594.1|4954134_4954800_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_006095036.1|4954812_4955133_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_040119593.1|4955278_4955977_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_018780603.1|4955998_4956580_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	51.0	1.8e-47
WP_018780602.1|4956633_4957491_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003204603.1|4957681_4958887_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	35.6	6.5e-28
>prophage 407
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4972944	4973700	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_003204560.1|4972944_4973700_+	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	43.5	6.7e-23
>prophage 408
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4983026	4983665	5229095		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003204528.1|4983026_4983665_-	class I SAM-dependent methyltransferase	NA	A0A0N7G7M8	Chrysochromulina_ericina_virus	32.3	2.8e-06
>prophage 409
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	4987106	4989707	5229095		Bacillus_phage(50.0%)	3	NA	NA
WP_018780577.1|4987106_4987814_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.5	1.1e-22
WP_018780576.1|4987810_4988794_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_018780575.1|4988936_4989707_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	28.9	3.6e-08
>prophage 410
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5007416	5008055	5229095		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_018780559.1|5007416_5008055_+	Vat family streptogramin A O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	42.5	2.1e-25
>prophage 411
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5015891	5017592	5229095		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_018780552.1|5015891_5017592_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.1	8.0e-16
>prophage 412
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5024847	5025522	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_003203539.1|5024847_5025522_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.7	1.1e-27
>prophage 413
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5036722	5038694	5229095		Staphylococcus_phage(50.0%)	2	NA	NA
WP_040119583.1|5036722_5037628_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.8	9.8e-37
WP_018765965.1|5037839_5038694_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	26.2	2.0e-07
>prophage 414
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5055614	5055992	5229095		Microbacterium_phage(100.0%)	1	NA	NA
WP_003197904.1|5055614_5055992_+	PH domain-containing protein	NA	A6N235	Microbacterium_phage	37.2	1.5e-10
>prophage 415
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5068649	5075910	5229095		Streptococcus_phage(66.67%)	9	NA	NA
WP_018780510.1|5068649_5070116_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.6	1.6e-25
WP_006094925.1|5070116_5070614_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_018780508.1|5070899_5071454_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_080740374.1|5071826_5072279_-	CHRD domain-containing protein	NA	NA	NA	NA	NA
WP_017149453.1|5072599_5072815_+	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	86.8	6.9e-26
WP_006094922.1|5072841_5073078_-	DUF3947 family protein	NA	NA	NA	NA	NA
WP_018780505.1|5073287_5074166_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_018780504.1|5074178_5074526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018780503.1|5074536_5075910_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	41.1	7.0e-71
>prophage 416
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5080531	5081110	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_018780499.1|5080531_5081110_-	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	26.4	8.2e-05
>prophage 417
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5084981	5088429	5229095		Bacillus_phage(66.67%)	3	NA	NA
WP_029426830.1|5084981_5085674_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.0	3.5e-42
WP_018780494.1|5085663_5086821_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.7	8.7e-30
WP_018780493.1|5087418_5088429_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.6	1.5e-17
>prophage 418
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5092944	5098182	5229095		Staphylococcus_phage(50.0%)	4	NA	NA
WP_018780489.1|5092944_5094885_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	34.4	9.6e-66
WP_018780488.1|5094933_5096475_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
WP_018780487.1|5096477_5097266_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_006094897.1|5097270_5098182_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	35.7	6.2e-39
>prophage 419
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5105331	5110741	5229095	bacteriocin	Bacillus_phage(50.0%)	6	NA	NA
WP_018780480.1|5105331_5106186_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	22.1	2.4e-05
WP_080740296.1|5106661_5106898_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1C8E996	Bacillus_phage	88.3	6.7e-30
WP_006094839.1|5106962_5107187_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	75.7	2.4e-21
WP_006094842.1|5108314_5108974_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_018780475.1|5108999_5110019_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_018780474.1|5110015_5110741_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.2	9.2e-30
>prophage 420
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5120778	5122089	5229095		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_029426828.1|5120778_5122089_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.1	2.8e-61
>prophage 421
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5130851	5135418	5229095		Streptococcus_phage(100.0%)	3	NA	NA
WP_018767037.1|5130851_5132099_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.2	1.4e-105
WP_006094865.1|5132338_5133442_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.2	2.5e-71
WP_026008671.1|5134599_5135418_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.2	5.0e-32
>prophage 422
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5148045	5156537	5229095		Bacillus_phage(50.0%)	6	NA	NA
WP_018780453.1|5148045_5149842_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	5.4e-55
WP_040119578.1|5149834_5151589_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	3.2e-44
WP_018780451.1|5152034_5152919_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006094878.1|5153433_5154954_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	38.0	6.8e-83
WP_018780450.1|5154940_5155555_+	cyclase family protein	NA	NA	NA	NA	NA
WP_018780449.1|5155634_5156537_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	36.8	5.9e-58
>prophage 423
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5163601	5167316	5229095		Lactococcus_phage(50.0%)	5	NA	NA
WP_003203959.1|5163601_5163805_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	8.6e-18
WP_000286203.1|5163892_5164078_+	cold-shock protein	NA	NA	NA	NA	NA
WP_040119571.1|5164162_5164717_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_040119570.1|5165269_5165830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040119569.1|5165915_5167316_-	protoporphyrinogen oxidase	NA	R4THQ7	Phaeocystis_globosa_virus	32.9	4.0e-05
>prophage 424
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5173937	5175206	5229095		Streptococcus_phage(100.0%)	1	NA	NA
WP_040119566.1|5173937_5175206_-	MFS transporter	NA	A0A1B0RXA6	Streptococcus_phage	26.9	1.9e-14
>prophage 425
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5191739	5193183	5229095		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_018780427.1|5191739_5192255_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	59.3	2.0e-47
WP_018780426.1|5192988_5193183_-	hypothetical protein	NA	B0YL92	Streptococcus_virus	45.3	1.1e-06
>prophage 426
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5198353	5200327	5229095	transposase	Leptospira_phage(100.0%)	2	NA	NA
WP_018780416.1|5198353_5198710_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.4	8.0e-19
WP_029426824.1|5198749_5200327_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	9.9e-69
>prophage 427
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5209594	5212836	5229095	tRNA	Planktothrix_phage(50.0%)	2	NA	NA
WP_029426823.1|5209594_5210362_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	2.5e-33
WP_018780403.1|5210910_5212836_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	42.1	1.2e-145
>prophage 428
NZ_CP009651	Bacillus pseudomycoides strain BTZ chromosome, complete genome	5229095	5221991	5222264	5229095		Bacillus_phage(100.0%)	1	NA	NA
WP_018767205.1|5221991_5222264_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	75.6	2.5e-28
>prophage 1
NZ_CP009650	Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence	273588	8241	61165	273588	transposase,integrase	Streptococcus_phage(25.0%)	34	48311:48335	61926:61950
WP_018783227.1|8241_9267_-|transposase	IS1595-like element ISBth19 family transposase	transposase	NA	NA	NA	NA
WP_018783226.1|9766_11431_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_018767543.1|12172_12817_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_018783224.1|13592_14267_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_018783223.1|15145_16579_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_018783222.1|16872_17070_+	helix-turn-helix transcriptional regulator	NA	A0A142LP09	Marinitoga_camini_virus	39.7	1.6e-05
WP_002107182.1|17074_17413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783220.1|18599_19100_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_018783218.1|20907_21564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042511171.1|22690_23572_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.4	5.6e-45
WP_018783181.1|26554_27340_-	3-hydroxybutyryl-CoA dehydratase	NA	NA	NA	NA	NA
WP_018783183.1|28868_29093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783184.1|29661_30369_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	44.4	1.4e-43
WP_018783185.1|30496_31441_-	response regulator	NA	NA	NA	NA	NA
WP_018783186.1|31445_32762_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_040118762.1|33000_33987_-	glutaminase	NA	NA	NA	NA	NA
WP_018783188.1|34522_35953_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_018783189.1|36579_36762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123767142.1|37067_37742_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	64.6	2.6e-66
WP_018783191.1|38872_40102_+	serine hydrolase	NA	NA	NA	NA	NA
WP_040118761.1|40509_40815_-	monooxygenase	NA	NA	NA	NA	NA
WP_018783195.1|42267_43500_+	5-aminolevulinate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	30.5	1.1e-38
WP_018783196.1|43496_44408_+	DMT family transporter	NA	NA	NA	NA	NA
WP_040118760.1|44779_45439_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_080739956.1|46204_47362_-	acyltransferase	NA	NA	NA	NA	NA
48311:48335	attL	CTTGTTTGAATTGTTTTCCTTTAAA	NA	NA	NA	NA
WP_029427806.1|48421_49360_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	44.2	2.0e-56
WP_018783202.1|50072_51119_-	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	28.2	4.5e-09
WP_040118759.1|51096_52044_-	inorganic polyphosphate kinase	NA	NA	NA	NA	NA
WP_040118758.1|52040_53315_-	aspartate aminotransferase family protein	NA	B5LJF5	Mycobacterium_phage	25.2	7.1e-09
WP_040118757.1|53696_54905_+	MFS transporter	NA	NA	NA	NA	NA
WP_040118756.1|55755_57141_+	chitosanase	NA	NA	NA	NA	NA
WP_040118755.1|57340_58324_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_040118790.1|58678_59839_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_018783211.1|60286_61165_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
61926:61950	attR	CTTGTTTGAATTGTTTTCCTTTAAA	NA	NA	NA	NA
>prophage 2
NZ_CP009650	Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence	273588	95935	164735	273588	transposase,protease	Escherichia_phage(20.0%)	53	NA	NA
WP_018783353.1|95935_97372_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_018783354.1|97533_98523_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_018783355.1|98978_99611_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_080739953.1|100584_100755_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_018783356.1|100881_101772_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	25.4	8.2e-20
WP_018783357.1|102340_103114_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	3.9e-34
WP_018783358.1|103118_104975_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_018783359.1|105074_105440_+	YxeA family protein	NA	NA	NA	NA	NA
WP_051091469.1|105960_106272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783361.1|106368_107028_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_018783362.1|107127_107748_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	32.1	4.5e-09
WP_018783364.1|108826_109330_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_040118748.1|110173_111712_-	alveolysin	NA	NA	NA	NA	NA
WP_018783518.1|113681_114227_-	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_029427931.1|116750_116987_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_018783523.1|116979_117306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033799504.1|118301_118598_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006097496.1|118606_119488_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.7	5.0e-46
WP_040118787.1|119527_119725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783525.1|119887_120322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783526.1|120578_121127_-	VanZ family protein	NA	NA	NA	NA	NA
WP_016114392.1|121733_122105_-	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_018783527.1|122139_122595_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_018783528.1|122746_124276_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_018783529.1|124589_125771_-	DUF3533 domain-containing protein	NA	NA	NA	NA	NA
WP_018783531.1|126181_127621_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_018783532.1|127717_130933_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	35.9	1.1e-77
WP_018783533.1|131133_131748_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_018767729.1|134118_135357_-	cytochrome P450	NA	A0A2I2L481	Orpheovirus	27.8	1.2e-05
WP_018783396.1|135857_136652_-	nucleoside triphosphate hydrolase	NA	NA	NA	NA	NA
WP_018783398.1|137253_137706_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_018783399.1|138127_139558_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_018783400.1|139702_140080_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	39.5	2.4e-13
WP_123767141.1|140523_141825_-	teichoic acid transporter	NA	NA	NA	NA	NA
WP_123767138.1|142028_142496_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	39.8	3.5e-06
WP_018783404.1|142633_143803_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.3	1.8e-22
WP_001120967.1|144525_144858_+	DUF1904 family protein	NA	NA	NA	NA	NA
WP_018783405.1|144994_146389_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_123767137.1|147149_148028_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_018783407.1|148081_148711_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_018783408.1|148905_149835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018783410.1|150729_151584_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003202922.1|151982_152258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003202925.1|152325_152559_-	YuzF family protein	NA	NA	NA	NA	NA
WP_018767989.1|152798_153032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000738547.1|153330_153477_-	BC1881 family protein	NA	NA	NA	NA	NA
WP_018783411.1|154024_154486_-	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_029427896.1|155304_156186_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.5	3.5e-47
WP_018783414.1|158064_158568_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_018783416.1|160321_160930_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040118747.1|160922_162179_+	MFS transporter	NA	NA	NA	NA	NA
WP_123767136.1|162509_163073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783630.1|163817_164735_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP009650	Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence	273588	169966	214905	273588	integrase,holin,transposase	Bacillus_phage(62.5%)	57	187213:187231	191538:191556
WP_018783634.1|169966_170323_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_018783635.1|170524_170665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783636.1|170738_171677_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_018783637.1|171746_172613_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	47.5	3.5e-36
WP_018783638.1|173073_173664_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.4	1.7e-29
WP_158318669.1|173579_173780_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_029427994.1|173944_174268_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_018783657.1|174995_176024_-	spore photoproduct lyase	NA	NA	NA	NA	NA
WP_006096981.1|176020_176284_-	transcriptional regulator SplA	NA	NA	NA	NA	NA
WP_018783658.1|176830_176995_+	DUF4021 family protein	NA	NA	NA	NA	NA
WP_040118745.1|177104_179333_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_016113442.1|179456_180074_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006096976.1|180216_180390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006096975.1|180726_181092_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_018783661.1|182202_182403_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006097206.1|182392_182755_-	DUF3796 domain-containing protein	NA	NA	NA	NA	NA
WP_018783662.1|183064_183715_-	type 1 glutamine amidotransferase-like domain-containing protein	NA	NA	NA	NA	NA
WP_042511177.1|184203_184911_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	2.3e-41
WP_018783695.1|185284_185758_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_018783696.1|185790_186558_+	YqcI/YcgG family protein	NA	NA	NA	NA	NA
WP_018783697.1|186550_187189_+	LysE family transporter	NA	NA	NA	NA	NA
187213:187231	attL	CATGCCCATCAACTTAAGA	NA	NA	NA	NA
WP_040118744.1|187666_188239_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	40.8	1.8e-28
WP_000566919.1|188296_188689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783699.1|188700_188898_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_040118696.1|189142_189598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000956453.1|189597_189792_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040118742.1|189990_191427_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_018783716.1|191687_192068_+	hypothetical protein	NA	NA	NA	NA	NA
191538:191556	attR	TCTTAAGTTGATGGGCATG	NA	NA	NA	NA
WP_018783715.1|192357_192870_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_040118741.1|193437_194145_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.0e-41
WP_018783749.1|194410_194959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080739967.1|196576_196741_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_040118738.1|196996_197215_-	hypothetical protein	NA	A0A218KCJ1	Bacillus_phage	52.5	2.3e-13
WP_040118740.1|197242_198244_-	N-acetylmuramoyl-L-alanine amidase	NA	J9PQX3	Bacillus_phage	69.2	6.9e-92
WP_018783744.1|198243_198669_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	85.1	9.1e-62
WP_040118739.1|198718_199567_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	42.1	2.7e-28
WP_040118738.1|199708_199927_-	hypothetical protein	NA	A0A218KCJ1	Bacillus_phage	52.5	2.3e-13
WP_040118737.1|199954_200935_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	41.8	3.5e-32
WP_018767569.1|201174_201561_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	73.8	1.2e-49
WP_018783079.1|201869_202067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123767139.1|202078_202282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783081.1|202323_203130_-	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	63.7	4.9e-88
WP_018783082.1|203065_203914_-	replication protein	NA	A0A1W6JNM1	Staphylococcus_phage	43.2	1.4e-32
WP_018783083.1|204370_204568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783084.1|204569_204770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783085.1|205382_206156_-	phage repressor protein/antirepressor Ant	NA	A0A2H4PQV4	Staphylococcus_phage	52.9	4.0e-71
WP_006097390.1|206197_206419_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	55.6	2.4e-05
WP_018767556.1|206548_206899_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	47.3	3.8e-21
WP_018767554.1|207661_208009_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	42.6	2.7e-19
WP_040118736.1|208190_208898_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	40.8	2.5e-40
WP_018767625.1|209063_209507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029427756.1|211644_211890_-	damage repair protein	NA	A0A290FZQ6	Caldibacillus_phage	58.0	2.6e-13
WP_003209566.1|212351_212582_+	helix-turn-helix transcriptional regulator	NA	S5MBY6	Brevibacillus_phage	47.3	8.5e-14
WP_018783092.1|212587_213202_-	hypothetical protein	NA	H0USY2	Bacillus_phage	47.1	5.0e-45
WP_018783093.1|213140_214322_-	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	55.6	1.1e-123
WP_018783094.1|214421_214607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029427758.1|214608_214905_-	hypothetical protein	NA	H0USY0	Bacillus_phage	47.7	2.2e-14
>prophage 1
NZ_CP009649	Bacillus pseudomycoides strain BTZ plasmid pBTZ_2, complete sequence	140953	8316	76531	140953	integrase,transposase,tRNA	Bacillus_phage(38.46%)	54	58823:58845	74962:74984
WP_018783644.1|8316_9948_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_018783643.1|10438_11647_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_018783642.1|12638_13541_+	hypothetical protein	NA	Q0H278	Geobacillus_phage	36.5	5.6e-08
WP_018783641.1|13627_14290_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_040118725.1|14282_15290_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_018783440.1|17372_18299_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_040118724.1|18688_19801_-	helix-turn-helix domain-containing protein	NA	A0A286QQB7	Streptococcus_phage	45.5	8.8e-80
WP_018783437.1|19812_20211_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	6.8e-51
WP_078211999.1|20358_20799_+	TipAS antibiotic-recognition domain-containing protein	NA	NA	NA	NA	NA
WP_040118723.1|21050_21629_-	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_158319618.1|21695_21857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006096920.1|22056_23280_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_006096921.1|23300_23657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_018767649.1|25221_26043_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	44.6	3.1e-50
WP_006097652.1|26044_26332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118722.1|26603_26969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006097656.1|27691_28162_-	DinB family protein	NA	NA	NA	NA	NA
WP_018783434.1|29088_29580_+	DinB family protein	NA	NA	NA	NA	NA
WP_018783433.1|29937_30495_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_018783432.1|31324_33049_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040118721.1|34299_36000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051977352.1|36828_40629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123772618.1|40725_44013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051977350.1|45170_46052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080739944.1|46738_46906_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_040118719.1|47083_47488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118718.1|47977_48352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118717.1|48516_48813_+	phage protein	NA	H0USY0	Bacillus_phage	44.3	3.8e-14
WP_040118716.1|48814_49000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040118715.1|49100_50282_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	56.0	1.7e-121
WP_040118714.1|50220_50835_+	hypothetical protein	NA	H0USY2	Bacillus_phage	46.1	8.9e-42
WP_018783423.1|50835_51066_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	56.6	9.7e-18
WP_018783422.1|51535_51763_+	hypothetical protein	NA	A0A290FZQ6	Caldibacillus_phage	58.0	1.4e-13
WP_018783421.1|52450_52900_+	DNA gyrase inhibitor	NA	NA	NA	NA	NA
WP_040118713.1|53051_54017_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_040118712.1|54306_55014_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.8e-41
WP_040118711.1|55262_56435_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	27.9	1.9e-24
WP_003203261.1|57260_58169_-	VanZ family protein	NA	NA	NA	NA	NA
58823:58845	attL	TTGATGGGCATGTGGTGCTACCC	NA	NA	NA	NA
WP_003209727.1|59105_59993_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_018783620.1|60199_61183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783621.1|61538_62699_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_018783622.1|62932_63373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095995426.1|63382_64102_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_040118710.1|64157_64865_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.3	4.6e-42
WP_029427989.1|65622_66009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018783627.1|66292_66802_+	DUF4303 domain-containing protein	NA	NA	NA	NA	NA
WP_095995427.1|67744_69105_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	76.6	4.8e-112
WP_040118707.1|70617_71427_+	DUF2837 family protein	NA	NA	NA	NA	NA
WP_040118706.1|71525_71909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042511148.1|71910_73107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118704.1|73167_73557_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_042511150.1|73636_74032_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_003204763.1|74167_74464_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_042511152.1|75100_76531_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
74962:74984	attR	GGGTAGCACCACATGCCCATCAA	NA	NA	NA	NA
