The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009628	Bacillus cereus ATCC 4342 chromosome, complete genome	5269496	100971	165274	5269496	tail,integrase,tRNA,portal,bacteriocin,protease,head,capsid,terminase	Bacillus_phage(63.16%)	68	135920:135936	169528:169544
WP_000753403.1|100971_102039_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	92.6	1.3e-192
WP_000254143.1|102035_102275_-	hypothetical protein	NA	A0A2H4J378	uncultured_Caudovirales_phage	94.9	4.7e-31
WP_000398745.1|102274_102511_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	96.2	1.5e-18
WP_001260170.1|102549_106545_-	hypothetical protein	NA	Q2LIB7	Bacillus_phage	97.6	0.0e+00
WP_000517348.1|106541_108032_-	hypothetical protein	NA	Q2LIB8	Bacillus_phage	99.8	3.6e-294
WP_001262735.1|108046_111877_-|tail	phage tail tape measure protein	tail	A0A288WG36	Bacillus_phage	92.9	0.0e+00
WP_000778621.1|112098_112413_-	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	96.2	2.0e-50
WP_000896779.1|112462_113071_-|tail	tail protein	tail	A0A288WG55	Bacillus_phage	98.0	1.8e-103
WP_000609199.1|113071_113431_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	95.0	4.7e-59
WP_000763227.1|113427_113865_-	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	98.6	1.5e-75
WP_001068014.1|113857_114181_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	90.7	5.0e-52
WP_000244595.1|114177_114456_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	95.6	9.9e-41
WP_000361135.1|114476_115649_-|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	89.0	2.5e-194
WP_001259157.1|115686_116397_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	94.9	4.8e-124
WP_000577487.1|116383_117637_-|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	96.4	9.1e-235
WP_000621125.1|117825_119520_-|terminase	terminase large subunit	terminase	A0A2H4JB98	uncultured_Caudovirales_phage	98.6	6.9e-310
WP_000251639.1|119521_120025_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J8E3	uncultured_Caudovirales_phage	98.8	2.6e-87
WP_001139458.1|120154_120532_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	96.8	3.8e-67
WP_001198491.1|120521_120776_-	hypothetical protein	NA	A0A0S2GLL6	Bacillus_phage	83.3	2.0e-35
WP_000777414.1|120794_121001_-	hypothetical protein	NA	H0USV9	Bacillus_phage	86.8	1.1e-25
WP_162484126.1|121000_121156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000773979.1|121298_121679_+	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	45.2	5.9e-20
WP_000127963.1|121675_121909_-	hypothetical protein	NA	A0A0K2CZF4	Paenibacillus_phage	38.4	7.3e-05
WP_001209235.1|122283_123180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033685975.1|123816_124203_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_002021487.1|124295_125426_+	S8 family serine peptidase	NA	A0A2L0UZX3	Agrobacterium_phage	27.3	7.0e-08
WP_000158572.1|126546_127251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001012105.1|127922_128465_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	88.9	6.8e-86
WP_000166203.1|128464_128947_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	7.7e-73
WP_002021485.1|129260_129383_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000227777.1|130134_130362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343917.1|131339_132485_+	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_001054606.1|132666_133176_-	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	44.8	2.0e-26
WP_000109493.1|133195_133447_-	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	43.8	1.7e-07
WP_000717820.1|133472_133640_-	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	64.2	1.8e-13
WP_001125953.1|133658_134018_-	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	52.5	1.4e-31
WP_000799079.1|134010_134289_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	62.7	6.0e-14
WP_000337989.1|134305_134500_-	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	82.8	1.5e-24
WP_001148232.1|134502_135366_-	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	92.9	4.2e-130
WP_000190241.1|135313_136036_-	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	87.1	3.0e-89
135920:135936	attL	TAACGATAAAATGTAAG	NA	NA	NA	NA
WP_000522016.1|136393_136660_-	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	84.7	1.9e-33
WP_048567700.1|136781_136991_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000041816.1|137159_137498_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	54.3	3.6e-21
WP_000527328.1|137517_137658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001045097.1|137940_139038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033692786.1|139656_140859_-	collagen-like protein	NA	NA	NA	NA	NA
WP_000675848.1|141163_142273_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	78.1	2.2e-147
WP_000359666.1|142341_143013_-	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_033686146.1|143314_143800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001071397.1|144327_144627_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000144499.1|145273_145963_-	thiaminase II	NA	NA	NA	NA	NA
WP_001219729.1|146263_147178_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_000471633.1|147182_148631_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000695917.1|148907_149948_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000517047.1|150035_151277_-	lipase	NA	NA	NA	NA	NA
WP_001165505.1|151531_151873_+	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
WP_000753239.1|151941_152607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000144185.1|152674_154609_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000404272.1|154583_155354_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	2.1e-32
WP_000547458.1|155668_156205_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_033692787.1|156644_157238_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033686435.1|157258_158887_-	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	30.2	2.9e-55
WP_000376269.1|159431_160058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000593186.1|160359_161343_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000238967.1|161339_162047_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000285749.1|162167_163082_-	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_001128415.1|163233_163662_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_002022941.1|163852_165274_-|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
169528:169544	attR	CTTACATTTTATCGTTA	NA	NA	NA	NA
>prophage 2
NZ_CP009628	Bacillus cereus ATCC 4342 chromosome, complete genome	5269496	776851	786171	5269496		Bacillus_phage(71.43%)	9	NA	NA
WP_001258498.1|776851_777724_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	42.9	4.0e-64
WP_000061719.1|777856_778534_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	88.5	5.5e-61
WP_000818985.1|778681_779401_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000823555.1|779597_780182_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_001254410.1|780205_781279_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	89.6	3.5e-174
WP_139254152.1|781275_781980_-	response regulator	NA	W8CYM9	Bacillus_phage	92.7	6.5e-121
WP_000453899.1|782041_783802_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	96.9	1.1e-270
WP_001194292.1|784041_784806_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755549.1|784902_786171_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	7.6e-11
>prophage 3
NZ_CP009628	Bacillus cereus ATCC 4342 chromosome, complete genome	5269496	2307153	2315525	5269496		Synechococcus_phage(50.0%)	8	NA	NA
WP_000088567.1|2307153_2307741_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.8	5.9e-27
WP_001262445.1|2307737_2308778_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	3.2e-68
WP_000879025.1|2308879_2310295_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_000055573.1|2310279_2312499_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.7	2.6e-163
WP_000666779.1|2312482_2313166_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278820.1|2313162_2313417_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170542.1|2313409_2314129_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000625683.1|2314217_2315525_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
>prophage 4
NZ_CP009628	Bacillus cereus ATCC 4342 chromosome, complete genome	5269496	2359141	2367089	5269496		Bacillus_phage(33.33%)	6	NA	NA
WP_000719215.1|2359141_2360647_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	1.2e-31
WP_000929888.1|2360630_2361332_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_000833097.1|2361477_2362803_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	9.2e-44
WP_000743900.1|2363185_2364724_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	2.6e-21
WP_001029999.1|2365131_2366766_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
WP_000917306.1|2366804_2367089_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.2e-20
>prophage 5
NZ_CP009628	Bacillus cereus ATCC 4342 chromosome, complete genome	5269496	5221955	5230903	5269496	transposase	Geobacillus_phage(28.57%)	11	NA	NA
WP_098228759.1|5221955_5223300_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	2.1e-112
WP_000820165.1|5223356_5223569_-	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	54.4	1.1e-12
WP_000714670.1|5223571_5224957_-	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	59.9	1.7e-77
WP_000288951.1|5225387_5225795_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000648514.1|5225808_5226162_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000655485.1|5226183_5226891_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.0	3.9e-17
WP_001093429.1|5226956_5227352_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_000502493.1|5227367_5228297_+	phosphotransferase	NA	NA	NA	NA	NA
WP_000720537.1|5228293_5228797_+	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	45.5	3.3e-42
WP_001058132.1|5228943_5229624_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	39.2	2.7e-31
WP_000124910.1|5229709_5230903_+	glycosyl transferase family 1	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	27.9	3.7e-07
>prophage 1
NZ_CP009627	Bacillus cereus ATCC 4342 plasmid pBGM, complete sequence	36802	0	4467	36802		Bacillus_phage(100.0%)	3	NA	NA
WP_001258080.1|431_1175_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000609083.1|1190_1928_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000473623.1|2310_4467_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.6	1.5e-35
>prophage 2
NZ_CP009627	Bacillus cereus ATCC 4342 plasmid pBGM, complete sequence	36802	12864	14973	36802	integrase	Bacillus_phage(50.0%)	3	2234:2256	28350:28372
2234:2256	attL	ATTTTACTAATTGTTATTAACAT	NA	NA	NA	NA
WP_000594390.1|12864_13437_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	42.4	1.0e-31
WP_001140760.1|13775_14150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018648.1|14151_14973_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	44.2	2.8e-51
28350:28372	attR	ATTTTACTAATTGTTATTAACAT	NA	NA	NA	NA
>prophage 3
NZ_CP009627	Bacillus cereus ATCC 4342 plasmid pBGM, complete sequence	36802	19663	20425	36802		Planktothrix_phage(100.0%)	1	NA	NA
WP_001075616.1|19663_20425_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	2.9e-34
>prophage 4
NZ_CP009627	Bacillus cereus ATCC 4342 plasmid pBGM, complete sequence	36802	34951	36400	36802		Bacillus_phage(100.0%)	1	NA	NA
WP_000811517.1|34951_36400_+	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	27.5	4.6e-20
