The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009641	Bacillus cereus 03BB108 chromosome, complete genome	5342933	551560	560879	5342933		Bacillus_phage(71.43%)	9	NA	NA
WP_000755546.1|551560_552823_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
WP_001194301.1|552921_553686_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453763.1|553926_555687_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.9	4.4e-267
WP_000254054.1|555766_556453_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	93.9	1.3e-118
WP_001231497.1|556449_557523_+	membrane protein	NA	W8CYF6	Bacillus_phage	87.4	1.2e-169
WP_000823554.1|557547_558135_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|558331_559051_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000103838.1|559200_559872_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	86.9	6.5e-62
WP_001258513.1|560006_560879_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	46.6	2.7e-68
>prophage 2
NZ_CP009641	Bacillus cereus 03BB108 chromosome, complete genome	5342933	1337657	1344863	5342933		Geobacillus_phage(33.33%)	9	NA	NA
WP_001065246.1|1337657_1339025_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.1	9.6e-20
WP_000720567.1|1339462_1339981_-	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.3	9.5e-45
WP_001093444.1|1340190_1340577_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_000655496.1|1340642_1341350_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.0	1.0e-17
WP_000994639.1|1341371_1341725_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000288934.1|1341738_1342143_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000714659.1|1342390_1343776_+	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	59.9	7.8e-78
WP_000820167.1|1343778_1343991_+	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	54.4	7.3e-12
WP_000540634.1|1344056_1344863_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	69.7	6.5e-109
>prophage 3
NZ_CP009641	Bacillus cereus 03BB108 chromosome, complete genome	5342933	2909308	2975533	5342933	protease,tRNA,integrase,bacteriocin,coat	Bacillus_phage(40.0%)	56	2927754:2927773	2978469:2978488
WP_000125362.1|2909308_2910448_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	2.5e-82
WP_000354029.1|2910460_2911513_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000138162.1|2911532_2911733_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344460.1|2911729_2912731_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.2	1.2e-08
WP_000464508.1|2912736_2913354_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_000823597.1|2913542_2914487_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871185.1|2914499_2915030_-	BofC protein	NA	NA	NA	NA	NA
WP_001994754.1|2915150_2916080_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000426920.1|2916147_2916468_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000721239.1|2916913_2917348_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001093533.1|2917381_2918026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001994739.1|2918204_2920052_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_000025291.1|2920426_2921533_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092246.1|2921563_2922397_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_001138561.1|2922416_2923946_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000973794.1|2924098_2925238_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	28.9	7.7e-31
WP_000812272.1|2925240_2925783_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000510428.1|2925864_2926512_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621721.1|2926593_2927445_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_001026353.1|2927541_2929458_-	ABC transporter permease	NA	NA	NA	NA	NA
2927754:2927773	attL	ATACTTCTTCCTTCGTCATT	NA	NA	NA	NA
WP_001011372.1|2929507_2931430_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114531.1|2931404_2932181_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.2e-19
WP_000865391.1|2932274_2933357_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000276720.1|2933346_2934054_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000496111.1|2934193_2935480_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001037006.1|2935479_2936028_-	sporulation protein	NA	NA	NA	NA	NA
WP_000944957.1|2936091_2936382_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001973720.1|2936385_2936730_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|2936741_2937050_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000855457.1|2937219_2938608_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000599073.1|2938675_2939536_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000797461.1|2939528_2940275_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503310.1|2940408_2941206_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391517.1|2941208_2941895_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975753.1|2941930_2942476_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135493.1|2942490_2943342_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466737.1|2943383_2944403_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_000366809.1|2944837_2946259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907107.1|2946218_2949260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000913003.1|2949289_2951053_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001087615.1|2951039_2951792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000081956.1|2953348_2954716_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000051680.1|2954743_2956936_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	6.9e-44
WP_000849670.1|2957145_2957322_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_001089676.1|2957344_2957551_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_001212906.1|2958459_2959581_+	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_001994729.1|2959987_2961262_-	collagen-like protein	NA	NA	NA	NA	NA
WP_001994714.1|2962297_2962420_-	DNA repair protein	NA	NA	NA	NA	NA
WP_001994722.1|2963313_2965833_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_001994746.1|2966671_2968054_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_001994733.1|2968815_2970243_+	serine hydrolase	NA	NA	NA	NA	NA
WP_042516397.1|2970716_2971559_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001994712.1|2972070_2972607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001994717.1|2972737_2972983_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001994752.1|2973202_2973952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042516400.1|2974198_2975533_-|integrase	integrase	integrase	NA	NA	NA	NA
2978469:2978488	attR	ATACTTCTTCCTTCGTCATT	NA	NA	NA	NA
>prophage 4
NZ_CP009641	Bacillus cereus 03BB108 chromosome, complete genome	5342933	3593199	3647776	5342933	holin,transposase,integrase	Streptococcus_phage(30.0%)	46	3584895:3584911	3636591:3636607
3584895:3584911	attL	TATCGACTTACCGACAA	NA	NA	NA	NA
WP_000938795.1|3593199_3595857_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001026986.1|3599090_3600410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042516415.1|3600916_3601786_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_080335331.1|3602548_3602713_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003291015.1|3605508_3607692_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	29.2	4.9e-50
WP_000762778.1|3607929_3608112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996263.1|3608278_3609148_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000907090.1|3609332_3610325_-	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_000412934.1|3610545_3612039_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	40.4	1.1e-82
WP_000774089.1|3613138_3613318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123905.1|3615683_3616151_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.3	1.4e-47
WP_000391103.1|3616399_3618820_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.4	5.7e-92
WP_000761973.1|3618962_3619703_-	carboxylesterase	NA	NA	NA	NA	NA
WP_000557262.1|3619864_3620098_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000078306.1|3620192_3620885_-	LrgB family protein	NA	NA	NA	NA	NA
WP_000673222.1|3620881_3621250_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_001125041.1|3621525_3622476_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000103949.1|3622526_3623822_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	6.4e-183
WP_001231156.1|3623852_3625382_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001231037.1|3625378_3626134_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001036338.1|3626166_3627351_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000161236.1|3627490_3628495_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001258187.1|3628521_3629550_-	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000869728.1|3629686_3629932_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_000647969.1|3629941_3631249_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000216166.1|3631788_3631995_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_001228547.1|3632088_3632574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095399.1|3632603_3633080_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_000938963.1|3633080_3634097_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_000575924.1|3634093_3634444_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_000215914.1|3634455_3634662_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_000018934.1|3634682_3635552_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001049162.1|3635793_3636375_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.3e-55
WP_000250307.1|3636699_3636948_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
3636591:3636607	attR	TATCGACTTACCGACAA	NA	NA	NA	NA
WP_000006561.1|3636971_3637922_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.1	6.6e-52
WP_000712177.1|3638011_3638965_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.5	1.3e-63
WP_000138464.1|3638968_3639850_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.9	4.6e-07
WP_001190080.1|3639870_3640329_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000455203.1|3640557_3641364_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_001288072.1|3641526_3642483_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.9	1.4e-89
WP_000517726.1|3642567_3644079_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001255052.1|3644218_3644731_-	acetyltransferase	NA	NA	NA	NA	NA
WP_000700956.1|3644754_3645405_-	pyrophosphatase PpaX	NA	NA	NA	NA	NA
WP_000924246.1|3645472_3646285_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_001127244.1|3646309_3647239_-	HPr(Ser) kinase/phosphatase	NA	NA	NA	NA	NA
WP_001267308.1|3647395_3647776_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 5
NZ_CP009641	Bacillus cereus 03BB108 chromosome, complete genome	5342933	4327055	4335432	5342933		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625683.1|4327055_4328363_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
WP_001170540.1|4328451_4329171_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	2.0e-48
WP_000278823.1|4329163_4329418_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666792.1|4329414_4330098_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055577.1|4330081_4332301_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
WP_000879029.1|4332285_4333701_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_001994851.1|4333807_4334848_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	7.2e-68
WP_000088582.1|4334844_4335432_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	5.9e-27
>prophage 1
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	0	8439	281957	integrase	Bacillus_phage(100.0%)	7	NA	NA
WP_144405580.1|353_1358_+	foldase	NA	NA	NA	NA	NA
WP_001994467.1|1566_2049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001995810.1|2017_4198_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001995944.1|4227_5610_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001995894.1|5626_6163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001995794.1|6539_7013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001996052.1|7044_8439_-	type II DNA-methyltransferase	NA	A0A1P8CX13	Bacillus_phage	27.0	2.0e-17
>prophage 2
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	11771	12782	281957		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001995830.1|11771_12782_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	33.7	4.1e-36
>prophage 3
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	23964	38382	281957	integrase	Bacillus_phage(20.0%)	12	NA	NA
WP_001995766.1|23964_24318_-	hypothetical protein	NA	A0A1B1P774	Bacillus_phage	70.9	4.5e-46
WP_001995983.1|24430_24853_-	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
WP_001995939.1|24903_25770_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_042516219.1|25878_26370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001995833.1|26394_28881_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	32.0	4.0e-56
WP_001995961.1|29009_30662_-	AAA family ATPase	NA	G3MAX6	Bacillus_virus	40.7	5.2e-44
WP_001995871.1|30860_31541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001995952.1|31573_31852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001996028.1|31817_32885_-	acyltransferase	NA	NA	NA	NA	NA
WP_001995764.1|33047_34388_+	C40 family peptidase	NA	A0A2H4PI41	Streptomyces_phage	41.5	2.5e-20
WP_001995862.1|34425_35058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001995962.1|35145_38382_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1V0DZX6	Clostridioides_phage	47.6	1.1e-24
>prophage 4
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	44371	46204	281957		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000914978.1|44371_46204_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	1.7e-32
>prophage 5
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	81879	83217	281957		Streptococcus_phage(100.0%)	1	NA	NA
WP_001995921.1|81879_83217_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	44.8	6.4e-93
>prophage 6
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	99758	105366	281957		Bacillus_phage(66.67%)	7	NA	NA
WP_001996010.1|99758_100535_+	DUF2726 domain-containing protein	NA	A0A223G0T1	Staphylococcus_phage	31.6	8.4e-21
WP_001995905.1|100895_101432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995843.1|101498_102971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995736.1|103089_103536_+	YopX protein	NA	H0USU9	Bacillus_phage	49.6	1.7e-29
WP_001995749.1|103532_103964_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001996017.1|103999_104290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996040.1|104676_105366_+	hypothetical protein	NA	A0A068EMK6	Bacillus_phage	52.2	1.3e-60
>prophage 7
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	111758	115923	281957		Bacillus_phage(100.0%)	3	NA	NA
WP_001996005.1|111758_112370_+	hypothetical protein	NA	S6ATW0	Bacillus_phage	31.6	1.3e-05
WP_042516228.1|112510_113488_+	hypothetical protein	NA	R4JGN0	Bacillus_phage	31.7	3.7e-34
WP_042516229.1|113658_115923_+	DNA translocase FtsK	NA	R4JMR0	Bacillus_phage	31.5	2.4e-84
>prophage 8
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	121587	121842	281957		Bacillus_phage(100.0%)	1	NA	NA
WP_001995910.1|121587_121842_-	hypothetical protein	NA	A0A218KBU4	Bacillus_phage	41.5	2.0e-11
>prophage 9
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	130202	130574	281957		Bacillus_phage(100.0%)	1	NA	NA
WP_001996002.1|130202_130574_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A217ER62	Bacillus_phage	47.1	2.1e-25
>prophage 10
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	135524	142968	281957	integrase	Bacillus_phage(33.33%)	7	135290:135306	150130:150146
135290:135306	attL	TATAATTAAAATCTTTT	NA	NA	NA	NA
WP_001995771.1|135524_136793_+	DNA repair protein MucB	NA	O64031	Bacillus_phage	47.4	6.9e-97
WP_017562367.1|136940_137285_-	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
WP_001994100.1|137397_138225_-	collagen-like protein	NA	NA	NA	NA	NA
WP_001082942.1|138351_139059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000205101.1|139359_139740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824133.1|139732_141838_-|integrase	tyrosine-type recombinase/integrase	integrase	L7TK95	Rhizobium_phage	27.0	8.4e-07
WP_001265872.1|141849_142968_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	26.8	2.3e-11
150130:150146	attR	AAAAGATTTTAATTATA	NA	NA	NA	NA
>prophage 11
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	146427	148799	281957		Tupanvirus(50.0%)	3	NA	NA
WP_001996049.1|146427_147822_+	HAMP domain-containing histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	27.2	2.0e-09
WP_001995958.1|147793_148372_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001995811.1|148598_148799_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPK3	Marinitoga_camini_virus	44.3	4.8e-05
>prophage 12
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	152612	154244	281957		Streptococcus_virus(100.0%)	1	NA	NA
WP_001995857.1|152612_154244_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	34.6	2.5e-51
>prophage 13
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	157521	163079	281957	integrase	Lactobacillus_phage(33.33%)	4	148427:148441	171572:171586
148427:148441	attL	TTTTTTACCCTCCCC	NA	NA	NA	NA
WP_001994662.1|157521_159387_-	hypothetical protein	NA	A0A0A7NNI1	Lactobacillus_phage	42.9	8.1e-86
WP_001994655.1|159465_159846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001994650.1|159842_161945_-|integrase	tyrosine-type recombinase/integrase	integrase	L7TK95	Rhizobium_phage	28.1	8.4e-07
WP_001994656.1|161963_163079_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIE1	Clostridium_phage	26.4	3.2e-13
171572:171586	attR	GGGGAGGGTAAAAAA	NA	NA	NA	NA
>prophage 14
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	167329	176391	281957		Geobacillus_virus(40.0%)	8	NA	NA
WP_001995840.1|167329_168361_+	hypothetical protein	NA	A0A0H3UZB6	Geobacillus_virus	28.5	7.3e-12
WP_001996059.1|168452_168845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995834.1|168923_170879_+	hypothetical protein	NA	A0A0H3UZB6	Geobacillus_virus	25.9	4.0e-19
WP_001995889.1|170908_171568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995992.1|171585_172827_+	glutathionylspermidine synthase family protein	NA	A0A219Y9C1	Aeromonas_phage	27.5	5.8e-24
WP_001996055.1|173022_173730_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001995760.1|174330_175098_-	polysaccharide deacetylase family protein	NA	A0A2K9L357	Tupanvirus	25.9	3.3e-09
WP_000383890.1|175545_176391_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	45.1	1.8e-24
>prophage 15
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	181120	182275	281957	integrase	Clostridium_phage(100.0%)	1	170105:170119	185459:185473
170105:170119	attL	CTTTAAATACTTTGA	NA	NA	NA	NA
WP_001265869.1|181120_182275_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	30.4	2.6e-10
WP_001265869.1|181120_182275_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	30.4	2.6e-10
185459:185473	attR	CTTTAAATACTTTGA	NA	NA	NA	NA
>prophage 16
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	186752	187622	281957		Salisaeta_icosahedral_phage(100.0%)	1	NA	NA
WP_001995925.1|186752_187622_+	RNA polymerase sigma factor RpoD/SigA	NA	I1ZBD5	Salisaeta_icosahedral_phage	26.4	9.4e-13
>prophage 17
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	203594	205083	281957		Synechococcus_phage(50.0%)	2	NA	NA
WP_001995937.1|203594_204578_+	DNA adenine methylase	NA	A0A0E3I2Y7	Synechococcus_phage	22.6	1.3e-05
WP_001996019.1|204612_205083_+	hypothetical protein	NA	A0A291AX77	Salmonella_phage	27.0	4.6e-06
>prophage 18
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	210580	229574	281957	transposase	Bacillus_phage(33.33%)	23	NA	NA
WP_001995788.1|210580_210862_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	65.6	1.2e-14
WP_001996037.1|210897_211191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995897.1|211436_211625_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001995765.1|211649_212222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001995918.1|213031_214447_+	DNA cytosine methyltransferase	NA	A0A1I9KFD6	Aeromonas_phage	46.2	1.4e-122
WP_001995965.1|214510_214723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996047.1|214719_215142_+	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	77.9	2.2e-60
WP_001996033.1|215312_215534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995887.1|215838_216510_+	hypothetical protein	NA	U5PS65	Bacillus_phage	34.5	7.7e-31
WP_001996027.1|216500_216797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995769.1|218149_219319_+	serine hydrolase	NA	A0A1I9S919	Mycobacterium_phage	27.6	2.2e-20
WP_001996008.1|219584_219833_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_042516243.1|220187_220571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001995883.1|220686_221199_-	DUF1572 family protein	NA	NA	NA	NA	NA
WP_001995726.1|221246_221918_-	HAD family hydrolase	NA	Q6VY93	Streptomyces_phage	32.5	6.6e-06
WP_001995975.1|222239_222662_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_001995951.1|222787_223357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001996013.1|223665_224580_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_001995722.1|224847_225390_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	42.4	6.2e-31
WP_001996058.1|225435_228384_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.5	7.2e-81
WP_042516244.1|228675_228882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995753.1|228980_229334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995994.1|229358_229574_+	hypothetical protein	NA	A0A0A7AQI6	Bacillus_phage	71.8	3.9e-21
>prophage 19
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	242162	246628	281957		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001995648.1|242162_244001_+	maturase	NA	A0A0U4J920	Pseudomonas_phage	36.1	8.4e-27
WP_001995783.1|245647_246628_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	30.7	8.4e-26
>prophage 20
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	250019	255548	281957		Acinetobacter_phage(50.0%)	4	NA	NA
WP_000412934.1|250019_251513_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	40.4	1.1e-82
WP_000907090.1|251733_252726_+	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_000762778.1|252944_253127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003291015.1|253364_255548_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	29.2	4.9e-50
>prophage 21
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	276407	276806	281957		Bacillus_phage(100.0%)	1	NA	NA
WP_001995895.1|276407_276806_+	hypothetical protein	NA	A0A218KC39	Bacillus_phage	41.2	3.0e-14
>prophage 22
NZ_CP009639	Bacillus cereus 03BB108 plasmid pBFI_1, complete sequence	281957	280304	281588	281957		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001996016.1|280304_281588_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	32.9	2.1e-45
>prophage 1
NZ_CP009638	Bacillus cereus 03BB108 plasmid pBFI_4, complete sequence	61862	167	28953	61862	capsid,portal	Bacillus_phage(66.67%)	38	NA	NA
WP_001995604.1|167_1097_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	72.0	1.5e-120
WP_000746380.1|1118_2129_-	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	35.5	5.9e-51
WP_001995617.1|2175_3102_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	35.6	2.4e-46
WP_001995603.1|3088_4627_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	39.0	1.7e-94
WP_144405579.1|5719_6229_-	hypothetical protein	NA	A0A2R4P8H7	Staphylococcus_phage	49.7	3.3e-42
WP_000810415.1|6898_7693_-	hypothetical protein	NA	D2XPX8	Bacillus_virus	72.7	4.8e-72
WP_001995624.1|8295_8973_-	GIY-YIG nuclease family protein	NA	D2XPX7	Bacillus_virus	37.9	2.0e-42
WP_001995611.1|8985_9570_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	48.6	7.7e-27
WP_001995620.1|10072_10348_-	hypothetical protein	NA	A0A142F1A2	Bacillus_phage	50.6	4.0e-18
WP_042516211.1|10453_10789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000529719.1|12222_12852_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	60.5	4.5e-49
WP_001114347.1|12854_13034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001996385.1|13594_14218_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_001996395.1|14302_14461_-	hypothetical protein	NA	A0A0A7AR63	Bacillus_phage	58.8	8.7e-10
WP_001996401.1|14706_14952_-	hypothetical protein	NA	A0A0S2MVC7	Bacillus_phage	58.0	7.2e-19
WP_001996379.1|14987_15452_-	hypothetical protein	NA	A0A1S6KV15	Providencia_phage	28.8	1.6e-06
WP_001996388.1|15768_16371_-	hypothetical protein	NA	A0A0S2SXN5	Bacillus_phage	43.6	7.1e-44
WP_001996427.1|16411_16621_-	hypothetical protein	NA	I1TLG8	Bacillus_phage	100.0	6.1e-35
WP_001053654.1|16828_17275_-	dUTP diphosphatase	NA	A0A0U3SLD3	Bacillus_phage	90.5	2.5e-70
WP_000434343.1|17523_17649_-	Fur-regulated basic protein FbpA	NA	A0A1B1P8B6	Bacillus_phage	75.6	2.4e-10
WP_001996422.1|17657_18371_-	hypothetical protein	NA	B5LPM7	Bacillus_virus	50.8	6.9e-38
WP_000811957.1|18382_18646_-	hypothetical protein	NA	A0A1B1P7U6	Bacillus_phage	64.4	7.2e-25
WP_042329751.1|18642_18888_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	89.7	1.3e-31
WP_000332351.1|18844_19108_-	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	70.7	3.8e-18
WP_041184387.1|19120_20002_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	55.2	1.9e-85
WP_000073890.1|19952_20768_-	replication protein	NA	A0A1W6JP67	Staphylococcus_phage	54.5	1.4e-58
WP_000487938.1|20768_20990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043060.1|21189_21864_-	ERF family protein	NA	A0A0M3ULL1	Bacillus_phage	57.9	2.5e-61
WP_000780697.1|21860_22343_-	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	51.2	9.4e-39
WP_001006520.1|22962_23733_-	phage antirepressor Ant	NA	A0A2H4PQV4	Staphylococcus_phage	45.1	4.2e-57
WP_080011779.1|23772_23994_-	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	50.0	7.4e-07
WP_000578778.1|24125_24476_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	49.6	6.9e-23
WP_000721629.1|24800_24950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189353.1|24989_26138_-	hypothetical protein	NA	A0A0S2MVK2	Bacillus_phage	33.8	1.8e-51
WP_000859164.1|26634_26982_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	46.3	8.3e-21
WP_000448836.1|27186_27891_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	90.4	2.7e-58
WP_000831284.1|27910_28255_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	80.7	2.0e-43
WP_000451516.1|28389_28953_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	50.0	1.6e-37
>prophage 2
NZ_CP009638	Bacillus cereus 03BB108 plasmid pBFI_4, complete sequence	61862	44331	58873	61862	tail,holin,plate,integrase	Bacillus_virus(30.0%)	12	44618:44632	59651:59665
WP_000824133.1|44331_46437_-|integrase	tyrosine-type recombinase/integrase	integrase	L7TK95	Rhizobium_phage	27.0	8.4e-07
44618:44632	attL	CAATCTCCTTTTAAT	NA	NA	NA	NA
WP_001265872.1|46448_47567_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	26.8	2.3e-11
WP_001995606.1|47790_48072_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_001995612.1|48241_49150_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	41.9	4.3e-16
WP_001173690.1|49162_49516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001995628.1|49712_50462_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7G0	Bacillus_phage	83.4	2.4e-121
WP_001995618.1|50461_50887_-|holin	phage holin family protein	holin	D2XPZ9	Bacillus_virus	97.9	6.3e-71
WP_001995605.1|50928_51600_-	hypothetical protein	NA	A0A1B1P805	Bacillus_phage	62.7	3.9e-51
WP_001995614.1|51613_52939_-|plate	BppU family phage baseplate upper protein	plate	B5LPS6	Bacillus_virus	50.2	1.1e-105
WP_001995608.1|52953_55254_-	peptidase S74	NA	A0A2P1JTV8	Anoxybacillus_phage	56.4	1.2e-128
WP_001995610.1|55265_56147_-|tail	phage tail family protein	tail	A0A2P1JTW0	Anoxybacillus_phage	47.2	4.8e-73
WP_001995622.1|56146_58873_-|tail	tail length tape measure protein	tail	B5LPS3	Bacillus_virus	46.4	9.4e-75
59651:59665	attR	CAATCTCCTTTTAAT	NA	NA	NA	NA
>prophage 1
NZ_CP009637	Bacillus cereus 03BB108 plasmid pBFI_5, complete sequence	42470	0	26751	42470	holin	Bacillus_phage(63.64%)	40	NA	NA
WP_001996374.1|1250_2027_-	hypothetical protein	NA	A0A1L2JY44	Aeribacillus_phage	55.3	8.3e-61
WP_042516204.1|2564_2819_-	hypothetical protein	NA	B5LPQ5	Bacillus_virus	84.4	5.5e-14
WP_001996382.1|2986_3178_-	hypothetical protein	NA	B5LPQ3	Bacillus_virus	87.7	9.8e-24
WP_000441079.1|4135_4507_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	48.8	1.8e-21
WP_000529719.1|4644_5274_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	60.5	4.5e-49
WP_001114347.1|5276_5456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001996385.1|6016_6640_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_001996395.1|6724_6883_-	hypothetical protein	NA	A0A0A7AR63	Bacillus_phage	58.8	8.7e-10
WP_001996401.1|7128_7374_-	hypothetical protein	NA	A0A0S2MVC7	Bacillus_phage	58.0	7.2e-19
WP_001996379.1|7409_7874_-	hypothetical protein	NA	A0A1S6KV15	Providencia_phage	28.8	1.6e-06
WP_001996388.1|8190_8793_-	hypothetical protein	NA	A0A0S2SXN5	Bacillus_phage	43.6	7.1e-44
WP_001996427.1|8833_9043_-	hypothetical protein	NA	I1TLG8	Bacillus_phage	100.0	6.1e-35
WP_001053654.1|9250_9697_-	dUTP diphosphatase	NA	A0A0U3SLD3	Bacillus_phage	90.5	2.5e-70
WP_000434343.1|9945_10071_-	Fur-regulated basic protein FbpA	NA	A0A1B1P8B6	Bacillus_phage	75.6	2.4e-10
WP_001996422.1|10079_10793_-	hypothetical protein	NA	B5LPM7	Bacillus_virus	50.8	6.9e-38
WP_000811957.1|10804_11068_-	hypothetical protein	NA	A0A1B1P7U6	Bacillus_phage	64.4	7.2e-25
WP_080014233.1|11064_11310_-	helix-turn-helix domain containing protein	NA	A0A1B1P7W1	Bacillus_phage	83.3	2.0e-29
WP_001996375.1|11365_11761_-	hypothetical protein	NA	E5DV95	Deep-sea_thermophilic_phage	51.6	1.9e-29
WP_001996387.1|11773_11986_-	hypothetical protein	NA	A6M987	Geobacillus_virus	50.0	1.7e-08
WP_001996394.1|11990_13298_-	replicative DNA helicase	NA	A6M986	Geobacillus_virus	39.1	2.2e-82
WP_080335328.1|13308_14031_-	hypothetical protein	NA	A0A1B1P7G4	Bacillus_phage	50.4	4.2e-59
WP_001996417.1|14064_14298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001996413.1|14317_14932_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	48.1	4.2e-31
WP_001996418.1|15127_15328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001996406.1|15795_15975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144405577.1|15971_16673_-	hypothetical protein	NA	A8ASM6	Listeria_phage	52.5	2.8e-31
WP_001996424.1|16767_16968_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P7V5	Bacillus_phage	97.0	3.1e-28
WP_001996400.1|17179_17530_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P8C2	Bacillus_phage	65.5	9.3e-36
WP_001996391.1|18017_19145_-	hypothetical protein	NA	D2XQ10	Bacillus_virus	45.3	4.6e-84
WP_001996414.1|19611_19956_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	99.1	1.2e-56
WP_001996421.1|20147_20621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001996411.1|20622_21153_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001996403.1|21476_22535_+	hypothetical protein	NA	A0A1B1P784	Bacillus_phage	50.3	2.5e-28
WP_001996415.1|22847_23879_+	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	98.8	5.8e-195
WP_042516206.1|23838_24165_+	hypothetical protein	NA	D2XQ05	Bacillus_virus	93.5	1.6e-50
WP_001996381.1|24293_24674_+	hypothetical protein	NA	A0A1B1P8B2	Bacillus_phage	94.4	2.2e-59
WP_001996393.1|24685_25216_+	hypothetical protein	NA	A0A1B1P8A3	Bacillus_phage	96.6	1.1e-93
WP_000539769.1|25302_25536_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	100.0	7.3e-37
WP_042516207.1|25576_26326_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7G0	Bacillus_phage	84.2	9.0e-121
WP_001996432.1|26325_26751_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	87.2	5.7e-64
>prophage 2
NZ_CP009637	Bacillus cereus 03BB108 plasmid pBFI_5, complete sequence	42470	30243	42457	42470	portal,capsid,head,tail	Bacillus_phage(25.0%)	15	NA	NA
WP_001996409.1|30243_31863_-	hypothetical protein	NA	A0A0K1LLF9	Bacillus_phage	35.5	1.4e-89
WP_001996399.1|31871_32690_-|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	53.1	2.5e-71
WP_001996383.1|32695_35428_-|tail	phage tail tape measure protein	tail	A0A2H4JI37	uncultured_Caudovirales_phage	51.1	1.5e-85
WP_001996396.1|35427_35703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001996378.1|35726_36137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001996389.1|36139_36664_-|tail	tail protein	tail	NA	NA	NA	NA
WP_001996428.1|36665_37073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001996376.1|37065_37494_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_001996434.1|37477_37795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001996429.1|37791_38133_-|head,tail	phage head-tail connector protein	head,tail	A0A097PAS2	Streptococcus_pyogenes_phage	37.6	8.5e-10
WP_000729227.1|38135_38315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001996373.1|38332_39271_-	DUF5309 family protein	NA	W0XA97	Pseudomonas_phage	28.6	4.3e-19
WP_001996398.1|39285_39924_-	DUF4355 domain-containing protein	NA	A0A1L2K2N1	Aeribacillus_phage	30.1	2.1e-09
WP_001996386.1|40029_40845_-|capsid	minor capsid protein	capsid	A0A141E1Y0	Streptococcus_phage	39.2	2.2e-32
WP_001996425.1|40963_42457_-|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	32.9	1.4e-48
